Guide rna, kit, method and application targeting stat3 gene
By using guide RNA targeting the STAT3 gene and the CRISPR/Cas9 system, mutations in the ΔS isoform of the STAT3 gene were achieved, and stable cell and animal models were constructed. This solved the problem of the lack of effective targets in IBD treatment and improved the ability to study the pathogenesis of IBD.
Patent Information
- Application Number
- CN202211034357.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-26
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2042-08-26
AI Technical Summary
Current technologies lack effective drug targets for the treatment of inflammatory bowel disease (IBD). Long-term drug use can lead to drug resistance or serious side effects. Surgical treatment has a high recurrence rate, and there is a lack of stable STAT3 gene ΔS subtype mutant cells and animal models for studying the pathogenesis of the disease.
We designed a guide RNA targeting the junction of intron 21 and exon 22 of the STAT3 gene, and used the CRISPR/Cas9 system for gene editing to achieve the ΔS isotype mutation of the STAT3 gene, and constructed stable ΔS isotype mutant cell lines and animal models.
It provides stable STAT3ΔS subtype mutant cell and animal models for studying the pathogenesis of IBD and related diseases, improves gene editing efficiency, avoids homologous sequence editing of non-target segments, and achieves specific subtype mutations of STAT3 protein.
Smart Images

Figure CN116064526B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biotechnology of STAT3 gene editing, and in particular to guide RNAs, kits, methods and applications targeting the STAT3 gene. Background Technology
[0002] Signal transducer and activator of transcription (STAT3) is a family of proteins with DNA-binding activity. The STAT family includes seven proteins with known structure and function associations: STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6. Among them, STAT3 is a significant nuclear transcription factor that affects the expression of more than 1,000 gene products.
[0003] The NCBI database shows that STAT3 produces four different protein isoforms based on alternative splicing of introns at positions 21 and 23: αFL, βFL, αΔS701, and βΔS701. Further, based on the presence or absence of serine 701, STAT3 proteins can be divided into those containing serine 701 (Full-length / FL isoform) and those lacking serine 701 (ΔS isoform). In human and mouse leukocytes, the ΔS isoform accounts for approximately 20% of the total, and the constant presence of the ΔS isoform suggests that the function of the STAT3 protein is jointly determined by the ΔS and FL isoforms.
[0004] Inflammatory bowel disease (IBD) is a group of chronic and relapsing nonspecific inflammatory diseases of the intestine caused by a variety of etiologies and abnormal immune-mediated processes. The main types include Crohn's disease (CD) and ulcerative colitis (UC).
[0005] Treatment for IBD primarily includes general therapy, drug therapy, and surgical treatment. General therapy mainly targets the early stages of the disease, employing methods such as regular sleep patterns, dietary interventions, and antibiotics. Drug therapy primarily uses medications such as salicylates, corticosteroids, and immunosuppressants to reduce the production of inflammatory factors; however, long-term continuous administration can lead to drug resistance or severe side effects. Surgical treatment is suitable for cases where medical treatment is ineffective or complications arise (intestinal obstruction, fistula, abscess formation, acute perforation, or uncontrollable massive bleeding), but postoperative recurrence rates are high. Therefore, in-depth research into the pathogenesis and disease progression of IBD is of significant theoretical and practical importance for identifying new and effective drug targets.
[0006] STAT3 protein has been repeatedly reported to play an important role in IBD by participating in the differentiation and maturation of immune cells. For example, a recent study published in Nature by Zhang M et al. showed that the reversible palmitoylation cycle of cysteine at position 108 of STAT3 can promote T cells. H 17. Cell differentiation and colitis: A study published in Nature Communications by Academician Shu Hongbing's team shows that TRIM27 mediates the activation of STAT3, a reverse transcriptase-positive structure, promoting colitis and colitis-related carcinogenesis. Summary of the Invention
[0007] Therefore, this application provides a guide RNA that can target and guide CRISPR effector proteins to cleave at specific sites on the STAT3 gene. Based on the targeting ability of this guide RNA and the "GT-AG" pattern of intron splicing, it provides guide RNA, kits, methods, and applications for STAT3 gene editing. This enables the establishment of stable, reproducible ΔS subtype mutant cell lines or genetically engineered animals of the STAT3 gene, serving as cell and animal models for studying the pathogenesis of STAT3-related diseases (e.g., tumors, metabolic diseases, inflammatory bowel disease, cardiovascular diseases), which has significant practical implications. Therefore, this application discloses at least the following technical solutions:
[0008] In a first aspect, embodiments of this application disclose a guide RNA applied to a gene editing method or kit for CRISPR / Cas9, wherein the guide RNA targets the junction of intron 21 and exon 21 of the STAT3 gene, and the guide RNA comprises any one of (I) to (IV):
[0009] (I) Having a nucleotide sequence as shown in SEQ ID NO:3 or 4;
[0010] (II) RNA molecules that hybridize with the RNA sequence defined in (I) under strict conditions and have the same targeting function;
[0011] (III) RNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the RNA sequence defined in (I) and have the same targeting function;
[0012] (IV) A vector comprising the nucleotide sequence shown in SEQ ID NO:3 or 4 and having the same targeting function, or a vector comprising the nucleotide sequence shown in (II) or (III) and having the same targeting function.
[0013] Secondly, embodiments of this application disclose a gene editing kit, which performs gene editing on the 5' end of intron 21 of the STAT3 gene. The kit includes:
[0014] CRISPR effector proteins or expression constructs containing nucleotide sequences encoding CRISPR effector proteins;
[0015] The guide RNA described in the first aspect, wherein the guide RNA binds to the CRISPR effector protein to form a complex, the complex targeting and recognizing the junction of exon 21 and intron 21 of the STAT3 gene, and cleaving at the junction of exon 21 and intron 21; and
[0016] Donor, providing the nucleotide sequence for gene editing at the 5' end of intron 21 of the STAT3 gene;
[0017] The donor is selected from any one of (A) to (D):
[0018] (A) The nucleotide sequence shown in SEQ ID NO:5;
[0019] (B) DNA molecules that hybridize with the DNA sequence defined in (A) under strict conditions and have the same function;
[0020] (C) and (A) define an RNA sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology and has the same function as the DNA molecule.
[0021] (D) A vector comprising the nucleotide sequence shown in SEQ ID NO:5 and having the same function, or a vector comprising the nucleotide sequence shown in (B) or (C) and having the same function.
[0022] Thirdly, embodiments of this application disclose a method for editing the STAT3 gene in cells, comprising:
[0023] Culture recipient cells;
[0024] Prepare the gene editing kit described in the second aspect;
[0025] The gene editing is introduced into the recipient cells via electroporation, liposomes, virology, transposonization, nanoparticles, gene gun, chemical induction, or microinjection to obtain a mutant line of STAT3 gene cells.
[0026] Fourthly, embodiments of this application disclose a method for STAT3 gene editing, used to construct genetically engineered animal models of the STAT3ΔS subtype, wherein the method includes:
[0027] Culture recipient animals;
[0028] Prepare the gene editing kit described in the second aspect;
[0029] The gene editing kit was introduced into the fertilized eggs of the recipient animal to obtain F0 generation model animals; and
[0030] The F0 generation model animals were bred and identified to obtain the genetically engineered model animals.
[0031] Fifthly, embodiments of this application disclose the application of at least one of the following: the guide RNA described in the first aspect and the gene editing kit described in the second aspect:
[0032] Application in constructing ΔS subtype mutant cell lines of the STAT3 gene;
[0033] Application of constructing an engineered animal model of the ΔS subtype mutant of the STAT3 gene;
[0034] The cells are selected from at least one of fertilized egg cells, colon cancer cells, intestinal epithelial cells, intestinal stem cells, cardiomyocytes, hepatocytes, spleen cells, lung stem cells, embryonic kidney cells, cervical cancer cells, embryonic stem cells, hematopoietic stem cells, progenitor cells, T cells, TCR-T cells or CAR-T cells;
[0035] The animals are selected from at least one of the following: C57BL / 6J mice, BALB / C mice, BALB / C-nu / nu mice, DBA / 1 mice, SD rats, Wistar rats, Lewis rats, guinea pigs, rabbits, dogs, or sheep. Attached Figure Description
[0036] Figure 1 This is a schematic diagram of the construction scheme of the STAT3ΔS subtype gene-edited mouse model provided in the embodiments of this application.
[0037] Figure 2 The specificity and target efficiency prediction results of the guide RNA provided in the embodiments of this application.
[0038] Figure 3 Another guide RNA specificity and target efficiency prediction result provided for embodiments of this application.
[0039] Figure 4 This is a schematic diagram of the PCR identification method for the STAT3ΔS subtype gene mouse provided in the embodiments of this application.
[0040] Figure 5 A diagram showing the genotype identification results of the STAT3ΔS subtype F1 generation mice provided in the embodiments of this application; Figure 5 a represents the agarose gel electrophoresis results of PCR products from F1 generation mice. The mice are numbered 51, 52, 53, and 57 from left to right. N represents the negative control, and M represents the DNA Marker. Figure 5 b represents the sequencing sequence alignment result; where the number is the mouse tail number, Wildtype / WT is the C57BL / 6J wild type, and Mutant is the genotype.
[0041] Figure 6 This is a comparison of sequencing results between STAT3ΔS homozygous mice and WT mice provided in the embodiments of this application.
[0042] Figure 7 A comparison of body weight between DSS-induced ΔS homozygous mice and WT mice provided in the embodiments of this application.
[0043] Figure 8 A comparison of survival time between DSS-induced ΔS homozygous mice and WT mice provided in the embodiments of this application.
[0044] Figure 9 A comparison of colon length between DSS-induced ΔS homozygous mice and WT mice provided in the embodiments of this application;
[0045] Figure 9 a represents the measured length of the mouse colon; Figure 9 b represents the statistical results of mouse colon length.
[0046] Figure 10 A comparison of TNF-α and IL-6 concentrations in the serum of DSS-induced ΔS homozygous mice and WT mice provided in the embodiments of this application.
[0047] Figure 11 A comparison of colonic inflammation in DSS-induced ΔS homozygous mice and WT mice provided in the embodiments of this application; Figure 11 a is an HE staining image of mouse colon tissue; Figure 11 b represents the statistical results of histological changes in the mouse colon. Detailed Implementation
[0048] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0049] the term
[0050] In this application, the term "CRISPR effector protein" generally refers to nucleases present in naturally occurring CRISPR systems, as well as their modified forms, variants (including nickase mutants and inactivating mutants), catalytically active fragments, or fusions thereof with other functional proteins. CRISPR effector proteins can recognize and / or cleave target nucleic acid structures by interacting with guide RNAs (such as crRNA and optionally tracrRNA or artificial guide RNAs (such as s guide RNA)). This term encompasses any CRISPR-based effector protein capable of achieving gene targeting (e.g., gene editing, gene targeting regulation, etc.) within cells and / or in vivo.
[0051] Examples of “CRISPR effector proteins” include Cas9 nucleases or variants thereof. The Cas9 nuclease can be a Cas9 nuclease from a different species, such as spCas9 from *Streptococcus pyogenes* or SaCas9 derived from *Staphylococcus aureus*.
[0052] Examples of the Cas9 nuclease variants include highly specific variants of the Cas9 nuclease, such as the Cas9 nuclease variants eSpCas9(1.0) (containing mutations K810A / K1003A / R1060A) and eSpCas9(1.1) (containing mutations K848A / K1003A / R1060A) developed by Feng Zhang et al., and the Cas9 nuclease variant SpCas9-HF1 (containing mutations N497A / R661A / Q695A / Q926A) developed by J. Keith Joung et al.
[0053] The Cas9 nuclease variant also includes Cas9 nickase (nCas9), in which one of the two subdomains (HNH nuclease subdomain and RuvC subdomain) of the DNA cleavage domain of the Cas9 nuclease is inactivated to form the nickase.
[0054] Examples of “CRISPR effector proteins” may also include Cpf1 nucleases or variants thereof, such as highly specific variants. The Cpf1 nuclease may be a Cpf1 nuclease from a different species, such as Cpf1 nucleases from Francisella novicida U112, Acidaminococcus sp. BV3L6, and Lachnospiraceae bacterium ND2006.
[0055] Examples of available "CRISPR effector proteins" may also include Cas13, Cas12a, Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Csm6, Cmr5, Cas10, Csx11, Csx10, Csf1, Csn2, Cas4, C2c1, C2c3, or C2c2 nucleases or variants thereof. Other "CRISPR effector proteins" available in this application can be found, for example, at http: / / www.addgene.org / crispr / guide / .
[0056] As used herein, "guide RNA" refers to an RNA molecule capable of forming a complex with a CRISPR effector protein and, due to complementarity with the target sequence, directing the complex to the target sequence. For example, in Cas9-based gene editing systems, guide RNAs typically consist of partially complementary crRNA and tracrRNA molecules forming a complex, wherein the crRNA contains a sequence sufficiently complementary to the target sequence to hybridize with it and guide the CRISPR complex (Cas9 + crRNA + tracrRNA) to specifically bind to the target sequence. However, it is known in the art that single guide RNAs (s guide RNAs) can be designed that simultaneously contain the characteristics of both crRNA and tracrRNA. The guide RNA of this application may contain other structures or modifications known in the art for improving its performance, such as including (e.g., inserted into a stem-loop structure) additional MS2 hairpin aptamer sequences, allowing it to be bound by the MS2 protein, thus providing additional functionality to the gene editing system.
[0057] When guide RNA is prepared chemically, it is called "synthetic single guide RNA" or "synthetic guide RNA". Guide RNA is a polynucleotide sequence containing two different functional sequences (crRNA and tracrRNA) (in their natural size or form or modified). Guide RNA can be expressed using an expression vector or chemically synthesized. Synthetic s guide RNA can contain ribonucleotides or their analogs or modified forms, or analogs of modified forms, or non-natural nucleosides. Synthetic single guide RNA can also contain a modified backbone or non-natural nucleoside bonds.
[0058] Guide RNA targeting the STAT3 gene
[0059] To this end, the inventors of this application have creatively discovered a guide RNA targeting the junction of exon 21 and intron 21 of the STAT3 gene. This guide RNA can bind to a CRISPR effector protein (e.g., Cas9) to form a complex, thereby cleaving the junction of exon 21 and intron 21 of the STAT3 gene. It then uses homologous recombination to connect the DNA molecules provided by the donor vector, introducing the target fragment into the genome at a specific site. This achieves the mutation of the first five bases "gttgt" of intron 21 into any nucleotide sequence without consecutive "gt" bases. Based on the "GT-AG" rule of intron splicing, after the above mutation occurs in the STAT3 gene, the two GT sites at the start of intron 21 of the STAT3 gene mutate, forcing the splicesome to select the GT site at the end of exon 21 to splice the mRNA, thus achieving the purpose of editing the STAT3 gene. This guide RNA not only avoids homologous sequence editing in non-target regions of the STAT3 gene, improving its gene editing efficiency, but also enables stable gene editing in cells and animals, resulting in the edited STAT3 protein being of the ΔS subtype.
[0060] In some embodiments, such as Figure 1 As shown, this guide RNA can be applied to CRISPR / Cas gene editing methods or kits. This guide RNA targets the 300 bases at the 5' end of exon 21 and intron 21 of the STAT3 gene. More specifically, this guide RNA targets the first 5 bases at the 5' end of intron 21 of the STAT3 gene.
[0061] The first 300 nucleotide sequences of the No. 21 intron: 5'-gttgttgactttccatggctttgccttccttcctagtgagaaagtacgcatccttggagagacaaggacatggctgagtatcttgtgggagcagggcttggtgattccttcttttgggaaagagtggtttattgggttcctt gacagggtgactaactcaggattcaagaggaggacagaatcagccctcagggagcttggaagtctgaagatgaaaaatagtatctctccctcttcctctcttctccctttccatctccccctccctcccaccccgccactttaaaacactagaaagaga-3', as in SEQ ID As shown in NO.1; the nucleotide sequence of exon 21 is: 5'-gcaagacccagatccagtctgtagagccatacaccaagcagcagctgaacaacatgtcatttgctgaaatcatcatgggctataagatcatggatgcgaccaacatcctggtgtctccacttgtctacctctaccccgacattcccaaggaggaggcatttggaaagtactgtaggcccgagagccaggagcaccccgaagccgacccaggta-3', as shown in SEQ ID NO.2. One guide RNA sequence is: 5'-tggaaagtcaacaactacctggg-3', as shown in SEQ ID NO.3; the other guide RNA sequence is: 5'-aagtcaacaactacctgggtcgg-3', as shown in SEQ ID NO.4.
[0062] In some embodiments, the guide RNA is selected from any of (I) to (IV):
[0063] (I) Having a nucleotide sequence as shown in SEQ ID NO:3 or 4;
[0064] (II) RNA molecules that hybridize with the RNA sequence defined in (I) under strict conditions and have the same targeting function;
[0065] (III) RNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the RNA sequence defined in (I) and have the same targeting function;
[0066] (IV) A vector comprising the nucleotide sequence shown in SEQ ID NO:3 or 4 and having the same targeting function, or a vector comprising the nucleotide sequence shown in (II) or (III) and having the same targeting function.
[0067] In the embodiments of this application, "vector" refers to a stable genetic nucleic acid molecule capable of carrying RNA with the same sequence and function, such as plasmids, bacteriophages, and lentiviruses.
[0068] In some embodiments, the guide RNA provided in this application is obtained by in vitro transcription.
[0069] In some embodiments, the guide RNA provided in this application is chemically synthesized.
[0070] Therefore, embodiments of this application also disclose a method for generating the guide RNA. The method includes the steps of generating the guide RNA through in vitro transcription or chemical synthesis, and / or pre-in vivo transcription and isolation of the guide RNA.
[0071] As used herein, “in vitro transcription” of guide RNA means the synthesis of guide RNA in vitro using an expression construct containing a guide RNA-encoding nucleic acid sequence as a template via RNA polymerase. In the expression construct, the guide RNA-encoding nucleic acid sequence is operatively linked to a suitable promoter. The expression construct includes linear nucleic acid molecules, plasmids, etc. In some embodiments, the in vitro transcription is performed using a phage polymerase and a corresponding promoter. In some specific embodiments, the in vitro transcription is performed using a T7 polymerase and a T7 promoter.
[0072] STAT3 gene editing kit
[0073] Therefore, this application also discloses a STAT3 gene editing kit. This kit performs gene editing on the 5' end of intron 21 of the STAT3 gene, for example, by replacing the first 5, 10, 100, or 120 bases at the 5' end of intron 21. The kit includes: a CRISPR effector protein or an expression construct containing a nucleotide sequence encoding a CRISPR effector protein; a guide RNA and a donor as defined in the above embodiments. The guide RNA binds to the CRISPR effector protein to form a complex. The complex targets and recognizes the junction between exon 21 and intron 21 of the STAT3 gene, and performs cleavage at the junction of exon 21 and intron 21; for example, the complex is used to target and recognize 300 bases at the 5' end of exon 21 and intron 21 of the STAT3 gene, and performs cleavage at the junction of exon 21 and intron 21. The donor provides a nucleotide sequence for gene editing of the 5' end of intron 21 of the STAT3 gene; for example, the donor provides a nucleotide sequence obtained by replacing the first 5, 10, 100, or 120 bases of the 5' end of intron 21 of the STAT3 gene.
[0074] In the above embodiments, the complex formed by the guide RNA and the CRISPR effector protein can locate and recognize the junction between exon 21 and intron 21 of the STAT3 gene, opening its DNA double strand. Through homologous recombination, the DNA molecule provided by the donor vector is ligated, and the target fragment is introduced into the genome at a specific site. This achieves the mutation of the first five bases "gttgt" of intron 21 into any nucleotide sequence without consecutive "gt" bases. Based on the "GT-AG" rule of intron splicing, after the above mutation occurs at the two GT sites at the start of intron 21 of the STAT3 gene, the spliceosome is forced to select the GT site at the end of exon 21 to splice the mRNA, thus producing only the ΔS isoform of the STAT3 protein, thereby achieving gene editing. For example, in some embodiments, the donor homologous sequence is designed to mutate the first 5 bases "gttgt" of intron 21 of the STAT3 gene to "cctct". The donor homologous sequence in this embodiment is: 5'-gaggaggcatttggaaagtactgtaggcccgagagccaggagcaccccgaagcagacccaggtacctcttgactttccatggctttgccttccttcctagtgagaaagtacgcatccttg-3', as shown in SEQ ID NO.5.
[0075] In the embodiments of this application, those skilled in the art should understand that the sequence provided by the donor is used to replace the first 5 bases at the 5' end of intron 21 of the STAT3 gene with any nucleotide sequence that does not contain consecutive "gt" bases, and the sequence provided by the donor is a homologous sequence of STAT3 gene 21.
[0076] In some embodiments, the donor is selected from any one of (A) to (D):
[0077] (A) Has the nucleotide sequence shown in SEQ ID NO:5;
[0078] (B) DNA molecules that hybridize with the RNA sequence defined in (A) under strict conditions and have the same function;
[0079] (C) and (A) define an RNA sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology and has the same function as the DNA molecule.
[0080] (D) A vector comprising the nucleotide sequence shown in SEQ ID NO:5 and having the same function, or a vector comprising the nucleotide sequence shown in (B) or (C) and having the same function.
[0081] In some embodiments, "vector" in item (D) refers to a stable, genetically inherited nucleic acid molecule capable of carrying DNA with the same sequence and function, such as plasmids, bacteriophages, and lentiviruses. "Same function" refers to providing a nucleotide sequence obtained by replacing the first five bases at the 5' end of intron 21 of the STAT3 gene.
[0082] application
[0083] On the other hand, the embodiments of this application also disclose the applications of the guide RNA or STAT3 gene editing kits defined above, including: applications in constructing ΔS subtype mutant cell lines of the STAT3 gene; and applications in constructing genetically engineered animal models of ΔS subtype mutants of the STAT3 gene.
[0084] In some embodiments, the cells are selected from at least one of fertilized egg cells, colon cancer cells, intestinal epithelial cells, intestinal stem cells, cardiomyocytes, hepatocytes, spleen cells, lung stem cells, embryonic kidney cells, cervical cancer cells, embryonic stem cells, hematopoietic stem cells, progenitor cells, T cells, TCR-T cells, or CAR-T cells. Preferably, the cells are selected from fertilized egg cells, intestinal epithelial cells, embryonic kidney cells, cervical cancer cells, TCR-T cells, or CAR-T cells.
[0085] In some embodiments, the animal is selected from at least one of C57BL / 6J mice, BALB / C mice, BALB / C-nu / nu mice, DBA / 1 mice, SD rats, Wistar rats, Lewis rats, guinea pigs, rabbits, dogs, or sheep. Preferably, the animal is selected from C57BL / 6J mice, BALB / C mice, BALB / C-nu / nu mice, or DBA / 1 mice; more preferably, the animal is selected from C57BL / 6J mice or BALB / C mice.
[0086] On the other hand, this application discloses a method for editing the STAT3 gene in cells, comprising: culturing recipient cells; preparing a STAT3 gene editing kit as provided in the above embodiments; and introducing the gene editing kit into the recipient cells by electroporation, liposomes, viral methods, transposon methods, nanoparticles, gene gun methods, chemical induction methods, or microinjection to obtain a mutant line of STAT3 gene cells.
[0087] In some embodiments, the STAT3 gene editing method is performed in vitro. For example, the recipient cells are isolated cells. In some embodiments of this implementation, the recipient cells are selected from at least one of fertilized egg cells, colon cancer cells, intestinal epithelial cells, intestinal stem cells, cardiomyocytes, hepatocytes, spleen cells, lung stem cells, embryonic kidney cells, cervical cancer cells, embryonic stem cells, hematopoietic stem cells, progenitor cells, T cells, TCR-T cells, or CAR-T cells. Preferably, the cells are selected from fertilized egg cells, intestinal epithelial cells, embryonic kidney cells, cervical cancer cells, TCR-T cells, or CAR-T cells.
[0088] In drug research targeting the ΔS isoform of the STAT3 protein, it is often necessary to construct relevant model cells and animal models. The method for constructing model cells can refer to the "Method for STAT3 Gene Editing in Cells" described above. This application also discloses a method for STAT3 gene editing, used to construct genetically engineered animal models of the STAT3 ΔS isoform.
[0089] In some embodiments, the method for STAT3 gene editing includes: culturing a recipient animal; preparing the STAT3 gene editing kit as defined above; introducing the gene editing kit into the fertilized egg of the recipient animal to obtain an F0 generation model animal; and breeding and identifying the F0 generation model animal to obtain the genetically engineered model animal.
[0090] In some embodiments, the step of "breeding and identifying F0 generation model animals" specifically includes: identifying the STAT3 gene of the F0 generation model animals to confirm the acquisition of F0 generation positive mice; mating the F0 generation positive mice with the wild-type recipient animals to obtain F1 generation model animals; identifying the STAT3 gene of the F1 generation model animals to confirm the acquisition of F1 generation heterozygous model animals; self-crossing the F1 generation heterozygous model animals to obtain F2 generation model animals; and identifying the STAT3 gene of the terminal F2 generation animals to confirm the acquisition of genetically engineered model animals with the ΔS subtype of the STAT3 gene.
[0091] In some embodiments, the recipient animal is selected from at least one of C57BL / 6J mice, BALB / C mice, BALB / C-nu / nu mice, DBA / 1 mice, SD rats, Wistar rats, Lewis rats, guinea pigs, rabbits, dogs, or sheep.
[0092] The more specific embodiments described below are for illustrative purposes. Unless otherwise specified or clearly indicated from the content, any feature described relating to one embodiment may be used in conjunction with any other embodiment.
[0093] Design of guide RNA and establishment of STAT3ΔS subtype cell lines
[0094] 1. Design of guide RNA
[0095] like Figure 1 As shown, using CRISPR / Cas9 technology, the first five bases "gttgt" of intron 21 of the STAT3 gene (NCBI Gene ID: 20848) were mutated to any nucleotide sequence without consecutive "gt" bases. Based on the "GT-AG" rule of intron splicing, after mutations at the two GT sites at the start of intron 21 of the STAT3 gene, the spliceosome is forced to select the GT site at the end of exon 21 to splice the mRNA, resulting in the production of only the ΔS isoform of STAT3 protein in mice, and not the FL isoform.
[0096] Based on the aforementioned principles, the inventors of this application designed and synthesized an isolated guide RNA as described in SEQ ID NO. 3 or 4. This isolated guide RNA can target the STAT3 gene, form a complex with a CRISPR effector protein, and guide this complex to cleave at the junction of exon 21 and intron 21 of the STAT3 gene, facilitating the introduction of a homologous sequence. This mutates the first five bases "gttgt" of the 5' end of intron 21 of STAT3 to "cctct," resulting in a STAT3 gene encoding only the ΔS isotype. This guide RNA improves the targeting specificity to 300 bases at the 5' end of exon 21 and intron 21 of the STAT3 gene, avoiding the need for the CRISPR system to perform homologous sequence editing in non-target regions of the STAT3 gene, thus improving gene editing efficiency. The targeting specificity of the guide RNA was comprehensively scored using the website http: / / crispr.tefor.net / crispor.py?batchId=VKgoByco1GU9xAVA1Du4, and the results are as follows: Figures 2-3 As shown, the guide RNAs in SEQ ID NO:3-4 have a score of not less than 50, indicating that these guide RNAs have good targeting specificity and low off-target rate.
[0097] Establishment and application of STAT3ΔS subtype mice
[0098] 1. Construction and identification of STAT3ΔS subtype mice
[0099] (1) F0 generation mice
[0100] The CRISPR effector protein, guide RNA, and donor vector (Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) from the kit were microinjected into the fertilized eggs of C57BL / 6J mice (Beijing Huafukang Biotechnology Co., Ltd.). F0 generation mice were obtained via embryo transfer. The CRISPR effector protein was sourced from Beijing Yingmaoshengye Co., Ltd., catalog number: PC1400. Seven days after birth, the F0 generation mouse pups were tail-cropped and numbered. Genomic DNA was extracted from the pups and subjected to PCR amplification and sequencing for identification.
[0101] like Figure 4As shown in the figure, this embodiment designed a pair of primers, Stat3-wt-tF1 and Stat3-wt-tR1, for PCR amplification based on the mutation region of the STAT3 gene. The PCR amplification reaction system is shown in Table 1, and the PCR amplification program is shown in Table 2. The primer used for sequencing was Stat3-wt-tF1. The sequence of the primer Stat3-wt-tF1 is 5'-cagtctgtagagccatacaccaag-3', as shown in SEQ ID NO:6; the sequence of the primer Stat3-wt-tR1 is 5'-gagttagtcaccctgtcaaggaac-3', as shown in SEQ ID NO:7.
[0102] Table 1
[0103]
[0104]
[0105] Table 2
[0106] temperature time 98℃ 5min 98℃ 10 seconds 55℃ 30 seconds 72℃ 35 seconds Repeat steps 2-4 34 loops 72℃ 5min 4℃ ∞
[0107] The target band amplified by PCR is 358 bp. This product is then sequenced, and the mouse genotype is determined based on the sequencing results. If the sequencing results show only wild-type sequences, the mouse is a WT mouse; if the sequencing results show only mutant sequences, the mouse is a homozygous positive mouse, i.e., a ΔS homozygous mouse; if the sequencing results show both wild-type and mutant sequences, the mouse is a heterozygous mouse.
[0108] (2) Construction and identification of F1 generation STAT3ΔS subtype mice and STAT3ΔS homozygous mice
[0109] The obtained F0 generation positive mice were mated with wild-type C57BL / 6J mice (Beijing Huafukang Biotechnology Co., Ltd.) to obtain F1 generation mice. Seven days after birth, the pups were tail-cropped and numbered, and genomic DNA was extracted from them for PCR amplification and sequencing identification. The results showed that the F1 generation mice were heterozygous for the STAT3ΔS subtype. Figure 5 As shown.
[0110] F1 generation heterozygous mice were self-crossed to obtain F2 generation mice. Seven days after birth, the pups were tail-cropped and numbered, and genomic DNA was extracted for PCR amplification and sequencing identification. Figure 6 As shown, the F2 generation mice obtained were homozygous mice containing the STAT3ΔS subtype.
[0111] 3. Establishment and experiment of DSS-induced mouse colitis model
[0112] Male STAT3 subtype ΔS homozygous mice (referred to as ΔS homozygous mice) aged 8–10 weeks and age-matched wild-type C57BL / 6J mice with similar genetic backgrounds (referred to as WT mice) were selected and grouped as shown in Table 3. The control group had no fewer than 8 mice per group, and the experimental group had no fewer than 10 mice per group. The control group mice had free access to sterilized water (free access to food), while the experimental group mice had free access to a 3% sodium dextran sulfate solution (DSS, MP Biomedicals, Cat. 160110, MW: 36000–50000 Da) for 7 days (during which other drinking water was withheld, but food was allowed). The DSS solution was replaced with fresh solution every other day, and samples were collected uniformly on the 8th day.
[0113] The modeling process was repeated once under the above conditions to monitor mouse survival. The difference was that on day 8, sterile water or 3% DSS solution was administered until the mice died. During the modeling process, the mice's weight was measured and recorded at a fixed time every day.
[0114] Table 3
[0115] category Group Drinking water type Control group 1 ΔS homozygous mouse + water Free drinking sterilized water Experimental group 1 ΔS homozygous mice + DSS Free drinking of 3% DSS aqueous solution Control group 2 WT mice + water Free drinking sterilized water Experimental group 2 WT mice + DSS Free drinking of 3% DSS aqueous solution
[0116] During the experiment, the mice were weighed at fixed times every day to observe their condition until the 8th day when samples were collected. After anesthetizing the mice, whole blood samples were obtained from their hearts. The intestinal tissue from the cecum to the anus of the mice was harvested, washed with physiological saline, photographed, and the length of the intestine was recorded. Subsequently, the feces in the intestines were washed away, and 0.5-1 cm of tissue from the middle of the colon was immersed in 4% paraformaldehyde fixative for 2-24 hours at room temperature or 4°C. After that, the tissue was embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E). The histological changes of colitis were scored using a double-blind method, and the scoring criteria are shown in Table 4.
[0117] Table 4
[0118]
[0119] Mouse whole blood was incubated at room temperature for 2 hours or overnight at 4°C, then centrifuged at 1000g for 15 minutes. The supernatant was used as serum, which was aliquoted and stored at -20°C or -80°C, avoiding repeated freeze-thaw cycles. The concentrations of the inflammatory cytokines TNF-α and IL-6 in mouse serum were detected using a mouse interleukin-6 (IL-6) ELISA kit (CUSABIO, Huamei Biotechnology, CSB-E04741m) and a mouse tumor necrosis factor-α (TNF-α) ELISA kit (CUSABIO, Huamei Biotechnology, CSB-E04639m), respectively.
[0120] like Figures 7-8As shown, in the DSS-induced acute colitis model, STAT3 gene ΔS homozygous mice experienced greater weight loss and shorter survival time than WT mice under the same conditions.
[0121] like Figure 9 As shown, in the untreated control group, there was no significant difference in colon length between ΔS homozygous mice and WT mice; in the experimental group treated with DSS-induced colitis, the colon length of ΔS homozygous mice was significantly shorter than that of WT mice.
[0122] like Figure 10 As shown, ELISA analysis of inflammatory cytokines TNF-α and IL-6 in mouse serum revealed that, in the DSS-induced acute colitis model, the concentrations of TNF-α and IL-6 in the serum of ΔS homozygous mice were higher than those in WT mice under the same conditions.
[0123] like Figure 11 As shown in figure a, HE staining results revealed that in the DSS-induced acute colitis model, the colonic mucosa of ΔS homozygous mice had essentially lost its normal morphology, exhibiting significant loss of crypt structures and mucosal ulceration. Under the same conditions, the colonic mucosa of WT mice was more intact, with relatively less loss of crypt structures and mucosal ulceration. Compared to WT mice, ΔS homozygous mice showed significantly greater infiltration of inflammatory cells in their colonic tissue. Figure 11 As shown in b, statistical data analysis in the pathological assessment of colitis severity scores showed that there was a significant difference in the severity of colitis between ΔS homozygous mice and WT mice under the same conditions, with ΔS homozygous mice exhibiting a more severe inflammatory phenotype in their colonic tissue. Figures 7-11 Results are expressed as mean ± standard deviation, n = 5–13. *P < 0.05, **P < 0.01, ***P < 0.001; statistical significance was analyzed using an unpaired t-test. ΔS stands for STAT3ΔS homozygous mouse, and WT stands for WT wild-type C57BL / 6J mouse.
[0124] The results, including changes in mouse body weight, survival rate, intestinal length, colonic tissue morphology and scoring, and serum inflammatory factor secretion, showed that the STAT3 gene ΔS homozygous mice constructed in this application exhibited more severe inflammatory manifestations compared to WT mice under the same conditions, exacerbating the progression of DSS-induced colitis. Therefore, the STAT3 gene ΔS homozygous mice constructed using the method provided in this application are highly suitable as colitis model mice for studying the pathogenesis of colitis and screening colitis-related drugs.
[0125] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.
Claims
1. A gene editing kit, wherein the gene editing kit performs gene editing on the 5' end of intron 21 of the STAT3 gene, the kit comprising: CRISPR effector proteins or expression constructs containing nucleotide sequences encoding CRISPR effector proteins; The guide RNA targets the junction of intron 21 and exon 21 of the STAT3 gene. The guide RNA can bind to CRISPR effector proteins to form a complex. The guide RNA is composed of partially complementary crRNA and tracrRNA molecules that form a complex. The nucleotide sequence of the guide RNA is shown in SEQ ID NO:3 or SEQ ID NO:
4. The guide RNA binds to the CRISPR effector protein to form a complex, which targets and recognizes the junction of exon 21 and intron 21 of the STAT3 gene, and cleaves at the junction of exon 21 and intron 21; Donor, providing the nucleotide sequence for gene editing at the 5' end of intron 21 of the STAT3 gene; The donor is selected from The nucleotide sequence shown in SEQ ID NO:
5.
2. A method for editing the STAT3 gene in cells, comprising: Culture recipient cells; Prepare the gene editing kit as described in claim 1; The gene editing kit is introduced into the recipient cells via electroporation, liposomes, virology, transposonization, nanoparticles, gene gun, chemical induction, or microinjection to obtain a ΔS subtype mutant cell line of the STAT3 gene.
3. The method according to claim 2, wherein, The method also includes the step of identifying the STAT3 gene in the mutant line.
4. A method for STAT3 gene editing, used to construct genetically engineered animal models of the STAT3 ΔS subtype, wherein, The method includes: Culture recipient animals; Prepare the gene editing kit as described in claim 1; The gene editing kit is introduced into the fertilized egg of the recipient animal to obtain the F0 generation model animal; and the F0 generation model animal is bred and identified to obtain the genetically engineered model animal.
5. The method according to claim 4, wherein, The specific steps involved in "breeding and identifying F0 generation model animals" include: The STAT3 gene in the F0 generation model animals was identified to confirm the acquisition of F0 generation positive mice; The F0 generation positive mice were mated with wild-type recipient animals to obtain the F1 generation model animals; The STAT3 gene of the F1 generation model animals was identified to confirm that F1 generation heterozygous model animals were obtained; F1 generation heterozygous model animals were self-crossed and bred to obtain F2 generation model animals; The STAT3 gene was identified in the F2 generation of model animals to confirm the genetically engineered model animals that obtained the homozygous STAT3 gene ΔS subtype.
6. The use of at least one of the following in the gene editing kit of claim 1: Application in constructing ΔS subtype mutant cell lines of the STAT3 gene; Application of constructing genetically engineered animal models of ΔS subtype mutations in the STAT3 gene.
7. The application according to claim 6, wherein the animal is selected from C57BL / 6J mice, BALB / C mice, BALB / C-nu / nu mice, and DBA / 1 mice.
8. The application according to claim 7, wherein the animal is selected from C57BL / 6J mice or BALB / C mice.
Citation Information
Patent Citations
Use of adenylate deaminase base editor to disrupt shear receptors of disease-related genes, including for treatment of genetic diseases
CN114190093A