Primer set for background screening of tobacco chromosome 8 for resistance to spotted wilt and its application
By developing a PCR and KASP primer combination for breeding tobacco resistant to spotted wilt, the problems of long breeding cycle and high cost in the existing technology have been solved. Rapid and accurate screening of tobacco resistant to spotted wilt with the chromosome 8 background of the backcross parent K326 tobacco has been achieved, thereby improving breeding efficiency.
Patent Information
- Application Number
- CN202211021291.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-24
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2042-08-24
AI Technical Summary
Existing technologies fail to effectively utilize the co-dominant KASP marker for spotted wilt-resistant backcross breeding in tobacco breeding, resulting in long breeding cycles and high costs, and making it difficult to quickly and accurately screen spotted wilt-resistant tobacco with the chromosome 8 background of the backcross parent K326 tobacco.
A PCR and KASP primer combination was developed for spotted wilt-resistant tobacco breeding, including a first PCR primer set and a second PCR primer set, as well as a first KASP primer set and a second KASP primer set, which are used to amplify specific SNP sites and perform genotype detection in combination with fluorescent probes to achieve efficient screening.
By screening out spotted wilt-resistant tobacco with the chromosome 8 background of the backcross parent K326 tobacco in a fast, accurate and low-cost manner, the breeding cycle is shortened and the breeding efficiency is improved.
Smart Images

Figure BDA0003814280940000071 
Figure BDA0003814280940000081 
Figure BDA0003814280940000101
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of tobacco breeding and relates to a primer set for identifying the genotypes of a donor parent, Polalta, and a backcross parent, K326, in the backcross breeding process of spotted wilt-resistant tobacco, in particular to a primer set for background screening of chromosome 8 of spotted wilt-resistant tobacco and an application thereof in the directional improvement of K326 tobacco for spotted wilt resistance or the breeding of spotted wilt-resistant tobacco varieties. Background Art
[0002] In crop production, some superior varieties excel in many important traits such as yield and agronomics. However, due to the poor performance of individual traits (such as disease resistance and insect resistance), it is often difficult to fully realize the potential of yield and quality, which restricts large-scale planting. Targeted variety improvement is to target the individual defective traits of existing main varieties or specialty varieties. Through backcross breeding, the superior target traits are introduced from the donor to the recurrent parent, while maintaining the other excellent traits of the recurrent parent. It is an effective and important breeding method for breeders to improve a single or a few undesirable traits of a variety. The genetic background and other traits of the varieties after targeted improvement are consistent with those of the original superior varieties, and they are an upgraded version of the original superior varieties.
[0003] In modern breeding, marker-assisted selection (MAS) has greatly accelerated the progress of targeted improvement breeding. In particular, marker-assisted backcross background selection utilizes molecular markers to select individual plants with genomes identical to the recurrent parent in backcross progeny, reducing the number of backcross generations and achieving targeted improvement in a shorter timeframe. In theory, marker-assisted backcross breeding is the fastest and most optimal breeding approach for targeted improvement of single or multiple traits controlled by major genes. Compared to conventional backcross breeding for targeted improvement, marker-assisted backcross background selection allows improved varieties to enter the market earlier.
[0004] Tobacco spotted wilt disease (TSWD) is a serious disease caused by infection by the Orthotospoviruses. Tomato spotted wilt virus (TSWV) is a representative species of the Orthotospoviruses. N.alata is a wild tobacco in the Nicotiana genus that has good resistance to TSWV and is the only available source of resistance to tobacco spotted wilt to date. Gajos et al. used N.otophora as a bridge parent and successfully transferred the spotted wilt resistance gene locus (RTSW locus, where RTSW is R esistance to TSWV (abbreviation for "V"), a cultivar 'Polalta', a spotted wilt-resistant tobacco, was obtained by transferring wild tobacco (N. alata) to cultivated tobacco (N. tabacum L.). 'Polalta' is a European strain with dark air-cured tobacco ancestry, significantly different from the flue-cured tobacco strains that dominate the Chinese and international markets. Crossing Polalta with the dominant flue-cured tobacco variety K326 as the female parent yielded spotted wilt-resistant tobacco with agronomic traits comparable to those of the dominant flue-cured tobacco. However, differences in metabolites and chemical composition still exist between the resulting spotted wilt-resistant tobacco and the dominant flue-cured tobacco, posing the risk that its characteristics may not fully meet the requirements of the flue-cured tobacco industry. To mitigate this risk in dominant flue-cured tobacco varieties targeted for spotted wilt resistance, backcross breeding with spotted wilt-resistant tobacco is needed to improve spotted wilt resistance in dominant flue-cured tobacco varieties. Using molecular markers for backcross-assisted background selection can accelerate the process of targeted improvement of spotted wilt resistance in flue-cured tobacco.
[0005] Single nucleotide polymorphisms (SNPs) are widely distributed throughout the genome and are the most common form of genetic variation among plant individuals. Common SNPs include base substitutions, transversions, insertions, and deletions. While most SNPs distributed throughout the genome do not directly determine phenotype, their close linkage to phenotypic-determining loci makes them promising candidates for development as important molecular markers. SNPs have become one of the most ideal molecular markers for studying the inheritance of complex plant traits.
[0006] Competitive allele-specific PCR (KASP) genotypes single nucleotide polymorphisms (SNPs) by specifically matching primer terminal bases. The basic principle is that two primers with different terminal bases each carry a fluorescent linker sequence. Based on the different fluorescent signals carried by the amplified products, large numbers of samples can be rapidly tested and their genotypes accurately determined. Since its introduction, KASP technology has rapidly captured the market with its exceptional flexibility, accuracy, and cost-effectiveness, playing a vital role in assisted crop breeding.
[0007] Currently, there are no reports on the use of co-dominant KASP markers for background selection in backcross breeding of tobacco for spotted wilt resistance. The development of co-dominant, specific KASP molecular markers based on the foreground donor parent and the background backcross parent could enable rapid, accurate, low-cost, high-throughput, and automated detection of background reversion rates in individual backcross plants, accelerating the targeted improvement of spotted wilt resistance in major flue-cured tobacco varieties. Summary of the Invention
[0008] The technical problem to be solved by the present invention is to provide SNP markers, primer combinations and methods for background screening of tobacco chromosome 8 for resistance to spotted wilt, so as to promote the directional improvement of K326 tobacco resistance to spotted wilt.
[0009] To solve the above technical problems, the present invention provides a PCR primer combination for screening spotted wilt-resistant tobacco breeding backgrounds, comprising a first PCR primer set and / or a second PCR primer set;
[0010] The first PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs: 1-3; the second PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs: 4-6;
[0011] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco;
[0012] The first PCR primer set is used to amplify the SNP site at 638952 bp on tobacco chromosome 8, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T;
[0013] The second PCR primer set is used to amplify the SNP site at 715449 bp on tobacco chromosome 8, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is T;
[0014] The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.
[0015] The present invention also provides a KASP primer combination for screening spotted wilt-resistant tobacco breeding backgrounds, comprising a first KASP primer set and / or a second KASP primer set;
[0016] The first KASP primer set consists of three primers: F1-1, F1-2, and R1. F1-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO: 1 in series from its 5' end to its 3' end; F1-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO: 2 in series from its 5' end to its 3' end; and the nucleotide sequence of R1 is shown in SEQ ID NO: 3.
[0017] The second KASP primer set consists of three primers: F2-1, F2-2, and R2. F2-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO:4 in series from its 5' end to its 3' end. F2-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO:5 in series from its 5' end to its 3' end. The nucleotide sequence of R2 is shown in SEQ ID NO:6.
[0018] The nucleotide sequences of the first tag sequence and the second tag sequence are different and are not homologous to the tobacco genome sequence;
[0019] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco;
[0020] The first KASP primer set is used to amplify the SNP site at 638952 bp on tobacco chromosome 8, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T;
[0021] The second KASP primer set is used to amplify the SNP site at 715449 bp on tobacco chromosome 8, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is T;
[0022] The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.
[0023] The present invention provides a kit comprising the above-mentioned PCR primer combination or the above-mentioned KASP primer combination.
[0024] In some embodiments of the present invention, the kit comprises the above-mentioned KASP primer combination and a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe;
[0025] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer set, and its 5' end is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first tag sequence, and its 3' end is connected to the quencher group;
[0026] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer set, and its 5' end is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second tag sequence, and its 3' end is connected to the quencher group.
[0027] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.
[0028] The use of the above-mentioned PCR primer combination or the above-mentioned KASP primer combination or the above-mentioned kit in the breeding of tobacco resistant to spotted wilt also falls within the protection scope of the present invention.
[0029] The present invention provides a method for screening a tobacco breeding background resistant to spotted wilt, comprising the following steps:
[0030] a) extracting DNA from tobacco plants resistant to spotted wilt;
[0031] b) performing PCR amplification on the DNA of the spotted wilt-resistant tobacco using the PCR primer set;
[0032] c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco plant resistant to spotted wilt, and screening the tobacco plant resistant to spotted wilt whose SNP site is a K326 tobacco genotype;
[0033] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.
[0034] The present invention also provides a method for screening a tobacco breeding background resistant to spotted wilt, comprising the following steps:
[0035] a) extracting DNA from tobacco plants resistant to spotted wilt;
[0036] b) adding the KASP primer set and PCR premix to the DNA of the spotted wilt-resistant tobacco to perform KASP amplification;
[0037] The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;
[0038] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer set, and its 5' end is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first tag sequence, and its 3' end is connected to the quencher group;
[0039] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer set, and the 5' end of the second fluorescent probe is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second tag sequence, and the 3' end of the second quencher probe is connected to the quencher group;
[0040] c) detecting the fluorescent signal to determine the genotype of the spotted wilt-resistant tobacco at the SNP site amplified by each KASP primer set, and screening spotted wilt-resistant tobacco having a K326 tobacco genotype at the SNP site;
[0041] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.
[0042] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.
[0043] In some embodiments of the present invention, during the KASP amplification,
[0044] The PCR system includes: DNA template, KASP primer working solution and KASP-TF V4.0 2X Master Mix;
[0045] The PCR program was as follows: step 1, pre-denaturation at 95°C for 15 min; step 2, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles.
[0046] Experiments have shown that using the KASP primer set developed by the present invention, PCR amplification is performed using the tobacco genomic DNA to be tested as a template, and then genotyping the PCR amplification products by fluorescence signal detection. Based on the typing results, tobacco plants with a chromosome 8 background of the recurrent parent, K326 tobacco, can be quickly and accurately screened for resistance to spotted wilt. Screening using SNP markers distributed continuously on a chromosome can ensure that the entire chromosome contains only the recurrent parent genotype. Compared with traditional marker screening, the SNP-KASP primer set developed by the present invention has the advantages of high accuracy, low cost, and high detection efficiency, making it suitable for large-scale screening of tobacco breeding for resistance to spotted wilt. The identification method using the SNP-KASP primer set of the present invention can be used to screen tobacco breeding backgrounds for resistance to spotted wilt in early generations, greatly shortening the breeding cycle for targeted improvement of K326 tobacco for resistance to spotted wilt and improving breeding efficiency.
[0047] As used herein, the term "RTSW locus" or "spotted wilt resistance locus" refers to a DNA segment comprising the RTSW gene, which confers resistance to tobacco spotted wilt in either the heterozygous or homozygous state. The "RTSW gene" refers to a gene from the genome of Nicotiana alata that confers resistance to spotted wilt. BRIEF DESCRIPTION OF THE DRAWINGS
[0048] Figure 1 The results of SNP genotyping using the two SNP-KASP primer sets of the present invention are shown. For each primer set, the genotype for Parent 1 is obtained by amplifying two Polalta homozygous donor parents, the genotype for Parent 2 is obtained by amplifying two K326 homozygous recurrent parents, and the heterozygous genotype is obtained by amplifying three Polalta × K326 F1 hybrids. Negative genotypes are obtained by using ultrapure water without DNA.
[0049] Figure 2 The results of chromosome 8 background screening using two SNP-KASP primer sets of the present invention on a segregating population of spotted wilt-resistant tobacco offspring were presented. For each primer set, the sample enclosed in the dashed circle in the upper left corner represents the Polalta homozygous genotype, the sample enclosed in the dashed circle in the lower right corner represents the K326 homozygous genotype, the sample enclosed in the dashed circle in the middle diagonal position represents the heterozygous genotype, and the sample enclosed in the dashed circle in the lower left corner represents the unamplified sample. A total of 384 samples were collected, including 376 DNA samples from spotted wilt-resistant tobacco, two DNA samples from Polalta, two DNA samples from K326, two DNA samples from the Polalta × K326 F1 line, and two DNA-free ultrapure water samples (as a negative control). DETAILED DESCRIPTION
[0050] The present invention will be further described in detail below with reference to the embodiments. Obviously, the embodiments described are only a part of the embodiments of the present invention, rather than all the embodiments.
[0051] In the following examples, if the specific techniques or conditions are not specified, they were carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased.
[0052] The tobacco materials used in the following examples are:
[0053] Polalta is a TSWV-resistant tobacco material containing a spotted wilt resistance gene locus (RTSW locus) and has been described in non-patent literature (Laskowska D, A,2010.TSWV resistance in DH lines of tobacco(Nicotianatabacum L.)obtained from a hybrid between'Polalta'and The tobacco material is disclosed in Plant Breeding 129, 731-3. The public can obtain the tobacco material from tobacco germplasm resource conservation units.
[0054] K326, a major flue-cured tobacco variety, does not contain the spotted wilt resistance locus (RTSW locus). Its reference genome sequence is publicly available at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome, and tobacco germplasm collections are available from tobacco germplasm collection institutions.
[0055] The F1 generation plants (K326×Polalta F1) obtained by hybridizing Polalta (♂) and K326 (♀), the segregating population (K326×Polalta BC7F1) obtained by backcrossing K326×Polalta F1 (♂) and K326 (♀) for seven generations, the spotted wilt-resistant tobacco with no linkage drag selected from K326×Polalta BC7F1 (single plant No. 12, with the genotype of RTSW / rtsw), and the segregating population (K326×Polalta BC8F1) obtained by backcrossing single plant No. 12 (♂) and K326 (♀) for one generation were all created by our research group and preserved in the Yunnan Tobacco Agricultural Science Research Institute. The screening process for spotted wilt-resistant tobacco (single plant No. 12) is described in International Patent Application No. PCT / CN2021 / 129382, entitled "Linkage Dyed Spotted Wilt-Resistant Tobacco Plants and Breeding Methods Thereof," and Chinese Patent Application No. 202111311707.0, entitled "Molecular Markers for Screening Linkage Dyed Spotted Wilt-Resistant Tobacco Plants and Their Applications," both of which are hereby incorporated by reference in their entirety. Previous research results indicate that the agronomic traits of spotted wilt-resistant tobacco with linkage drag-free are not significantly different from those of K326, making it suitable for use in spotted wilt-resistant tobacco breeding, officially entering the commercial breeding process.
[0056] The main reagents used in the following examples are:
[0057] KASP-TF V4.0 2X Master Mix (Cat. No. LGC-KBS-1050-132) was purchased from LGCBiosearch. The magnetic bead-based universal genomic DNA extraction kit (Cat. No. DP705) was purchased from Tiangen Biochemical Technology Co., Ltd.
[0058] Example 1. Acquisition of SNP markers for screening tobacco breeding backgrounds for resistance to spotted wilt
[0059] To obtain spotted wilt-resistant tobacco from hybrids and backcrosses between Polalta (♂) and K326 (♀), with a chromosomal background as close to that of K326 as possible, excluding the RTSW locus, it was necessary to develop SNP markers for screening spotted wilt-resistant tobacco breeding backgrounds. Therefore, we used the donor parent Polalta, the recipient parent K326, and previously obtained spotted wilt-resistant tobacco for marker development.
[0060] We performed whole-genome resequencing on Polalta, K326, and spotted wilt-resistant tobacco (single plant number 12). The sequencing platform was the BGISEQ-500, using the PE100 sequencing strategy. By filtering the raw data, aligning it with the cultivated tobacco reference genome, and detecting SNP variants, we filtered the SNPs obtained from the two parents (K326 and Polalta). A total of 50,009 high-quality SNPs (GQ (quality score) >= 40) between the two parents were identified, distributed across all 24 chromosomes (Table 1).
[0061] Table 1 SNP distribution of the two parents and single plant No. 12
[0062]
[0063] Resequencing SNP analysis of strain 12 revealed that the vast majority of SNPs were heterozygous, with SNP genotypes consistent with backcrossing. After seven generations of backcrossing, over 97% of the loci in the genome were identical to those of the backcross parent, K326. In addition to 106 heterozygous SNPs on chromosome 12 (chr12) containing the RTSW locus, the strain also contained 1,257 homozygous or heterozygous SNPs consistent with the donor parent, Polalta. This requires marker design and screening in the next segregating population.
[0064] The resequencing results showed that the end of chromosome 8 (chr8) contained a relatively dense donor parent-derived fragment, and 14 high-confidence SNPs were continuously distributed at 197201-1676680 bp on chromosome 8, with a size of approximately 1 Mb (Table 2).
[0065] Table 2 Distribution of SNPs on chr8
[0066] chromosome Location of the SNP site K326 Polalta Single plant No. 12 chr8 197201 G A R chr8 440278 A C M chr8 507629 C A M chr8 515472 G A R chr8 572633 G A R chr8 638952 C T Y chr8 715449 A T A chr8 863674 C T Y chr8 891719 A G R chr8 903514 G A R chr8 1052807 C T Y chr8 1186561 A C M chr8 1543933 C A M chr8 1676680 T C Y
[0067] In the table, R, M, and Y represent heterozygous genotypes; specifically, R = A / G, M = A / C, and Y = C / T. The location of the SNP on chromosome 8 was determined based on the complete genome sequence of the tobacco strain K326. The complete genome sequence of K326 is available at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.
[0068] In order to screen exchange plants from the segregating population and ultimately obtain plants containing only the recurrent parent K326 background in this segment, we selected 7 SNP sites and designed the SNP-KASP primer set.
[0069] The seven sets of SNP-KASP primers were screened using two homozygous parents (K326 and Polalta) and their hybridized F1 plants, with ultrapure water without DNA added as a negative control. The steps are as follows:
[0070] Preparation of KASP primer working solution: Take 12 μL (100 μM) of each upstream primer (first upstream primer, second upstream primer) and 30 μL (100 μM) of downstream primer, add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP primer working solution.
[0071] PCR system: 2 μL DNA template (about 30 ng / μL), 0.08 μL KASP primer working solution, 2.5 μL KASP-TF V4.0 2X Master Mix (LGC, product number LGC-KBS-1050-132), and add sterile ultrapure water to 5 μL.
[0072] PCR program: Step 1, pre-denaturation at 95°C for 15 min; Step 2, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles; Storage at 10°C.
[0073] A blank control (NTC) without adding DNA template to the PCR system was also set up in the experiment, and one blank control was set up for each primer set.
[0074] The PCR results are as follows: After the reaction is completed, a fluorescence microplate reader (FLUOstar OPTIMA, BMG Labtech, Germany) is used to perform fluorescence amplification on the obtained amplified products, and the fluorescence signal data is read using SNPviewer software to determine the genotype. If the fluorescence signal data of the amplified product of the tobacco to be tested is blue near the X-axis after analysis by SNPviewer software, the genotype of the tobacco to be tested is the K326 parent type; if the fluorescence signal data of the amplified product of the tobacco to be tested is red near the Y-axis after analysis by SNPviewer software, the genotype of the tobacco to be tested is the Polalta parent type; if the fluorescence signal data of the amplified product of the tobacco to be tested is green near the diagonal after analysis by SNPviewer software, the genotype of the tobacco to be tested is heterozygous; the fluorescence signal data of the amplified product of the negative control is black near the origin after analysis by SNPviewer software.
[0075] The optimal combination of SNP typing results that were consistent with the genotype, had good typing results, and was evenly distributed on the chromosome was screened. Finally, two SNP markers were identified for background screening of tobacco chromosome 8 for resistance to spotted wilt. The basic information of the KASP primer sets used to detect these two SNP markers is detailed in Table 3. The results of SNP genotyping using the two KASP primer sets are shown in Table 3. Figure 1 shown.
[0076] Table 3 SNP-KASP primer sets for chr8 chromosome background selection
[0077]
[0078]
[0079] The SNP-KASP primer combination used for chr8 chromosome background selection consists of two primer sets, designated SNP-KASP Primer Set 1 and SNP-KASP Primer Set 2. Each primer set consists of three primers: a first upstream primer, a second upstream primer, and a downstream primer, and is used to amplify a single SNP locus. The last base at the 3' end of the first upstream primer is the SNP genotype of K326, indicated by capital letters in parentheses within the primer name; the last base at the 3' end of the second upstream primer is the SNP genotype of Polalta, indicated by lowercase letters in parentheses within the primer name. In each primer set, the first upstream primer contains a FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) (SEQ ID NO: 11) at its 5' end, and the second upstream primer contains a HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT) (SEQ ID NO: 12) at its 5' end. The fluorescent tag sequences in the primers are underlined in Table 3; ununderlined sequences are genome-specific sequences. The numbers in the primer names indicate the locations of the SNPs amplified by each primer set on chromosome 8. SNP-KASP primer set 1 amplifies the SNP at 638,952 bp on chromosome 8, and SNP-KASP primer set 2 amplifies the SNP at 715,449 bp on chromosome 8. The chromosomal locations of these SNPs were determined based on the complete genome sequence of the tobacco plant K326. The complete genome sequence of K326 is available at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.
[0080] Example 2. Validation of SNP markers for screening tobacco breeding backgrounds for resistance to spotted wilt
[0081] The SNP markers obtained in Example 1 for background screening of tobacco chromosome 8 for resistance to spotted wilt disease were verified using the segregating population BC1F1 of single plant No. 12 obtained by backcrossing single plant No. 12 with K326 (ie, K326×PolaltaBC8F1).
[0082] First, plants containing the RTSW locus were screened from the K326×Polalta BC8F1 population. Using the avirulent gene infiltration identification method we established earlier, 800 individual plants from the K326×Polalta BC8F1 segregating population were identified for spotted wilt resistance. The avirulent gene infiltration identification method is a method for identifying tobacco resistance using the tomato spotted wilt virus NSm gene, as described in a Chinese patent (patent number ZL201710414755.X, invention titled "A method for identifying tobacco resistance using the tomato spotted wilt virus NSm gene"), the entire contents of which are hereby incorporated by reference. The specific steps are:
[0083] (1) Agrobacterium EHA105 containing the non-toxic gene NSm expression vector was cultured in LB medium at 28°C for 24 h. The cells were collected by centrifugation and diluted with infiltration buffer (10 mmol / L MgCl2, 10 mmol / L MES, 200 μmol / L acetosyringone) to an OD600 suspension of 0.5.
[0084] (2) Using a sterile syringe with the needle removed, inject 9.5-10.5 μl of the bacterial suspension from the back of the tobacco leaf into the interveinal space, forming a visible infiltration spot. Place the inoculated tobacco plant in an environment of 20-28°C and 80% humidity, alternating between 16 hours of continuous light and 8 hours of continuous darkness, and observe for a total of 72 hours.
[0085] (3) Observation: If the tobacco test host produces a hypersensitive reaction (HR) induced by the identified strain containing the avirulent gene NSm expression vector, it is confirmed that the tobacco test host is a disease-resistant variety relative to the avirulent gene NSm.
[0086] The results of NSm-mediated disease resistance identification showed that among the 800 plants in the K326×Polalta BC8F1 segregation population, 415 produced HR reactions and were TSWV-resistant plants (indicated by RTSW), 380 plants had no HR reactions and were TSWV-susceptible plants (indicated by rtsw), and the other 5 plants were not included in the statistics because they were too small to be suitable for HR detection.
[0087] We selected 376 of the 415 HR-positive plants and extracted total DNA from each plant using a universal genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP705) using a magnetic bead method. We used our previously developed spotted wilt resistance marker, NaChr3_59M (see International Patent Application No. PCT / CN2021 / 129382 and Chinese Patent Application No. 202111311707.0), to verify the NSm-mediated disease resistance identification results. The results showed that only three of the 376 plants had inconsistent results with the NSm-mediated disease resistance identification method, and the accuracy of the NSm-mediated disease resistance identification method was greater than 99.2%.
[0088] KASP detection was performed on the DNA of 376 HR-positive plants using the two SNP-KASP primer sets shown in Table 3 of Example 1. Two homozygous parents (K326 and Polalta) and the F1 generation plants obtained by hybridization were used as controls, and ultrapure water without DNA was used as a negative control. The KASP detection method was the same as in Example 1. The test results are shown in Tables 4 and Figure 2 shown.
[0089] Table 4 SNP genotyping results of tobacco resistant to spotted wilt
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099] In the table, numbers 1-376 represent DNA samples from 376 HR-positive plants. Numbers 377 and 378 represent DNA samples from Polalta, numbers 379 and 380 represent DNA samples from K326, numbers 381 and 382 represent DNA samples from a Polalta × K326 F1 hybrid, and numbers 383 and 384 represent ultrapure water without DNA added (negative control). A represents the homozygous Polalta genotype; B represents the homozygous K326 genotype; H represents the heterozygous genotype; N represents negative; and "?" indicates that the sample was not amplified. Pos represents positive, and Neg represents negative.
[0100] The results showed that using two SNP-KASP primer sets, 177 K326 homozygous strains and 197 heterozygous strains were identified from 376 isolates in the segregating population. The results from SNP-KASP primer sets 1 and 2 were essentially consistent, with the two markers in the same region mutually validating each other and demonstrating high accuracy.
[0101] To verify the accuracy of SNP markers, we selected six strains (numbered 11, 17, 24, 30, 102, and 109) for resequencing using the BGISEQ-500 platform and the PE100 sequencing strategy. By filtering the raw data, aligning it to the cultivated tobacco reference genome, and detecting SNP variants, the resequencing data were aligned to high-quality SNPs between the parents and filtered to determine the number of SNPs on chr8 for the six strains (Table 5).
[0102] Table 5 Resequencing results of 6 strains identified by SNP-KASP primer set
[0103] Number of SNPs on chr8 Single plant No. 12 14 Single plant 12BC1F1-11 0 Single plant 12BC1F1-17 0 Single plant 12BC1F1-24 0 Single plant 12BC1F1-30 0 Single plant 12BC1F1-102 0 Single plant 12BC1F1-109 0
[0104] The results showed that the six individuals screened had zero SNPs on chromosome chr8 identical to the donor parent, Polalta. Therefore, it was confirmed that the entire chr8 chromosome of the backcross individuals screened using SNP-KASP primer sets 1 and 2 was completely identical to that of the recurrent parent, K326.
[0105] It can be seen that the SNP-KASP primer set developed by the present invention can effectively screen out tobacco resistant to spotted wilt with the chromosome 8 background of the backcross parent K326, which has the advantages of reliability, simplicity and practicality. It has important application prospects in tobacco germplasm resource evaluation and breeding marker-assisted selection, and also provides a reference basis for breeding directed improved tobacco varieties with high resistance to spotted wilt.
[0106] The above embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.
Claims
1. A PCR primer combination for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: comprising a first PCR primer set and a second PCR primer set; The first PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs: 1-3; the second PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs: 4-6; The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco; The first PCR primer set is used to amplify the SNP site at 638952 bp on tobacco chromosome 8, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T; The second PCR primer set is used to amplify the SNP site at 715449 bp on tobacco chromosome 8, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is T; The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.
2. A KASP primer combination for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: including a first KASP primer set and a second KASP primer set; The first KASP primer set consists of three primers: F1-1, F1-2, and R1, wherein the nucleotide sequence of F1-1 is shown in SEQ ID NO: 7; the nucleotide sequence of F1-2 is shown in SEQ ID NO: 8; and the nucleotide sequence of R1 is shown in SEQ ID NO: 3; The second KASP primer set consists of three primers: F2-1, F2-2, and R2, wherein the nucleotide sequence of F2-1 is shown in SEQ ID NO: 9; the nucleotide sequence of F2-2 is shown in SEQ ID NO: 10; and the nucleotide sequence of R2 is shown in SEQ ID NO: 6; The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco; The first KASP primer set is used to amplify the SNP site at 638952 bp on tobacco chromosome 8, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T; The second KASP primer set is used to amplify the SNP site at 715449 bp on tobacco chromosome 8, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is T; The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.
3. A kit, characterized in that Comprising the PCR primer combination according to claim 1.
4. A kit, characterized in that Comprising the KASP primer combination according to claim 2.
5. The kit according to claim 4, characterized in that The kit further comprises a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe; The nucleotide sequence of the first fluorescent probe is as shown in SEQ ID NO: 11, and the 5' end thereof is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and the 3' end thereof is connected to the quencher group; The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO: 12, and its 5' end is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and its 3' end is connected to the quencher group.
6. The kit according to claim 5, characterized in that The first fluorescent group is FAM, and the second fluorescent group is HEX.
7. Use of the PCR primer combination according to claim 1, the KASP primer combination according to claim 2, or the kit according to any one of claims 3 to 6 in breeding tobacco varieties resistant to spotted wilt.
8. A method for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: The following steps are involved: a) extracting DNA from tobacco plants resistant to spotted wilt; b) performing PCR amplification on the DNA of the spotted wilt-resistant tobacco using the PCR primer set described in claim 1; c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco plant resistant to spotted wilt, and screening the tobacco plant resistant to spotted wilt whose SNP site is a K326 tobacco genotype; The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.
9. A method for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: The following steps are involved: a) extracting DNA from tobacco plants resistant to spotted wilt; b) adding the KASP primer set and PCR premix of claim 2 to the DNA of the spotted wilt-resistant tobacco to perform KASP amplification; The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe; The nucleotide sequence of the first fluorescent probe is as shown in SEQ ID NO: 11, and the 5' end thereof is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and the 3' end thereof is connected to the quencher group; The nucleotide sequence of the second fluorescent probe is as shown in SEQ ID NO: 12, and the 5' end thereof is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and the 3' end thereof is connected to the quencher group; c) detecting the fluorescent signal to determine the genotype of the spotted wilt-resistant tobacco at the SNP site amplified by each KASP primer set, and screening spotted wilt-resistant tobacco having a K326 tobacco genotype at the SNP site; The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.
10. The method according to claim 9, characterized in that The first fluorescent group is FAM, and the second fluorescent group is HEX.
11. The method according to claim 9, characterized in that During the KASP amplification, The PCR system includes: DNA template, KASP primer working solution and KASP-TF V4.0 2X Master Mix; The PCR program was as follows: step 1, pre-denaturation at 95°C for 15 min; step 2, denaturation at 95°C for 20 s, 65-57°C for 60 s, for a total of 9 cycles, with a decrease of 1°C during each cycle; step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles.
Citation Information
Patent Citations
A method for identifying tobacco resistance using the NSm gene of tomato spotted wilt virus
CN107400674B
Molecular markers for screening tobacco plants resistant to spotted wilt without linkage drag and their application
CN115247218B