Molecular marker BoC06ID22 tightly linked to anthocyanin gene in cabbage and its application

Abstract

The present invention discloses a molecular marker BoC06ID22 closely linked to the anthocyanin content gene of cabbage and its application, belonging to the technical field of molecular markers. The main technical problem solved is to increase the anthocyanin content or purple area of ​​cabbage leaves. The present invention discloses the application of detecting any of the following InDel1 substances, wherein InDel1 is whether there is an insertion mutation between the 135th thymine and the 136th cytosine of sequence 1; A1) for identifying or assisting in identifying the anthocyanin content of cabbage; A2) for preparing a product for identifying or assisting in identifying the anthocyanin content of cabbage; A3) for breeding high anthocyanin cabbage; A4) for preparing a product for breeding high anthocyanin cabbage; A5) for identifying or assisting in identifying the purple area of ​​cabbage leaves; A6) for preparing a product for identifying or assisting in identifying the purple area of ​​plant leaves. Compared with plants having the above insertion mutation, plants without the above insertion mutation have higher anthocyanin content and larger purple area of ​​leaves.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to a molecular marker BoC06ID22 closely linked to a gene for anthocyanin content in cabbage and its application. Background Art

[0002] Cabbage (Brassica oleracea L. var. capitata L.) is an important cruciferous vegetable crop that is widely cultivated around the world. In recent years, purple cabbage has attracted increasing attention from consumers due to its high anthocyanin content.

[0003] Anthocyanins are an important class of flavonoid compounds with a variety of biological functions. They can make plants appear in a variety of colors, thereby attracting insects for pollination and seed dispersal, and can also help plants resist external pests and other biological and non-biological stresses such as low temperature and ultraviolet rays. In addition, a large number of studies have shown that anthocyanins also have antioxidant, anti-mutagenic, anti-inflammatory, anti-cancer, and antibacterial activities, can prevent cardiovascular diseases and diabetes, improve vision, and are very beneficial to human health.

[0004] The anthocyanin content of cabbage is easily affected by environmental factors during the seedling stage. For example, low temperature and other adverse stresses will accelerate the accumulation of anthocyanins in the leaves of ordinary green cabbage. Therefore, the traditional field visual observation and identification method is prone to errors when screening high-anthocyanin cabbage materials during the seedling stage, and the selection efficiency is low. Therefore, it is extremely important to carry out research on the gene positioning of cabbage anthocyanin content and the development of tightly linked molecular markers for the early auxiliary breeding selection of cabbage high-anthocyanin materials. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a molecular marker BoC06ID22 which is closely linked to the anthocyanin content gene of cabbage.

[0006] In order to solve the above problems, the present application provides the following application:

[0007] Any of the following uses of an InDel1 molecular marker or a substance for detecting the InDel1 molecular marker, wherein the InDel1 molecular marker is a DNA molecule having a nucleotide sequence of positions 136 to 168 of SEQ ID NO: 2:

[0008] A1) Application of detecting a substance marked by the InDel1 molecule in predicting whether a cabbage leaf has purple color;

[0009] A2) Use of a substance for detecting the InDel1 molecule marker in preparing a product for predicting whether a cabbage leaf has purple color;

[0010] A3) Application of substances detected by InDel1 molecular marker in the breeding of high purple pigment cabbage;

[0011] A4) Use of substances detecting the InDel1 molecule marker in the preparation of products for breeding high purple pigment cabbage.

[0012] In the present application, the InDel1 molecular marker is referred to as InDel-33bp.

[0013] In order to solve the above problems, the present application also provides the following application:

[0014] Any of the following uses of a substance for detecting the InDel1 site, wherein the InDel1 site is whether there is an inserted fragment between the 135th thymine deoxynucleotide and the 136th cytosine deoxynucleotide of the molecular marker BoC06ID22;

[0015] A1) Application of a substance detecting the InDel1 site in predicting whether a cabbage leaf has purple color;

[0016] A2) Use of a substance for detecting the InDel1 site in preparing a product for predicting whether a cabbage leaf has purple color;

[0017] A3) Application of substances detecting the InDel1 locus in the breeding of high purple pigment cabbage;

[0018] A4) Use of a substance for detecting the InDel1 site in preparing a product for breeding high purple pigment cabbage;

[0019] The molecular marker BoC06ID22 is any one of the following:

[0020] R1) The nucleotide sequence is the nucleic acid molecule shown in Sequence 1;

[0021] R2) A nucleic acid molecule obtained by substituting and / or deleting and / or adding nucleotide residues in the nucleic acid molecule of R1) and having more than 80% identity with the nucleic acid molecule of R1) and having the same function as the nucleic acid molecule of sequence 1.

[0022] In the present application, the cabbage may be cabbage in the heading stage, cabbage in the germination stage, cabbage in the seedling stage or cabbage in the rosette stage.

[0023] In the above, the nucleic acid molecule may be DNA.

[0024] In the above, the purple pigment is a plant pigment that makes plant leaves purple. The substance for detecting the InDel1 site may be a product. The substance for detecting the InDel1 site may include reagents, kits and instruments for detecting the above-mentioned insert. Specifically, primers and other reagents and instruments required for in vitro amplification of nucleic acids for detecting the above-mentioned insert.

[0025] In the above text, plants having an insertion fragment between thymine at position 135 and cytosine at position 136 in the plant genome have lower purple pigment content and smaller purple area in leaves compared with plants without insertion fragments.

[0026] The above-mentioned inserted fragment may be a nucleic acid molecule having a sequence of AGCTGTGTACATAATTTGTTTTTTCTTTTTGGT.

[0027] In the above application, the purple pigment may be anthocyanin.

[0028] Anthocyanidin, also known as flower pigment, is a kind of water-soluble natural pigment widely found in plants in nature. It is a colored aglycone obtained by hydrolysis of anthocyanin. Under different pH conditions of plant cell vacuoles, anthocyanidin makes the petals present colorful colors. The purple color of the plant leaves of the present application comes from anthocyanidin.

[0029] In the above text, the depth of purple or the size of purple area of ​​the cabbage plant is achieved by the anthocyanin content in the body. The neutral conditions in the cabbage body make the anthocyanin in the cabbage appear purple.

[0030] In the above application, the substance for detecting the InDel1 site or the substance for detecting the InDel1 molecular marker may be any of the following:

[0031] B1) in vitro nucleic acid amplification primers for specifically amplifying the InDel1 site;

[0032] B2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in B1);

[0033] B3) A kit containing the in vitro nucleic acid amplification primers described in B1) or the in vitro nucleic acid amplification reagents described in B2).

[0034] In the above, the specific amplification of the InDel1 site is to design specific primers, use specific primers to perform in vitro nucleic acid amplification, and judge whether there is an insertion fragment between the thymine at position 135 and the cytosine at position 136 of sequence 1 based on the size or presence of the amplified nucleic acid fragment.

[0035] The specific amplification in B1) can detect the presence of the inserted fragment by the size of the amplified product.

[0036] The in vitro nucleic acid amplification technology can be polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR) and nucleic acid sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal amplification technology (HDA) or Qβ replication technology.

[0037] The present application uses polymerase chain reaction (PCR) as an amplification method to perform InDel1 site detection.

[0038] In the above-mentioned applications, methods and products, the in vitro nucleic acid amplification primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected without a marker.

[0039] In the above application, the primers may be A and B;

[0040] A is any of the following:

[0041] C1) The nucleotide sequence is the DNA shown in Sequence 3;

[0042] C2) a DNA obtained by substitution and / or deletion and / or addition of nucleotide residues of the DNA described in C1) which has more than 80% identity with the DNA described in C1) and has the same amplification specificity as the DNA of sequence 3;

[0043] The B is any of the following:

[0044] D1) The nucleotide sequence is the DNA shown in SEQ ID NO: 4;

[0045] D2) A DNA obtained by substituting and / or deleting and / or adding nucleotide residues of the DNA described in D1) and having more than 80% identity with the DNA shown in D1) and the same amplification specificity as the DNA of sequence 4.

[0046] In the above, the same amplification specificity is the ability to specifically amplify the InDel1 site. Detect whether the InDel1 site has an inserted fragment.

[0047] In the above, the above primers are used for specific amplification, and the purple pigment content of the plant or the purple area of ​​the plant leaves is identified or assisted in identification by the fragment size. The inserted fragment between the 135th thymine deoxynucleotide and the 136th cytosine deoxynucleotide of sequence 1 has a larger amplified fragment, and the plant has a lower purple pigment content and a smaller purple area of ​​the leaves. The fragment size of the specific amplification using the above primers A and B is 300bp. The amplified sequence is shown in sequence 2.

[0048] There is no insertion fragment between the 135th thymidine deoxynucleotide and the 136th cytosine deoxynucleotide in sequence 1. The amplified fragment has a smaller size, and the plant has a higher purple pigment content and a larger purple area on the leaves. The size of the fragment specifically amplified using the above primers A and B is 267 bp. The amplified sequence is shown in sequence 1.

[0049] In order to solve the above problems, the present application also provides a method for detecting or assisting in identifying the content of purple pigment in cabbage.

[0050] The method for detecting or assisting in identifying the content of purple pigment in cabbage provided by the present invention includes method A or method B;

[0051] Method A comprises detecting whether there is a nucleic acid insertion fragment between the 135th thymine deoxynucleotide and the 136th cytosine deoxynucleotide of sequence 1 in the genome of the cabbage to be tested, and identifying or assisting in identifying the purple pigment content of the cabbage according to whether there is an insertion fragment;

[0052] Method B includes detecting whether the genome of the cabbage to be tested has the InDel1 molecular marker, and identifying or assisting in identifying the purple pigment content of the cabbage based on whether the InDel1 molecular marker is present.

[0053] In order to solve the above problem, the present application also provides a method for predicting whether cabbage leaves are purple.

[0054] The method for predicting whether cabbage leaves have purple color provided by the present invention comprises method A or method B:

[0055] Method A comprises detecting whether there is a nucleic acid insertion fragment between the 135th thymine deoxynucleotide and the 136th cytosine deoxynucleotide of sequence 1 in the genome of the cabbage to be tested, and identifying or assisting in identifying whether the cabbage leaf has purple color according to whether there is an insertion fragment;

[0056] Method B comprises detecting whether the genome of the cabbage to be tested has the InDel1 molecular marker, and identifying or assisting in identifying whether the cabbage leaves have purple color according to whether the InDel1 molecular marker is present.

[0057] In the above, the substance used to detect whether there is an insertion fragment between the thymine at position 135 and the cytosine at position 136 of sequence 1 is as described above. The method for determining the result is as described above.

[0058] In the above method, the above-mentioned substance for detecting the InDel1 molecular marker or the above-mentioned substance for detecting the InDel1 site is used to perform relevant detection.

[0059] In the above application or method, the inserted fragment or InDel1 molecular marker is a nucleic acid molecule whose nucleotide sequence is from position 135 to position 168 of sequence 2.

[0060] In the above, the nucleotide sequence of the inserted fragment is 5`-AGCTGTGTACATAATTTGTTTTTTCTTTTTGGT-5'.

[0061] In order to solve the above problems, the present application also provides a product.

[0062] The product provided by the present invention includes one or more of the above-mentioned substance for detecting the InDel1 site, the above-mentioned substance for detecting the InDel1 molecular marker, or the InDel1 molecular marker.

[0063] In the present application, the cabbage is a hybrid offspring obtained by hybridizing at least two of the following cabbages: one or more of bicyclic cabbage, old red cabbage, Zhongshu 013-8 cabbage, Northwest Chunyuan 55 cabbage, Changzheng No. 1 cabbage, Changzheng No. 6 cabbage, Changzheng No. 7 cabbage, Changzheng No. 8 cabbage, Changzheng No. 9 cabbage, Concord N-43 cabbage, Japanese purple cabbage and ornamental kale.

[0064] In the present application, the cabbage can be specifically a hybrid offspring of "double ring" cabbage x "old red" cabbage, such as F2 generation or above. In the hybrid combination of "double ring" cabbage x "old red" cabbage, "double ring" cabbage is the female parent and "old red" cabbage is the male parent.

[0065] Beneficial effects:

[0066] The present invention discloses a molecular marker BoC06ID22 closely linked to a gene for anthocyanin content in cabbage and its application. Genetic analysis was performed using cabbage "Double Ring" as the female parent and cabbage "Old Red Cabbage" as the male parent. A molecular marker BoC06ID22 closely linked to a gene for anthocyanin content in cabbage was found. The molecular marker is a nucleic acid molecule having a sequence of AGCTGTGTACATAATTTGTTTTTTCTTTTTGGT, in particular, a sequence of AGCTGTGTACATAATTTGTTTTTTCTTTTTGGT. Compared with plants with the above insertion mutation, plants without the insertion mutation have higher purple pigment content and larger purple area of ​​leaves, especially in varieties of bicyclic cabbage, old red cabbage, Zhongshu 013-8 cabbage, Northwest Spring Circle 55 cabbage, Changzheng No. 1 cabbage, Changzheng No. 6 cabbage, Changzheng No. 7 cabbage, Changzheng No. 8 cabbage, Changzheng No. 9 cabbage, Concord N-43 cabbage, Japanese purple cabbage and ornamental kale. It can be used for the prediction and screening of early purple pigment content or purple area of ​​leaves of cabbage, and can also be used for molecular marker-assisted selection breeding and variety selection of cabbage. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 The phenotypes of individual plants in the F2 population: a. A plant with dark purple leaf heads, b. A plant with light purple leaf heads, c. A plant with green leaf heads.

[0068] Figure 2 The right side shows the InDel molecular markers used for the initial positioning, and the left side shows the genetic distance between the molecular markers.

[0069] Figure 3 For the fine positioning of BoPur.

[0070] Figure 4 These are the results of PCR amplification of the molecular marker BoC06ID22 in the F1 plants of the combinations of “Double Ring”, “Old Red Cabbage”, and “Double Ring” × “Old Red Cabbage” and some plants of the F2 segregating population.

[0071] Figure 5 It is the amplification detection of molecular marker BoC06ID22 in other cabbage materials. G1-G8 are green (low anthocyanin) cabbage materials: Zhongshu 013-8, Xibei Chunyuan 55, Changzheng 1, Changzheng 6, Changzheng 7, Changzheng 8, Changzheng 9, Xiehe N-43; P1-P3 are purple (high anthocyanin) cabbage materials: ornamental cabbage, ornamental cabbage and Japanese purple cabbage.

[0072] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0073] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0074] The bicyclic cabbage and old red cabbage materials in the following embodiments are recorded in Table 6 on page 3071 of the following document: (Tai Xiang, Chen Jinxiu, Guo Sanhong, Zhu Xiaowei, Bo Tianyue, 2021, Analysis of quality traits of different cabbage inbred lines, Molecular Plant Breeding; Vol. 19, No. 9). The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0075] The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.

[0076] Example 1 Obtaining the molecular marker BoC06ID22 tightly linked to the cabbage anthocyanin content gene

[0077] 1. Construction of genetically segregating populations and genetic analysis

[0078] 1. Test plant materials

[0079] A low-anthocyanin content material "Shuanghuan" cabbage obtained by multiple generations of self-pollination at the Horticultural Research Institute of Shanghai Academy of Agricultural Sciences was used as the female parent, and a high-anthocyanin content material "Laohong cabbage" was used as the male parent to prepare the hybrid combination "Shuanghuan" cabbage × "Laohong" cabbage to obtain F1, and F2 was obtained after self-pollination of F1 individual plants. At maturity, the leaf head color of the female low-anthocyanin material "Shuanghuan" cabbage is green, while the leaf head color of the male "Laohong" cabbage is purple.

[0080] 2. Genetic analysis

[0081] The head color of the F1 plants obtained from the hybrid combination of "Shuanghuan" and "Laohong" cabbage was purple, and the head colors of the F2 generation segregating population were dark purple, light purple and green ( Figure 1). In the F2 population consisting of 408 plants, the number of plants with purple (including light purple and dark purple, with high anthocyanin content) leaves was 314, and the number of plants with green (low anthocyanin content) leaves was 94. The chi-square test results showed that the separation ratio of the two types of plants met the 3:1 separation ratio (χ 2 =0.735<χ 2 0.05 =3.84), indicating that the purple head trait of “Old Red Cabbage” is controlled by a dominant single gene.

[0082] 2. Location of the cabbage anthocyanin gene

[0083] 1. Preliminary location of the cabbage anthocyanin gene BoPur

[0084] The genomes of the maternal "double ring" cabbage (low anthocyanin content, no purple leaves in the heading period) and the paternal "old red" cabbage (high anthocyanin content, purple leaves in the heading period) were resequenced using the second generation sequencing technology, and 113 polymorphic InDel markers between the two were developed. Then, 7 purple-leafed cabbage (high anthocyanin content) and 8 green-leafed cabbage (low anthocyanin content) plants were selected from the F2 segregation population of the "double ring" cabbage × "old red" cabbage combination, and the genomic DNA of each plant was extracted to form a high anthocyanin gene pool and a low anthocyanin gene pool. The DNA of the high anthocyanin gene pool and the low anthocyanin gene pool was PCR amplified using 34 polymorphic InDel markers between parents that were evenly distributed in 9 linkage groups of cabbage.

[0085] The PCR reaction system (the same below) was: total volume 10 μL, template DNA (20 ng / μL) 1 μL, upstream and downstream primers 0.2 μM, 2×Taq premixed PCR reaction system (including dye) (purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.) 5 μL, ddH2O 3.6 μL.

[0086] The PCR reaction program (the same below) was: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min; and storage at 16°C.

[0087] The PCR product was detected by 4% agarose gel (4 g agarose, 100 ml TAE buffer) electrophoresis at 150 V constant voltage for 30 min and photographed by UV gel imaging (the same below).

[0088] The results showed that an InDel marker BoC06ID07 located on chromosome 6 of cabbage was closely linked to high anthocyanin content, and one recombinant was detected. BoC06ID07 was further used to perform PCR amplification on 46 recessive green head (low anthocyanin content) plants. The results showed that the genetic distance between BoC06ID07 and the anthocyanin gene BoPur was 16.9cM. Based on this, it can be preliminarily determined that the cabbage anthocyanin gene BoPur is located on chromosome 6. In order to find a molecular marker that is more closely related to the cabbage high anthocyanin gene, 10 new inter-parental polymorphic InDel markers located on chromosome 6 of cabbage were further used to perform PCR amplification on the above 46 recessive green head (low anthocyanin content) plants. The results showed that the cabbage anthocyanin gene BoPur was preliminarily located between two InDel molecular markers BoC06ID25 and BoC06ID43, and their genetic distances with BoPur were both 2.2cM ( Figure 2 ).

[0089] 2. Fine localization of the cabbage anthocyanin gene BoPur

[0090] First, the PCR amplification of all recessive green head (low anthocyanin content) plants in the F2 segregation population of the combination of "Double Ring" cabbage and "Old Red" cabbage was performed using the flanking markers BoC06ID25 and BoC06ID43 in the preliminary positioning interval. Four recombinants were detected by BoC06ID25 and five recombinants were detected by BoC06ID43. Six polymorphic InDel markers between parents were further developed in the preliminary positioning interval, namely BoC06ID30, BoC06ID26, BoC06ID48, BoC06ID22, BoC06ID53, and BoC06ID39. The 9 recombinants detected were amplified by PCR using the 6 newly developed polymorphic InDel markers between the parents. The BoPur gene was finally located in the 199.5 kb region between the InDel markers BoC06ID48 and BoC06ID53. One recombinant was detected for each of these two markers, and one InDel marker, BoC06ID22, was co-segregated with the BoPur gene ( Figure 3 ).

[0091] Based on the results of resequencing the paternal and maternal genomes, the InDel marker BoC06ID22 has a 33-base deletion less in the paternal parent than in the maternal parent, and the sequence is AGCTGTGTACATAATTTGTTTTTTCTTTTTGGT (also known as the InDel1 molecular marker, abbreviated as InDel-33bp). The BoC06ID22 marker primer sequence is as follows:

[0092] 5'-TTGGGATTTTGAGAGAGAGAGACG-3', SEQ ID No. 3;

[0093] 5'-TGTTCCTAAGTTCTTTCACCAGCA-3', SEQ ID No. 4;

[0094] This primer can amplify a 300bp fragment in the parent "double ring" BoC06ID22, the sequence is:

[0095] TTGGGATTTTGAGAGAGAGAGACGACGGAGGAGGAGCAAGAAGAAGAAGGCGTTGGCAGCCTTTTTTATCAAGTCAAAAGAAAAAATGGTTGGGTTGGGTTTAACACTTCTCTCTTTAACT CTTTTCTTTTTGGTAGCTGTGTA CATAATTTGTTTTTTCTTTTTGGT CTAATGTAATATGAATTTGTTGTCTTTTTAATATGTTATGATGACTAATTTTTCTTGGATTAATTATAGATGGTAAGAAAATTGAGATAATTCGGAAAGAAATCTCCATGCTGGTGAAAGAACTTAGGAACA, which is named sequence 2, also known as SEQ ID No.2.

[0096] A 267 bp fragment was amplified from the male parent "Old Red" cabbage, and the sequence was:

[0097] TTGGGATTTTGAGAGAGAGAGACGACGGAGGAGGAGCAAGAAGAAGAAGGCGTTGGCAGCCTTTTTTATCAAGTCAAAAGAAAAAATGGTTGGGTTGGGTTTAACACTTCTCTCTTTAACT CTTTTCTTTTTGGT CTAATGTAATATGAATTTGTTGTCTTTTTAATATGTTATGATGACTAATTTTTCTTGGATTAATTATAGATGGTAAGAAAATTGAGATAATTCGGAAAGAAATCTCCATGCTGGTGAAAGAACTTAGGAACA, which is named Sequence 1, also known as SEQ ID No.1.

[0098] The nucleotide sequence of the 300 bp fragment of SEQ ID No.2 (referred to as the insertion type) and the nucleotide sequence of the 267 bp fragment of SEQ ID No.1 (referred to as the deletion type) differ only in that the insertion type is a fragment with the nucleotide sequence of positions 136 to 168 of sequence 2 (i.e., the nucleotide sequence is 5'-AGCTGTGTACATAATTTGTTTTTTCTTTTTG GT-5') inserted between the 135th thymidine deoxynucleotide and the 136th cytosine deoxynucleotide of SEQ ID No.1 (the fragment is referred to as InDel-33bp).

[0099] Example 2 Application of molecular marker BoC06ID22

[0100] 1. PCR amplification detection of molecular marker BoC06ID22 in individual plants of paternal, maternal, F1 and F2 segregating populations

[0101] The genomic DNA of the male parent, female parent, F1, and F2 segregating populations in Example 1 was extracted, and the cabbage material was as follows:

[0102] The female parent is "Shuanghuan" cabbage, the male parent is "Laohong" cabbage, the F1 plant obtained from the hybrid combination of "Shuanghuan" × "Laohong" cabbage, and the F2 segregating population obtained from the hybrid combination of "Shuanghuan" × "Laohong" cabbage contains 30 plants with purple leaf heads (high anthocyanin content) and 30 plants with green leaf heads (low anthocyanin content).

[0103] The above genomic material was subjected to PCR amplification detection using BoC06ID22 labeled primers. The genomic DNA extraction method, PCR reaction system, PCR reaction procedure and electrophoresis detection were the same as those in Example 1.

[0104] The test results showed that the PCR product of the female parent "double ring" cabbage was a specific fragment of about 300bp in size. The PCR product of the male parent "old red" cabbage was a specific fragment of more than 250bp and less than 300bp in size. Two band types were amplified in F1, namely, the PCR product was a specific fragment of 300bp in size and a specific fragment of more than 250bp and less than 300bp in size. In the F2 population, 18 of the 30 purple leaf bulb plants amplified two band types, namely, the PCR product was a specific fragment of about 300bp in size and a specific fragment of more than 250bp and less than 300bp in size, and the PCR product of the remaining 12 plants was a specific fragment of more than 250bp and less than 300bp in size; the PCR product of 30 green leaf bulb plants was a specific fragment of about 300bp in size. Figure 4 The electrophoresis results of PCR products of some plants.

[0105] The PCR products of each individual plant were recovered and sequenced. The results showed that the nucleotide sequences of the specific fragments of each plant with a size of about 300 bp were all SEQ ID No. 2 in the sequence list (containing InDel-33bp), and the nucleotide sequences of the specific fragments of each plant with a size of more than 250 bp and less than 300 bp were all SEQ ID No. 1 in the sequence list (excluding InDel-33bp).

[0106] The genotype of the plant whose PCR product is a DNA fragment with a nucleotide sequence of SEQ ID No.2 (containing InDel-33bp) in the sequence list is defined as an insertion type, the genotype of the plant whose PCR product is two DNA fragments, a nucleotide sequence of SEQ ID No.2 (containing InDel-33bp) in the sequence list and a nucleotide sequence of SEQ ID No.1 (not containing InDel-33bp) in the sequence list is defined as an insertion / deletion type, and the genotype of the plant whose PCR product is a DNA fragment with a nucleotide sequence of SEQIDNo.1 (not containing InDel-33bp) in the sequence list is defined as a deletion type.

[0107] The color of the leaves of the female parent "Double Ring" cabbage, the male parent "Old Red" cabbage, and the F2 generation of "Double Ring" cabbage × "Old Red" cabbage during the heading period was observed to determine whether the leaves were purple. The results showed that the leaves of the female parent "Double Ring" cabbage and the F2 generation of "Double Ring" cabbage × "Old Red" cabbage with the genotype of insertion were green and did not have purple (such as Figure 1 The leaves of the F2 generation plants of the "double ring" cabbage × "old red" cabbage with the genotype of insertion / deletion type and the genotype of deletion type were purple during the heading period (as shown in Figure c). Figure 1 (a, b in the figure). This indicates that the BoC06ID22 marker can separate the plants with high anthocyanin content and low anthocyanin content.

[0108] Table 1. Genotypes and anthocyanin content of individual plants 1-60 of the female parent "Double Ring" cabbage, the male parent "Old Red" cabbage, and the F2 generation of "Double Ring" cabbage × "Old Red" cabbage, as well as whether the leaves are purple during the heading stage.

[0109]

[0110]

[0111]

[0112] 2. PCR amplification and detection of molecular marker BoC06ID22 in other cabbage materials

[0113] To further verify the accuracy of the BoC06ID22 marker, PCR amplification detection was performed on 9 cabbage materials. The 9 cabbage materials are as follows:

[0114] Zhongshu 013-8 cabbage, Northwest Chunyuan 55 cabbage, Changzheng 1 cabbage, Changzheng 6 cabbage, Changzheng 7 cabbage, Changzheng 8 cabbage, Changzheng 9 cabbage, Xiehe N-43 cabbage, Japanese purple cabbage and 2 types of kale (ornamental kale and transformed ornamental kale).

[0115] The genomic DNA of the above materials was extracted, and the genome of the above cabbage materials was amplified by PCR using BoC06ID22 labeled primers. The PCR reaction system, PCR reaction procedure and electrophoresis detection were the same as those in Example 1.

[0116] Test results such as Figure 5 As shown, G1-G8 are green (low anthocyanin) cabbage materials: Zhongshu 013-8, Xibei Chunyuan 55, Changzheng 1, Changzheng 6, Changzheng 7, Changzheng 8, Changzheng 9, Xiehe N-43; P1-P3 are purple (high anthocyanin) cabbage materials: ornamental cabbage, ornamental cabbage and Japanese purple cabbage. In all purple cabbage (high anthocyanin content) materials, including ornamental cabbage, ornamental cabbage and Japanese purple cabbage, two types of bands were detected, namely, a fragment of 267bp in length and a hybrid band type containing both 300bp and 267bp fragments. In all green cabbage (low anthocyanin content) materials, only a fragment of 300bp in length was detected, indicating that the marker has reliability and wide applicability.

[0117] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention can be implemented in a wider range with equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without unnecessary experiments. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In summary, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including those that depart from this invention. The scope has been disclosed in the application, and modifications can be made using conventional techniques known in the art. Application of some of the essential features can be made within the scope of the following appended claims.

Claims

1. Any of the following uses of primers for detecting InDel1 molecular markers, wherein the InDel1 molecular marker is a DNA molecule having a nucleotide sequence of positions 136 to 168 of SEQ ID No. 2: A1) use of primers for detecting InDel1 molecular markers in predicting whether cabbage leaves have purple color; A2) use of primers for detecting InDel1 molecular markers in preparing a product for predicting whether cabbage leaves have purple color; A3) Application of primers for detecting the InDel1 molecular marker in the breeding of high purple pigment cabbage; A4) Use of primers for detecting the InDel1 molecular marker in preparing a product for breeding high purple pigment cabbage; The purple pigment is anthocyanin.

2. The use according to claim 1, characterized in that The primers are A and B; A is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.3; B is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.

4.

3. A method for identifying the content of purple pigment in cabbage, characterized in that: The method detects whether the cabbage genome to be tested has the InDel1 molecular marker described in claim 1, and identifies or assists in identifying the purple pigment content of the cabbage according to whether the InDel1 molecular marker is present; The purple pigment is anthocyanin.

4. A method for predicting whether cabbage leaves have purple color, characterized in that: The method comprises detecting whether the genome of the cabbage to be tested has the InDel1 molecular marker described in claim 1, and identifying or assisting in identifying whether the cabbage leaves have purple color according to whether the InDel1 molecular marker is present.

5. The method according to claim 3 or 4, characterized in that The primers for detecting the InDel1 molecular marker described in claim 1 or 2 are used for relevant detection.

6. A kit, characterized in that: The kit comprises the primers for detecting the InDel1 molecular marker as described in claim 2.

Images