A method for genetic transformation of eryngii

Abstract

The application discloses a genetic transformation method of Eutrema sibiricum, and comprises the following steps: (1) selecting Eutrema sibiricum stem segments; (2) pre-culturing the stem segments; (3) Agrobacterium infection; (4) co-culturing the stem segments with Agrobacterium; (5) inducing the formation of callus; (6) inducing the callus to form sprouts; and (7) inducing the sprouts to root and regenerate plants. The application fills the blank of the high-efficiency genetic transformation method of Eutrema sibiricum at home and abroad; transgenic Eutrema sibiricum can be obtained in about half a month, the time for verifying the function of genes is greatly shortened compared with other horticultural crops; the regeneration rate of Eutrema sibiricum plants obtained by using the genetic transformation method reaches 100%, the transgenic positive rate reaches 10%, and the success rate is much higher than that of the previous methods.

Description

Technical Field

[0001] This invention relates to a method for verifying plant gene function, and more particularly to a method for genetic transformation of watercress. Background Technology

[0002] Watercress, also known as Chinese watercress, belongs to the genus *Watercress* in the family Brassicaceae. It reproduces both asexually and sexually, and exists in diploid, triploid, and tetraploid forms in nature. It is a plant that can be both aquatic and terrestrial, and is found wild in Asia, Africa, and Europe. It has excellent taste and nutritional value; it is high in glucosinolate metabolites and polyphenols, making it a vegetable with high health benefits; and it has a strong ability to purify water, thus possessing significant ecological and environmental benefits.

[0003] Gene function verification is an important part of modern molecular experiments. The technology is relatively mature in field crops such as corn, soybeans, and rice. However, watercress is a niche vegetable, and research on watercress, both domestically and internationally, has mostly focused on its cultivation methods. To date, there are very few methods for verifying the gene function of watercress, and there is virtually no research on the selection of superior varieties or the discovery of superior genes. Due to the slow progress of watercress-related research both domestically and internationally, no predecessors have established an efficient genetic transformation system for watercress. This has created certain obstacles for carrying out watercress breeding and the discovery of superior genes.

[0004] Agrobacterium infection is an important means of genetic transformation. In Agrobacterium-infected transformation, inducing callus formation from successfully infected watercress stem segments is the most crucial step in forming regenerated plants. Successful Agrobacterium infection and the ease of callus formation are the two most important factors. Two key factors for successful Agrobacterium infection are whether the Vir gene of Agrobacterium is activated and whether the infected cells are in the S phase of cell division. Two main factors influence callus formation: the genotype effect of the selected material and the age of the material's organs. Zhang Nan et al. used tender stems of wild watercress as explants, but the formation of regenerated seedlings required at least three months, resulting in a long cycle, high late-stage investment, and low efficiency. Shinjiro Ogita et al. used watercress internodes as material to induce rooting and budding, but this resulted in buds directly arising from the stem segments without callus formation, making efficient regeneration difficult. Currently, watercress stem segments are the most common site for callus induction, but their high degree of differentiation makes callus induction difficult and time-consuming. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a method for efficient genetic transformation of watercress, which can reduce the plant regeneration cycle and improve the efficiency of genetic transformation.

[0006] Technical solution: To achieve the above-mentioned objective, this invention provides a method for genetic transformation of watercress, comprising the following steps:

[0007] (1) Select watercress stem segments;

[0008] (2) The watercress stem segments described in step (1) were inoculated onto a pre-culture medium containing cytokinins and plant growth hormones for pre-culture;

[0009] (3) Place Agrobacterium in Agrobacterium culture medium and shake to activate it. Infect the stem segments obtained from the pre-culture in step (2) with Agrobacterium in a vacuum environment.

[0010] (4) Use filter paper to absorb the excess bacterial solution on the stem segment infected by Agrobacterium in step (3), and then inoculate the stem segment onto the co-culture medium for culture.

[0011] (5) Wash the co-cultured stem segments obtained in step (4) with sterile water, and then inoculate the stem segments onto the callus induction medium to induce the stem segments to form callus tissue;

[0012] (6) Inoculate the callus tissue described in step (5) onto the bud differentiation culture medium until buds form on the callus tissue;

[0013] (7) Cut off the buds on the callus tissue obtained in step (6) and place them on the rooting medium for culture until they take root and form regenerated plants.

[0014] Preferably, the watercress stem segment in step (1) is a sterile stem segment with leaves removed, measuring 1-2 cm in length.

[0015] Preferably, in step (2), the pre-culture medium is MS medium, with 6-8 mg / L 6-BA, 2-5 mg / L 2,4-D, and 0.2-0.25 M mannitol added to adjust the pH of the medium. The culture conditions are to culture in the dark in a light incubator for 1-2 days, and to take it out when it grows a 0.5-1 cm pale yellow and slightly transparent deformed swollen bud.

[0016] By pre-culturing, abnormally swollen buds are induced in watercress stem segments. These abnormally swollen buds are then used to induce callus tissue. The reason for choosing abnormally swollen buds instead of watercress stem segments as the target for callus induction is that abnormally swollen buds are in their young stage with vigorous cell division, which perfectly meets the early conditions for callus induction, thus reducing a large amount of initial investment. At the same time, under the action of auxin and cytokinin, the wounds of this old organ, the watercress stem node, can produce a large amount of callus in a short period of time.

[0017] Preferably, in step (3), the Agrobacterium culture medium is MS liquid culture medium, with AS added to adjust the pH of the culture medium, and the bacterial solution is activated by shaking until the OD value is 0.5-1, and then infected under vacuum.

[0018] Preferably, the Agrobacterium used is Agrobacterium GV3101.

[0019] Preferably, in step (4), the co-culture medium is MS medium, with 4-5 mg / L AS, 6-8 mg / L 6-BA, 2-5 mg / L 2,4-D, VC, and melatonin added to adjust the pH of the medium, and the co-culture time is 1-2 days.

[0020] Preferably, in step (5), the callus induction medium is MS medium, with the following components added: 3-6.5 mg / L 6-BA, 2.2-5 mg / L 4-D, 2 mg / L melatonin, 2-100 mg / L VC, 3-5 mg / L MES, inositol, glutamic acid, and glycine. The pH of the medium is adjusted to 6.2, and the medium is cultured in the dark in a light incubator.

[0021] Preferably, in step (6), the bud differentiation medium is MS medium, with 1.5-2.5 mg / L 6-BA, 4-5 mg / L NAA, 3-5 mg / L TDZ, and 3-5 mg / L MES added to adjust the pH of the medium, and cultured in a light incubator.

[0022] Preferably, in step (7), the rooting medium is MS medium, and the culture is carried out in a light incubator.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) It can obtain transgenic watercress in about one and a half months, which greatly shortens the time for gene function verification compared with other horticultural crops; (2) The regeneration rate of watercress plants obtained by using this genetic transformation method reaches 100%, and the transgenic positive rate reaches 10%, which is far higher than the previous methods; (3) Through pre-culture, watercress stem segments produce abnormally swollen buds, and callus tissue is induced by using these abnormally swollen buds instead of directly using watercress stem segments as the object of callus induction, which can generate a large number of calluses in a short time; (4) In the Agrobacterium activation stage, an appropriate concentration of acetylsuccione is selected to activate the Vir gene of Agrobacterium, and at the same time, through pre-culture, a large number of cells are in the S phase of division, providing the best cell state for Agrobacterium infection; (5) During infection, vacuuming is used to ensure that a large number of bacterial solutions can fully contact plant cells, ensuring that Agrobacterium can quickly invade and implant cells during the co-culture period. Attached Figure Description

[0024] Figure 1 It is a stem segment of watercress;

[0025] Figure 2 The stem segment after being infected with Agrobacterium;

[0026] Figure 3 For the induced callus cell clusters;

[0027] Figure 4To induce the formation of callus buds;

[0028] Figure 5 To induce the formation of adventitious roots between bud nodes;

[0029] Figure 6 The plant is intact;

[0030] Figure 7 The results are from the GFP protein fluorescence detection.

[0031] Figure 8 PCR positive result; M: DL2000 DNA maker; CK: control without target gene; 1, 2, 3: ClaI gene band. Detailed Implementation

[0032] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0033] Example 1

[0034] pEASY-Blunt Cloning Vector: Beijing TransGen Biotech Co., Ltd., catalog number cb101-02; ClonExpressMltra One Step Cloning Kit: Nanjing Novizan Biotechnology Co., Ltd., catalog number c115-02; Escherichia coli DH5α; Agrobacterium GV3101.

[0035] (1) Design primer sequences for the ClaI gene

[0036] Primers for the full-length gene ClaI, a chloroplast-related gene, were designed using the primer design software BioXM2.7.

[0037] Pre-primer 1: ATGGACCAGTACCCATCATCTTT (SEQ ID NO:1);

[0038] Back primer 1: AAGATGATGGGTACTGGTCCAT (SEQ ID NO:2).

[0039] Add a BamHI restriction site and a protective base to the 5' end of the front primer, and add a KpnI restriction site and a protective base to the 3' end of the back primer.

[0040] Pre-primer 2: TCGACCCCGGGGGTACATGGACCAGTACCCATCATCTT (SEQ ID NO: 3)

[0041] Back primer 2: AAGATGATGGGTACTGGTCCAT TTGCTCACCATGGATC (SEQ ID NO:4)

[0042] ClaI gene: (SEQ ID NO:5)

[0043] Using the mRNA transcribed from the ClaI gene as a template, it is reverse transcribed into cDNA. The cDNA is then used as a template to amplify the PCR product, which is the ClaI gene without introns.

[0044] (2) The PCR product obtained in step (1) is ligated to the pEASY-Blunt Cloning Vector to obtain the ligation product.

[0045] The connection system is as follows:

[0046] 4 μl of PCR product

[0047] pEASY-Blunt Cloning Vector 1μl

[0048] (3) Transformation of the ligation product into Escherichia coli

[0049] First, gently mix the ligation product from step (2) with 50 μl of DH5α competent cells and incubate on ice for 20–30 min; heat the mixture at 42°C for 30 s, immediately place it on ice for 2 min, then add 250 μl of LB medium at 25°C, shake at 200 r / min, and incubate at 37°C for 1 h to obtain LB plates.

[0050] The second step involves mixing 8 μl of 500 mM IPTG with 40 μl of 20 mg / ml X-gal, spreading the mixture evenly on the LB plate, and incubating at 37°C for 30 min.

[0051] Third, after IPTG and X-gal are absorbed by the LB plate, take 200 μl of E. coli culture and spread it on the LB plate, and incubate overnight.

[0052] (4) Sequencing was performed to obtain positive clones for propagation, and E. coli plasmids were extracted.

[0053] (5) Amplify the target gene of the E. coli plasmid obtained in step (4). The following two amplification systems and reaction procedures can be used for target gene amplification.

[0054] Table 1 PCR amplification system for target genes ①

[0055]

[0056]

[0057] Reaction procedure:

[0058]

[0059] Table 2 PCR amplification system for target genes ②

[0060]

[0061] Reaction procedure:

[0062]

[0063] (6) Overexpression vector pR101-W40 double digestion.

[0064] Table 3. P101-W40 double enzyme digestion system

[0065]

[0066] Reaction procedure: Incubate at 37°C for 2 hours

[0067] (7) Ligate the PCR product obtained in step (5), i.e. the target gene, with the pR101-W40 vector.

[0068] Table 4 Connecting Carrier System

[0069]

[0070] Reaction procedure: React at 50℃ for 5–15 min.

[0071] (8) Transform the recombinant product obtained in step (7) into Escherichia coli DH5α competent cells, in the same manner as in step (3).

[0072] (9) Sequencing was used to obtain positive single clones for propagation, and E. coli plasmids were extracted. The plasmids were then transformed into GV3101 Agrobacterium C58 competent cells using heat shock transformation to obtain Agrobacterium carrying the ClaI gene, which was then used for genetic transformation.

[0073] Example 2

[0074] In this embodiment, the watercress selected is Guangxi large-leaf watercress, and the MS medium is from Nanjing Zhengyang Biotechnology Co., Ltd., catalog number M519-100L.

[0075] A method for genetic transformation of watercress includes the following steps:

[0076] (1) Selection of watercress stem segments: At the Vegetable Tissue Culture Center of Nanjing Agricultural University, select healthy sterile seedlings of watercress, remove the leaves of the plants on a clean bench, leaving only the stem segments, and cut the watercress stem segments into 1-2 cm lengths.

[0077] (2) Stem segment pre-culture: The stem segments cut in step (1) were inoculated onto the pre-culture medium using sterile forceps. The pre-culture medium was MS medium, with the following components added: 7.2 mg / L 6-BA, 4.5 mg / L 2,4-D, and 0.25 M mannitol. The pH of the medium was adjusted to 6.2, and the culture dishes were sealed with paraffin film. The pre-culture medium was incubated in the dark at 25°C in a light incubator for 1 day. The stem segments were removed when they grew into 0.5-1 cm pale yellow, slightly transparent, abnormally swollen buds.

[0078] (3) Agrobacterium infection: Agrobacterium with ClaI gene obtained in Example 1 was placed in Agrobacterium culture medium and shaken to activate it. Agrobacterium culture medium is MS liquid medium, with 10 mg / L AS added. The pH was adjusted to 6.2 and the rotation speed was 200 r / min. When the OD value of Agrobacterium culture liquid was 1, the watercress stem segment with abnormally swollen buds in step (2) was placed into Agrobacterium culture liquid and infected in a vacuum environment for 20 min.

[0079] (4) Agrobacterium co-culture of stem segments: On a clean bench, place the watercress stem segments infected with Agrobacterium in step (3) on a sterile filter paper plate. After wiping the excess bacterial solution off the stem segments with filter paper, inoculate the stem segments onto the co-culture medium. The co-culture medium is MS medium, with the following components added: 5 mg / L AS, 8 mg / L 6-BA, 5 mg / L 2,4-D, 100 mg / L VC, and 1 mg / L melatonin. Adjust the pH of the medium to 6.2 and culture for 2 days.

[0080] (5) Induction of callus formation: On a clean bench, the stem segments co-cultured in step (4) were transferred to sterile filter paper using sterile forceps. After washing the stem segments with sterile water, they were transferred to callus induction medium. The callus induction medium was MS medium, with the following additional components: 6.5 mg / L 6-BA, 4.5 mg / L 2,4-D, 2 mg / L melatonin, 100 mg / L vitamin C, 5 mg / L MES, 50 mg / L inositol, 100 mg / L glutamate, and 100 mg / L glycine. The pH of the medium was adjusted to 6.2. After the stem segments were transferred to the callus induction medium, they were cultured in the dark for 15 days until callus formation occurred.

[0081] (6) Inducing callus to form buds: The callus formed in step (5) was transferred to the bud differentiation medium for culture. The bud differentiation medium was MS medium, with the following components added: 1.5 mg / L 6-BA, 4.5 mg / L NAA, 5 mg / L TDZ, 3 mg / L MES, and 0.5 mg / L 2,4-D. The pH of the medium was adjusted to 6.2. The culture dish was sealed with paraffin film and placed in a 25°C light incubator. It was cultured for 8 hours in the dark and 16 hours in the light, with a light intensity of 20,000 lux, for 5 days until the callus grew buds.

[0082] (7) Inducing root regeneration of plants: On a clean bench, use sterile tweezers to inoculate the callus tissue that has sprouted in step (6) onto the rooting induction medium. The rooting induction medium is MS medium. The culture dish is sealed with paraffin film. The medium is placed in a 25°C light incubator. It is cultured for 8 hours in the dark and 16 hours in the light, with a light intensity of 20,000 lux, for 7 days until adventitious roots spontaneously form at the bud nodes.

[0083] (8) Positive seedling detection: The regenerated seedlings with adventitious roots formed in step (7) were placed under a stereofluorescent microscope for GFP fluorescence identification to obtain the number of regenerated budding stem segments. At the same time, DNA was extracted from the leaves of watercress for PCR positive detection to obtain the number of positive seedlings.

[0084] The primers used for detection are the front primer 1 and the back primer 1 from Example 1. A positive result will show a band of the target size. Under a fluorescence microscope, the excitation wavelength is 480 nm. Materials that are genetically converted to positive will show green fluorescence, while negative seedlings will not show fluorescence.

[0085] Conclusion: The plant regeneration rate obtained using this method was 100%, and the positive rate was 10.98%. It takes a total of 30 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0086] Positive rate = Number of positive seedlings containing the ClaI gene / Total number of regenerated seedlings; Regeneration rate = Number of regenerated budding stem segments / Total number of stem segments.

[0087] Example 3

[0088] The steps are the same as in Example 2, except that additional components are added to the MS culture medium and the culture time is adjusted in the following steps.

[0089] (2) Stem segment pre-culture: Pre-culture medium, MS medium with 6 mg / L 6-BA, 2 mg / L 2,4-D, 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0090] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 0.5; infect under vacuum for 20 min.

[0091] (4) Co-culture of Agrobacterium stem segments: The co-culture medium, MS medium, was supplemented with 6 mg / L 6-BA, 2 mg / L 2,4-D and 4 mg / L AS; the pH was adjusted to 6.2; and cultured for 2 days.

[0092] (5) Induction of callus formation: The callus induction medium, MS medium, was supplemented with 4 mg / L 6-BA, 4 mg / L 2,4-D, 2 mg / L melatonin, 2 mg / L VC and 4 mg / L MES, and the pH was adjusted to 6.2. The medium was cultured for 15 days.

[0093] (6) Induction of callus formation: Bud differentiation medium, MS medium with 2 mg / L 6-BA, 4 mg / L NAA, 3 mg / L TDZ and 4 mg / L MES added, pH adjusted to 6.2, cultured for 5 days.

[0094] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0095] Conclusion: The plant regeneration rate obtained by this method was 81%, the positive rate was 9.12%, and it took a total of 31 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0096] Example 4

[0097] The steps are the same as in Example 2, except that additional components are added to the MS culture medium and the culture time is adjusted in the following steps.

[0098] (2) Stem segment pre-culture: Pre-culture medium, MS medium with 6 mg / L 6-BA, 2 mg / L 2,4-D, 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0099] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 0.5; infect under vacuum for 20 min.

[0100] (4) Co-culture of Agrobacterium stem segments: The co-culture medium, MS medium, was supplemented with 6 mg / L 6-BA, 2 mg / L 2,4-D and 4 mg / L AS; the pH was adjusted to 6.2; and cultured for 2 days.

[0101] (5) Induction of callus formation: The callus induction medium, MS medium, was supplemented with 4 mg / L 6-BA, 4 mg / L 2,4-D, 2 mg / L melatonin, 2 mg / L VC and 4 mg / L MES, and the pH was adjusted to 6.2. The medium was cultured for 15 days.

[0102] (6) Induction of callus formation: Bud differentiation medium, MS medium with 2.5 mg / L 6-BA, 5 mg / L NAA, 4 mg / L TDZ and 5 mg / L MES added, pH adjusted to 6.2, cultured for 5 days.

[0103] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0104] Conclusion: The plant regeneration rate obtained by this method was 87%, the positive rate was 10.33%, and it took a total of 31 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0105] Example 5

[0106] Same as Example 2, except that additional components and incubation time are added to the MS medium in the following steps.

[0107] (2) Stem segment pre-culture: Pre-culture medium, MS medium with 6 mg / L 6-BA, 2 mg / L 2,4-D, 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0108] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 0.5; infect under vacuum for 20 min.

[0109] (4) Co-culture of Agrobacterium stem segments: The co-culture medium, MS medium, was supplemented with 6 mg / L 6-BA, 2 mg / L 2,4-D and 4 mg / L AS; the pH was adjusted to 6.2; and cultured for 2 days.

[0110] (5) Induction of callus formation: Callus induction medium, MS medium with 5 mg / L 6-BA, 5 mg / L 2,4-D, 2 mg / L melatonin, 3 mg / L VC and 5 mg / L MES added, pH adjusted to 6.2, cultured for 15 days.

[0111] (6) Induction of callus formation: Bud differentiation medium, MS medium with 1.5 mg / L 6-BA, 4 mg / L NAA, 3 mg / L TDZ and 3 mg / L MES added, pH adjusted to 6.2, cultured for 5 days.

[0112] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0113] Conclusion: The plant regeneration rate obtained by this method was 93%, the positive rate was 8.24%, and it took a total of 31 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0114] Example 6

[0115] Same as Example 2, except that additional components and incubation time are added to the MS medium in the following steps.

[0116] (2) Stem segment pre-culture: Pre-culture medium, MS with 8 mg / L 6-BA, 5 mg / L 2,4-D and 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0117] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 1, and infected under vacuum for 20 min.

[0118] (4) Co-culture of Agrobacterium tumefaciens in stem segments: The co-culture medium, MS medium, is supplemented with 8 mg / L 6-BA, 5 mg / L 2,4-D and 5 mg / L AS, and the pH is adjusted to 6.2. The culture is carried out for 2 days.

[0119] (5) Induction of callus formation: The callus induction medium was supplemented with 3 mg / L 6-BA, 2 mg / L 2,4-D, 2 mg / L melatonin, 2 mg / L VC and 3 mg / L MES; the pH was adjusted to 6.2 and cultured for 15 days.

[0120] (6) Induction of callus formation: Bud differentiation medium, MS medium with 2.5 mg / L 6-BA, 5 mg / L NAA, 4 mg / L TDZ and 5 mg / L MES added; pH adjusted to 6.2 and cultured for 5 days.

[0121] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0122] Conclusion: The plant regeneration rate obtained by this method was 91%, the positive rate was 9.89%, and it took a total of 31 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0123] Example 7

[0124] Same as Example 2, except that additional components and incubation time are added to the MS medium in the following steps.

[0125] (2) Stem segment pre-culture: Pre-culture medium, MS with 8 mg / L 6-BA, 5 mg / L 2,4-D and 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0126] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 1, and infected under vacuum for 20 min.

[0127] (4) Co-culture of Agrobacterium tumefaciens in stem segments: The co-culture medium, MS medium, is supplemented with 8 mg / L 6-BA, 5 mg / L 2,4-D and 5 mg / L AS, and the pH is adjusted to 6.2. The culture is carried out for 2 days.

[0128] (5) Induction of callus formation: Dedifferentiation medium, MS with 4 mg / L 6-BA, 4 mg / L 2,4-D, 2 mg / L melatonin, 2 mg / L VC and 4 mg / L MES added, pH adjusted to 6.2, cultured for 15 days.

[0129] (6) Induction of callus formation: Bud differentiation medium, MS medium with 1.5 mg / L 6-BA, 4 mg / L NAA, 3 mg / L TDZ and 3 mg / L MES added, pH adjusted to 6.2, cultured for 5 days.

[0130] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0131] Conclusion: The plant regeneration rate obtained by this method was 86%, the positive rate was 9.78%, and it took a total of 31 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0132] Example 8

[0133] The steps are the same as in Example 2, except that additional components and incubation time are added to the MS medium in the following steps.

[0134] (2) Stem segment pre-culture: Pre-culture medium, MS with 8 mg / L 6-BA, 5 mg / L 2,4-D and 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0135] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 1, and infected under vacuum for 20 min.

[0136] (4) Co-culture of Agrobacterium tumefaciens in stem segments: The co-culture medium, MS medium, is supplemented with 8 mg / L 6-BA, 5 mg / L 2,4-D and 5 mg / L AS, and the pH is adjusted to 6.2. The culture is carried out for 2 days.

[0137] (5) Induction of callus formation: Dedifferentiation medium, MS with 4 mg / L 6-BA, 4 mg / L 2,4-D, 2 mg / L melatonin, 2 mg / L VC and 4 mg / L MES added, pH adjusted to 6.2, cultured for 15 days.

[0138] (6) Induction of callus formation: Bud differentiation medium, MS medium with 2.5 mg / L 6-BA, 5 mg / L NAA, 4 mg / L TDZ and 5 mg / L MES added, pH adjusted to 6.2, cultured for 5 days.

[0139] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0140] Conclusion: The plant regeneration rate obtained by this method was 97%, the positive rate was 9.22%, and it took a total of 31 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0141] Example 9

[0142] The steps are the same as in Example 2, except that...

[0143] (2) Stem segment pre-culture: Pre-culture medium, MS with 8 mg / L 6-BA, 5 mg / L 2,4-D and 0.2 M mannitol added, pH adjusted to 6.2, cultured for 2 days.

[0144] (3) Agrobacterium infection: Agrobacterium culture medium, MS medium with 10 mg / L AS added, pH adjusted to 6.2, shaken until the OD value of the bacterial solution is 1, and infected under vacuum for 20 min.

[0145] (4) Co-culture of Agrobacterium tumefaciens in stem segments: The co-culture medium, MS medium, is supplemented with 8 mg / L 6-BA, 5 mg / L 2,4-D and 5 mg / L AS, and the pH is adjusted to 6.2. The culture is carried out for 2 days.

[0146] (5) Induction of callus formation: Dedifferentiation medium, MS with 5 mg / L 6-BA, 5 mg / L 2,4-D, 2 mg / L melatonin, 3 mg / L VC and 5 mg / L MES added, pH adjusted to 6.2, cultured for 15 days.

[0147] (6) Induction of callus formation: Bud differentiation medium, MS medium with 1.5 mg / L 6-BA, 4 mg / L NAA, 3 mg / L TDZ and 3 mg / L MES added, pH adjusted to 6.2, cultured for 5 days.

[0148] (7) Inducing rooted and regenerated plants: cultured on MS medium for 7 days.

[0149] Conclusion: The plant regeneration rate obtained by this method was 82%, the positive rate was 9.11%, and the total time from the selection of watercress stem segments in step (1) to the formation of regenerated plants was 31 days.

[0150] Comparative Example 1

[0151] Existing culture media for genetic transformation:

[0152] (1) Selection of watercress stem segments: At the Vegetable Tissue Culture Center of Nanjing Agricultural University, select healthy sterile seedlings of watercress, remove the leaves of the plants on a clean bench, leaving only the stem segments, and cut the watercress stem segments into 1-2 cm lengths.

[0153] (2) Agrobacterium infection: The Agrobacterium carrying the ClaI gene obtained in Example 1 was placed in Agrobacterium culture medium and shaken to activate it. The Agrobacterium culture medium was MS liquid medium, with 100 μmol / L AS and 30 g / L sucrose added. The pH was adjusted to 5.8 and the rotation speed was 200 r / min. When the OD value of the Agrobacterium culture was 0.5, the watercress stem segment from step (1) was placed in the Agrobacterium culture medium and infected under vacuum for 15 min.

[0154] (3) Agrobacterium co-culture of stem segments: On a clean bench, place the watercress stem segments infected with Agrobacterium in step (2) on a sterile filter paper plate. After wiping off the excess bacterial solution on the stem segments with filter paper, inoculate the stem segments onto the co-culture medium. The co-culture medium is MS medium, with the following components added: 0.5 mg / L NAA, 4 mg / L 6-BA, 4 mg / L AgNO3, and 100 μmol / LAS. Adjust the pH to pH 6.2 and culture for 2 days.

[0155] (4) Induction of callus and bud differentiation: On a clean bench, the stem segments co-cultured in step (3) were transferred to sterile filter paper with sterile tweezers. After washing the stem segments with sterile water, they were transferred to the callus induction medium. The callus induction medium was MS medium with the following additional components: 0.5 mg / L NAA, 4 mg / L 6-BA, 34 mg / L AgNO, 200 mg / L TMT, and 25 mg / L Hyg. The pH was adjusted to 5.8 and the cells were cultured in the dark for 14 days.

[0156] (5) Inducing root regeneration of plants: On a clean bench, use sterile tweezers to inoculate the callus tissue that has sprouted in step (4) onto the rooting induction medium. The rooting induction medium is MS medium. MS medium is supplemented with 1 mg / L NAA / IBA and 200 mg / L TMT. Adjust the pH to 5.8. Seal the culture dish with paraffin film. Place the medium in a 25℃ light incubator. Culture for 8 hours under dark conditions and 16 hours under light conditions every day. The light intensity is 20000 lux. Culture for 30 days until adventitious roots spontaneously form between the bud nodes.

[0157] (6) Positive seedling detection: The regenerated seedlings with adventitious roots formed in step (5) were placed under a stereofluorescence microscope for GFP fluorescence identification to obtain the number of regenerated bud stem segments. At the same time, DNA was extracted from the leaves of watercress for PCR positive detection to obtain the number of positive seedlings.

[0158] The primers used for detection are the front primer 1 and the back primer 1 from Example 1. A positive result will show a band of the target size. Under a fluorescence microscope, the excitation wavelength is 480 nm. Materials that are genetically converted to positive will show green fluorescence, while negative seedlings will not show fluorescence.

[0159] Conclusion: The plant regeneration rate obtained by this method was 20%, the positive rate was 0%, and it took a total of 61 days from the selection of watercress stem segments in step (1) to the formation of regenerated plants.

[0160] Table 5 Plant regeneration rate and positive rate

[0161]

Claims

1. A method for genetic transformation of watercress, characterized in that, Includes the following steps: (1) Select watercress stem segments; (2) The watercress stem segments described in step (1) are inoculated onto a pre-culture medium containing cytokinins and plant growth hormones for pre-culture; The pre-culture medium is MS medium, with 6~8 mg / L 6-BA, 2~5 mg / L 2,4-D, and 0.2~0.25 M mannitol added. The pH of the medium is adjusted to 6.

2. The culture conditions are to culture in the dark in a light incubator for 1~2 days, and to take it out when it grows 0.5~1 cm of pale yellow and slightly transparent abnormal swollen buds. (3) Place Agrobacterium in Agrobacterium culture medium and shake to activate it. Infect the stem segments obtained from the pre-culture in step (2) with Agrobacterium under vacuum. The Agrobacterium culture medium is MS liquid medium, with 10 mg / L AS added. Adjust the pH of the culture medium to 6.2, shake to activate the bacterial solution to an OD value of 0.5~1, and infect under vacuum for 20 min. (4) Use filter paper to absorb the excess bacterial solution on the stem segment infected by Agrobacterium in step (3), and then inoculate the stem segment onto a co-culture medium for culture; the co-culture medium is MS medium, with 4~5 mg / L AS, 6~8 mg / L 6-BA, 2~5 mg / L 2,4-D, 2~100 mg / L VC, 1~2 mg / L melatonin added, the pH of the medium is adjusted to 6.2, and the co-culture time is 1~2 days; (5) Wash the co-cultured stem segments obtained in step (4) with sterile water, and then inoculate the stem segments onto the callus induction medium to induce the formation of callus tissue; the callus induction medium is MS medium, with the following components added: 3~6.5 mg / L 6-BA, 2~5 mg / L 2,4-D, melatonin, 2~100 mg / L VC, 3~5 mg / L MES, and adjust the pH of the medium to 6.2, and culture in the dark in a light incubator; (6) The callus tissue described in step (5) is inoculated onto the bud differentiation medium until buds are formed on the callus tissue; the bud differentiation medium is MS medium, with 1.5~2.5 mg / L 6-BA, 4~5 mg / L NAA, 3~5 mg / L TDZ, and 3~5 mg / L MES added, the pH of the medium is adjusted to 6.2, and cultured in a light incubator; (7) Cut off the buds on the callus tissue obtained in step (6) and place them on the rooting medium for culture until they take root and form regenerated plants.

2. A method for genetic transformation of watercress, characterized in that, Includes the following steps: (1) Select watercress stem segments; (2) The watercress stem segments described in step (1) are inoculated onto a pre-culture medium containing cytokinins and plant growth hormones for pre-culture; The pre-culture medium was MS medium, with the addition of 7.2 mg / L 6-BA, 4.5 mg / L 2,4-D, and 0.25 M mannitol. The pH of the medium was adjusted to 6.

2. The culture conditions were to culture in the dark in a light incubator for 1 day, and to remove the 0.5-1 cm pale yellow and slightly transparent abnormal swollen buds. (3) Place Agrobacterium in Agrobacterium culture medium and shake to activate it. Infect the stem segments obtained from the pre-culture in step (2) with Agrobacterium under vacuum. The Agrobacterium culture medium is MS liquid culture medium with 10 mg / L AS added. Adjust the pH to 6.2, shake to activate the bacterial solution until the OD value is 1, and infect under vacuum for 20 min. (4) Use filter paper to absorb the excess bacterial solution on the stem segment infected by Agrobacterium in step (3), and then inoculate the stem segment onto a co-culture medium for culture; the co-culture medium is MS medium, with 5 mg / L AS, 8 mg / L 6-BA, 5 mg / L 2,4-D, 100 mg / L VC, and 1 mg / L melatonin added, and the pH of the medium is adjusted to 6.2, and the co-culture time is 2 days; (5) Wash the co-cultured stem segments obtained in step (4) with sterile water, and then inoculate the stem segments onto the callus induction medium to induce the formation of callus tissue; the callus induction medium is MS medium, with the following components added: 6.5 mg / L 6-BA, 4.5 mg / L 2,4-D, 2 mg / L melatonin, 100 mg / L VC, 5 mg / L MES, 50 mg / L inositol, 100 mg / L glutamate, and 100 mg / L glycine. Adjust the pH of the medium to 6.2 and culture in the dark in a light incubator. (6) The callus tissue described in step (5) is inoculated onto the bud differentiation medium until buds are formed on the callus tissue; the bud differentiation medium is MS medium, with 1.5 mg / L 6-BA, 4.5 mg / L NAA, 5 mg / L TDZ, 3 mg / L MES, and 0.5 mg / L 2,4-D added, and the pH of the medium is adjusted to 6.2, and cultured in a light incubator; (7) Cut off the buds on the callus tissue obtained in step (6) and place them on the rooting medium for culture until they take root and form regenerated plants.

3. The method for genetic transformation of watercress according to claim 1, characterized in that, The watercress stem segment in step (1) is a sterile stem segment with leaves removed, measuring 1 to 2 cm in length.

4. The method for genetic transformation of watercress according to claim 1, characterized in that, The Agrobacterium used was Agrobacterium GV3101.

5. The method for genetic transformation of watercress according to claim 1, characterized in that, In step (7), the rooting medium is MS medium, and the culture is carried out in a light incubator.

Images