Application of long-chain non-coding RNA NONHSAT017321 in diagnosis of colon cancer

Abstract

The application belongs to the technical field of disease diagnosis and molecular biology, and particularly relates to application of long-chain non-coding RNA NONHSAT017321 in colon cancer diagnosis. The application finds that the expression up-regulation of lncRNA NONHSAT017321 in peripheral blood serum exosome of a colon cancer patient is consistent with the verification result of colon cancer tissue, and the sensitivity of the test result is high, and the specificity is good, so the lncRNA NONHSAT017321 can be used as a diagnostic marker of colon cancer, and can be used not only for early diagnosis of colon cancer but also for large-scale screening of colon cancer patients and prediction of the risk of the disease, thereby providing strong technical support for early diagnosis and prediction of colon cancer, and having far-reaching clinical significance and popularization.

Description

Technical Field

[0001] This invention belongs to the field of disease diagnosis and molecular biology technology, specifically relating to the application of long non-coding RNA NONHSAT017321 in the diagnosis of colon cancer. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Colorectal cancer is one of the most common digestive system tumors, and its incidence and mortality rates have been rising in recent years, making it a significant public health issue. Currently, surgery, chemotherapy, and radiotherapy are the main treatments for colorectal cancer. Although surgery-based comprehensive treatment has significantly improved the prognosis of colorectal cancer patients, most patients are diagnosed at an advanced stage with distant metastases due to the lack of obvious clinical symptoms in the early stages, thus losing the opportunity for radical surgery. Most colorectal cancer patients have a poor prognosis, high mortality rate, and low 5-year survival rate. Therefore, exploring novel diagnostic biomarkers is of significant clinical value in improving the prognosis of colorectal cancer patients.

[0004] Exosomes are vesicles with a diameter of 30-150 nm, containing components such as RNA, lipids, and proteins. They are present in various bodily fluids, including blood, saliva, urine, cerebrospinal fluid, and breast milk, and can shuttle back and forth in these fluids, transporting genetic material and proteins between cells. Tumors continuously release exosomes into their surrounding environment during growth. Exosomes can be stored at 4°C for 96 hours or even longer at -70°C. Furthermore, isolating exosomes from serum for colorectal cancer diagnosis overcomes the influence of non-detectable substances in blood when directly extracting molecules from blood, resulting in more accurate and reliable test results. These characteristics make exosomes helpful for early tumor diagnosis and prognosis. Studies have reported the discovery of two biomarkers, PCA-3 and TMPRSS2, in exosomes derived from the urine of bladder cancer patients; a significant increase in the expression level of the tumor-associated marker CAV1 in plasma exosomes of melanoma patients, which can be used to diagnose melanoma; and the discovery that miRNAs in exosomes can serve as biomarkers for lung cancer in lung cancer models. However, to date, there are few reports on exosome markers for the diagnosis of colorectal cancer. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the inventors, through long-term technical and practical exploration, have developed an application of the long non-coding RNA NONHSAT017321 in the diagnosis of colorectal cancer. This invention has found that peripheral blood serum exosome-derived lncRNA NONHSAT017321 can be used for the diagnosis of colorectal cancer patients. Upregulation of serum-derived lncRNA NONHSAT017321 expression is consistent with the results of colorectal cancer tissue analysis, and the test results show high sensitivity and specificity. Based on these research findings, this invention was completed.

[0006] To achieve the above technical objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the invention provides the use of a substance for detecting lncRNA NONHSAT017321 in the preparation of products for the diagnosis, screening, detection or monitoring of colorectal cancer.

[0008] The nucleotide sequence of the lncRNA NONHSAT017321 is shown below:

[0009] GTTTTTTCAAATATTTAACATCCTTGCTTGGTTGAATCCACGGATGCGGAACCCATAGATCCTGAGGGCCGACTCTACCCCCTTCTGAGAACATCCCCAGATGGCTGGGCTGGGTGGAGTCTGGATAGTTAGACCCCAGCA CCTGTGAGTCACGCAGACCCAGAAGCAGGAAGCAGACAGTAAGTGACAGCCGCTAAGACGCAGGGAGGCTGGGCCAGGGCTGGGGCACGAGGGTACCTTCACCTGGGCGTCAGAAGCACTTGAGAGGACAGGGGCTGCTG(SEQ IDNO.1).

[0010] The lncRNA NONHSAT017321 is preferably derived from the serum exosomes of the subject.

[0011] A second aspect of the present invention provides a product for diagnosing, screening, detecting or monitoring colorectal cancer, comprising at least a substance for detecting the expression level of lncRNA NONHSAT017321 based on RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0012] A third aspect of the present invention provides a detection reagent comprising a substance for detecting lncRNANONHSAT017321;

[0013] In a fourth aspect, the present invention provides a detection kit comprising the detection reagents described above.

[0014] A fifth aspect of the present invention provides a system for diagnosing, screening, detecting, or monitoring colon cancer, said system comprising at least:

[0015] i) An analysis unit, the analysis unit comprising: a detection substance selected from the above-mentioned lncRNA NONHSAT017321 for determining the expression level of the subject's test sample;

[0016] ii) An assessment unit comprising: determining the subject's condition based on the lncRNA expression level determined in i).

[0017] A sixth aspect of the present invention provides the use of the above-mentioned lncRNANONHSAT017321 as a target in the preparation or screening of colorectal cancer drugs.

[0018] Compared with existing technical solutions, one or more of the above technical solutions have the following beneficial effects:

[0019] The above-mentioned technical method, through quantitative real-time PCR analysis, revealed differential expression of lncRNA NONHSAT017321 in colorectal cancer tissue and adjacent normal tissue, with upregulated expression in colorectal cancer tissue. Secondly, quantitative real-time PCR analysis further confirmed differential expression of lncRNA NONHSAT017321 between colorectal cancer tissue and normal human colon tissue, with upregulated expression in colorectal cancer tissue. Further detection of lncRNA NONHSAT017321 by isolating exosomes from peripheral blood serum showed a significant difference in expression compared to normal individuals, consistent with the tissue detection results.

[0020] The above-mentioned technical solution can detect the expression level of lncRNANONHSAT017321 in various populations, thereby predicting the risk of colorectal cancer, screening high-risk groups, and making early, rapid, and non-invasive diagnoses of colorectal cancer patients.

[0021] The above-mentioned technical solution exhibits high specificity (up to 96%) and sensitivity (up to 92%) for the early diagnosis of colorectal cancer. It only requires RNA extraction from exosomes to detect the expression level of lncRNA NONHSAT017321, is simple to operate, and has good stability. It can be used not only for the early diagnosis of colorectal cancer but also for large-scale screening of colorectal cancer patients and prediction of disease risk, providing strong technical support for the early diagnosis and prediction of colorectal cancer, and has profound clinical significance and wide applicability. Attached Figure Description

[0022] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0023] Figure 1 This invention provides an example of real-time quantitative PCR analysis of the expression differences of lncRNA NONHSAT017321 in colon cancer tissue and adjacent normal tissue.

[0024] Figure 2 This invention provides an example of real-time quantitative PCR analysis to differentiate the expression of lncRNA NONHSAT017321 in colon cancer tissue and normal colon tissue.

[0025] Figure 3 This invention provides an example of real-time quantitative PCR analysis to differentiate the expression of exosome-derived lncRNA NONHSAT017321 between colorectal cancer patients and healthy individuals.

[0026] Figure 4 This study demonstrates the specificity and sensitivity of exosome-derived lncRNA NONHSAT017321 for the early diagnosis of colorectal cancer using ROC analysis in Example 4 of this invention. Detailed Implementation

[0027] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0028] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods in the following specific embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or according to the conditions recommended by the manufacturer.

[0029] The present invention will be further illustrated with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Unless otherwise specified, experimental conditions not explicitly stated in the examples are generally performed under conventional conditions or as recommended by the selling company. Materials and reagents used in the examples, unless otherwise specified, are commercially available.

[0030] Several lncRNA sequences are known in this art, and it should be understood that the database access numbers for the individual lncRNAs shown below are for human-derived lncRNAs. However, these database entries also provide database access numbers for lncRNAs from, for example, the following different sources: lncRNAs from any mammalian, reptile, or bird source.

[0031] The term "expression level" refers to the amount of a gene product present in an organism or sample at a specific time point. Expression levels can be measured / quantified / detected, for example, by the amount of protein or mRNA expressed by the gene. Expression levels can be quantified, for example, by normalizing the amount of the target gene product present in the sample to the total amount (total protein or mRNA) of the same type of gene product in the same sample or reference sample (e.g., a sample obtained from the same organism at the same time or a portion of the same size (weight, volume) of the same sample), or by determining the amount / defined sample size (weight, volume, etc.) of the target gene product. Expression levels can be measured or detected by any method known in the art, such as methods for the direct detection and quantification of the target gene product (e.g., mass spectrometry), or methods for the indirect detection and measurement of the target gene product that typically work by binding the target gene product to one or more different molecules or detection devices (e.g., primers, probes, antibodies, proteins) specific to the target gene product. It is also known to those skilled in the art to determine the level of gene copying, which also includes determining the absence or presence of one or more fragments (e.g., by nucleic acid probes or primers, such as quantitative PCR, multiplex ligation-dependent probe amplification PCR, etc.).

[0032] The terms "upgraded," "elevated," or "improved" in a terminology refer to a decrease in the level of such an indicator in the sample compared to a reference.

[0033] The terms "downgrade," "reduction," or "decline" in an indicator mean that the level of such an indicator in the sample has decreased compared to a reference.

[0034] In principle, reference values ​​for the target group or cohort specified in this invention can be calculated based on the mean or median of a given lncRNA using standard statistical methods. In particular, the precision of tests, for example, those intended or not intended to determine an event, is preferably described by their receiver-operating characteristic (ROC) (see especially Zweig 1993, Clin. Chem. 39: 561-577). An ROC plot is a graph of all sensitivities versus specificities obtained by continuously varying the decision threshold across the entire observed data range. The clinical performance of a diagnostic method depends on its precision, i.e., its ability to correctly assign subjects to a certain prognosis or diagnosis. An ROC plot represents the overlap between two distributions by plotting sensitivity versus 1-specificity across the full range of thresholds suitable for differentiation. On the y-axis is the sensitivity, or true positive score, defined as the ratio of the number of true positive test results to the sum of the number of true positive and false negative test results. This is also referred to as positive in the presence of a disease or symptom. It is calculated separately for the affected subgroup. On the x-axis is the false positive score, or 1-specificity, which is defined as the ratio of the number of false positive results to the sum of the number of true negatives and false positives. It is an index of specificity and is calculated entirely from the unaffected subgroups. Because the true and false positive scores are calculated completely separately, the ROC plot is independent of the prevalence of events in the group by using test results from two different subgroups. Each point on the ROC plot represents a sensitivity / -specificity pair corresponding to a specific decision threshold. A test with perfect discrimination (no overlap in the two outcome distributions) has an ROC plot passing through the top left corner, where the true positive score is 1.0 or 100% and the false positive score is 0 (perfect specificity). The theoretical plot for a test with no discrimination (identical distributions of results in both groups) is a 45° diagonal line from the bottom left to the top right corner. Most plots fall between these two extremes. If the ROC plot falls exactly below the 45° diagonal line, this is easily corrected by reversing the "positive" criterion from "greater than" to "less than," and vice versa. Qualitatively, the closer the graph is to the top left corner, the higher the overall accuracy of the test. Based on the desired confidence interval, a threshold can be derived from the ROC curve, allowing for the diagnosis or prediction of a given event with an appropriate balance of sensitivity and specificity, respectively. Therefore, a reference for the method of the present invention can preferably be generated by establishing an ROC for the group as described above and deriving a threshold amount from it. The ROC plot allows for the derivation of an appropriate threshold based on the desired sensitivity and specificity of the diagnostic method. Preferably, the reference amount lies within a range of values ​​representing at least 75% sensitivity and at least 45% specificity, or at least 80% sensitivity and at least 40% specificity, or at least 85% sensitivity and at least 33% specificity, or at least 90% sensitivity and at least 25% specificity.

[0035] As used herein, the term "kit" refers to a collection of the aforementioned components, preferably provided individually or in a single container. The container also preferably contains instructions for carrying out the methods of the invention. Examples of these components and their methods of use have been given in this specification. Preferably, the kit contains the aforementioned components in a ready-to-use formulation. Preferably, the kit may additionally include instructions, such as a user manual for adjusting the components and for interpreting the results of any assays relating to a diagnosis provided by the methods of the invention. In particular, such a manual may include information for allocating the amount of the gene product to the diagnostic type. Details are provided elsewhere in this specification. Furthermore, such a user manual may provide instructions on the correct use of the kit components to determine the amount of the corresponding biomarker. The user manual may be provided in print or electronic form. The invention also relates to the use of the kit in any method according to the invention.

[0036] In a typical embodiment of the present invention, the use of a substance for detecting lncRNA NONHSAT017321 in the preparation of products for (aiding) diagnosis, screening, detection, or monitoring of colorectal cancer is provided. The present invention has found through research that upregulation of lncRNA NONHSAT017321 derived from peripheral blood serum exosomes is consistent with the results of colorectal cancer tissue validation, and the test results have high sensitivity and specificity, making it suitable for the diagnosis of colorectal cancer patients. Furthermore, it is minimally invasive for subjects, resulting in better compliance, and is highly suitable for screening and early diagnosis of high-risk groups for colorectal cancer.

[0037] The nucleotide sequence of lncRNANONHSAT017321 is shown below:

[0038] GTTTTTTCAAATATTTAACATCCTTGCTTGGTTGAATCCACGGATGCGGAACCCATAGATCCTGAGGGCCGACTCTACCCCCTTCTGAGAACATCCCCAGATGGCTGGGCTGGGTGGAGTCTGGATAGTTAGACCCCAGCA CCTGTGAGTCACGCAGACCCAGAAGCAGGAAGCAGACAGTAAGTGACAGCCGCTAAGACGCAGGGAGGCTGGGCCAGGGCTGGGGCACGAGGGTACCTTCACCTGGGCGTCAGAAGCACTTGAGAGGACAGGGGCTGCTG(SEQ IDNO.1).

[0039] In some embodiments, the lncRNA NONHSAT017321 is preferably derived from serum exosomes of the subject. This invention has demonstrated through experiments that whole blood contains very low levels of RNA. Directly processing anticoagulated whole blood, i.e., directly adding lysis buffer such as Trizol, limits the volume of blood processed; typically, 1 mL of Trizol can only process 100-200 μl of blood, resulting in very little extracted RNA and wasting reagents, which is highly unfavorable for practical detection. In contrast, serum contains a high concentration of exosomes; only 500 μL of serum is needed to isolate sufficient exosomes for detecting the expression level of lncRNA NONHSAT017321. Furthermore, the lncRNA NONHSAT017321 in serum exosomes is consistent with the lncRNA NONHSAT017321 in colon tissue (cells), indicating that this method has excellent operability.

[0040] In another specific embodiment of the present invention, a product for (aided) diagnosis, screening, detection or monitoring of colorectal cancer is provided, which at least includes a substance for detecting the expression level of lncRNA NONHSAT017321 based on RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0041] In some embodiments, the product includes, but is not limited to, primers, probes, chips, nucleic acid membrane strips, formulations, or kits for detecting the expression level of lncRNA NONHSAT017321 in a sample to be tested.

[0042] The primers have nucleotide sequences as shown in SEQ ID NO.2-3.

[0043] In another specific embodiment of the present invention, a detection reagent is provided, the detection reagent comprising a substance for detecting lncRNA NONHSAT017321;

[0044] In some embodiments, the substance comprises primers having nucleotide sequences as shown in SEQ ID NO.2-3.

[0045] In another specific embodiment of the present invention, a detection kit is provided, the kit comprising the above-mentioned detection reagents. The detection kit may be a real-time fluorescence quantitative PCR detection kit, which may also include real-time fluorescence quantitative SYBR dye, internal control (such as GAPDH) primers, RNA extraction reagents, reverse transcription reagents, buffers, etc., which are easily implemented by those skilled in the art and are not specifically limited here.

[0046] In another specific embodiment of the present invention, a system for (aided) diagnosis, screening, detection, or monitoring of colorectal cancer is provided, the system comprising at least:

[0047] i) An analysis unit, the analysis unit comprising: a detection substance selected from the above-mentioned lncRNA NONHSAT017321 for determining the expression level of the subject's test sample;

[0048] ii) An assessment unit comprising: assessing the subject’s condition based on the expression level of the lncRNA NONHSAT017321 determined in i).

[0049] In another specific embodiment of the present invention, the evaluation process of the evaluation unit includes:

[0050] If the expression level of lncRNA NONHSAT017321 in the test sample of the subject is upregulated compared with the reference, then the subject is or is a candidate for colorectal cancer; otherwise, the subject is not or is not a candidate for colorectal cancer.

[0051] Here, "reference" can be a suitable control sample, such as a sample from a normal healthy subject who has no symptoms of colorectal cancer and no abnormal physiological or pathological findings. A reference can also be a sample from the same subject before they exhibited symptoms of the disease or were diagnosed with colorectal cancer. A reference can be a standardized sample, such as a sample containing materials or data from several healthy subjects who do not have symptoms of colorectal cancer and no related physiological or pathological findings.

[0052] In some embodiments, the test sample may specifically be serum exosomes from the peripheral blood of the subject. This invention demonstrates that lncRNA NONHSAT017321 is significantly highly expressed in both colon cancer tissue and serum exosomes of colon cancer patients. The area under the ROC curve (AUC) of lncRNA NONHSAT017321 expression level in serum exosomes for early diagnosis of colon cancer reaches 0.9832, with a specificity of 96% and a sensitivity of 92%. Therefore, lncRNA NONHSAT017321 derived from serum exosomes can be effectively used for the early diagnosis of colon cancer.

[0053] In another specific embodiment of the present invention, the above-mentioned lncRNANONHSAT017321 is provided as a target in the preparation or screening of colorectal cancer drugs.

[0054] In some implementations, the effects of candidate drugs on lncRNA NONHSAT017321 before and after use can be used to determine whether a candidate drug can be used to prevent or treat colon cancer.

[0055] The present invention will be further illustrated below with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Experimental conditions not specifically specified in the examples are generally performed under conventional conditions or as recommended by the sales company; unless otherwise specified in the present invention, these conditions are commercially available.

[0056] Example 1: Preparation of a kit (50 reactions) for screening, early diagnosis, or prognosis of colon cancer patients using long non-coding RNA NONHSAT017321 in high-risk populations.

[0057] 1. 50 mL Trizol reagent

[0058] 2. 22 mL of chloroform

[0059] 3. Isopropanol 55mL

[0060] 4. 50 mL of anhydrous ethanol

[0061] 5. RNase-Free ddH2O 5mL

[0062] 6.5×gDNAClean Reaction Mix 220μL

[0063] 7.10× reverse transcription buffer 2ml

[0064] 8.10mM FQ-RT Primer mix 200ul

[0065] 9.200U / μl Enzyme mix 50ul

[0066] 10.2×Premix 500μL

[0067] 11.10 μM lncRNA NONHSAT017321 Real-time Quantitative PCR Specific Primer 110 μL NONHSAT017321 Primer F 5'-CCACCTGTGCAGACTTGAGA-3' (SEQ ID NO.2)

[0068] NONHSAT017321Primer R 5'-TGGTCAAATCGTGGGGTGAG-3'(SEQ ID NO.3)

[0069] 10.10 μM GAPDH real-time quantitative PCR specific primers 110 μL

[0070] GAPDH Primer F 5′-TGGTCACCAGGGCTGCTT-3′(SEQ ID NO.4)

[0071] GAPDH Primer R 5′-AGCTTCCCGTTCTCAGCCTT-3′ (SEQ ID NO.5) Example 2: Validation of the differential expression of LncRNA NONHSAT017321 in colon cancer tissue and adjacent normal tissue.

[0072] 1. Collect the colon cancer tissue and adjacent tissue to be tested, place them in cryovials, and store them in liquid nitrogen.

[0073] 2. RNA extraction from tissue: Place 150 mg of sample into a 1.5 mL EP tube, add 1.2 mL of Trizol, grind and sonicate, then add 240 μL of chloroform. Vigorously vortex by hand and centrifuge at 12000 g for 20 min at 4°C. Carefully aspirate the supernatant into a 1.5 mL RNase-free EP tube, add an equal volume of isopropanol and gently mix. Incubate at room temperature for 15 min, then centrifuge at 12000 g for 15 min at 4°C. Discard the supernatant, resuspend and wash with 750 μL of 75% ethanol (diluted with DEPC water), centrifuge at 7500 g for 8 min at 4°C, discard the supernatant, and repeat once. Open the EP tube and air dry at room temperature. Add 40-60 μL of DEPC water to dissolve the RNA. Measure the RNA concentration and quality using Nanodrop. RNA quality is good when the OD260 / 280 ratio is between 1.8 and 2.0. Store at -80°C.

[0074] 3. LncRNA NONHSAT017321 reverse transcription: TIANGEN reverse transcription premix kit was used.

[0075] Step 1: Remove genomic DNA

[0076]

[0077] Reaction conditions: 42℃, 6 min;

[0078] Step 2: Reverse transcription reaction

[0079]

[0080]

[0081] Reaction conditions: 42℃, 1h;

[0082] 4. Real-time quantitative PCR was performed using the NONHSAT017321 specific primers synthesized by Genewiz Biotechnology Co., Ltd. The 10 μL reaction system is as follows:

[0083]

[0084] Real-time quantitative PCR reaction program: 95℃ for 5 min;

[0085]

[0086] 5, -2 ΔΔCT Measurement of indicators: The data in this experiment were analyzed using a relative quantitative method, with GAPDH as an internal reference gene. The data were analyzed using SPSS software. The analysis revealed that compared with the expression of lncRNA NONHSAT017321 in adjacent normal tissues, the expression of lncRNA NONHSAT017321 in 50 patients with colorectal cancer was significantly upregulated, and the difference was statistically significant (P<0.001).

[0087] Example 3: Validation of the differential expression of LncRNA NONHSAT017321 in colon cancer tissue and normal colon tissue.

[0088] 1. Collect the colon cancer tissue to be tested and normal colon tissue and place them in cryovials for storage in liquid nitrogen.

[0089] 2. RNA extraction from tissue: Place 150 mg of sample into a 1.5 mL EP tube, add 1.2 mL of Trizol, grind and sonicate, then add 240 μL of chloroform. Vigorously vortex by hand and centrifuge at 12000 g for 20 min at 4°C. Carefully aspirate the supernatant into a 1.5 mL RNase-free EP tube, add an equal volume of isopropanol and gently mix. Incubate at room temperature for 15 min, then centrifuge at 12000 g for 15 min at 4°C. Discard the supernatant, resuspend and wash with 750 μL of 75% ethanol (diluted with DEPC water), centrifuge at 7500 g for 8 min at 4°C, discard the supernatant, and repeat once. Open the EP tube and air dry at room temperature. Add 40-60 μL of DEPC water to dissolve the RNA. Measure the RNA concentration and quality using Nanodrop. RNA quality is good when the OD260 / 280 ratio is between 1.8 and 2.0. Store at -80°C.

[0090] 3. LncRNANONHSAT017321 reverse transcription: TIANGEN reverse transcription premix kit was used.

[0091] Step 1: Remove genomic DNA

[0092]

[0093] Reaction conditions: 42℃, 6 min;

[0094] Step 2: Reverse transcription reaction

[0095]

[0096]

[0097] Reaction conditions: 42℃, 1h;

[0098] 4. Real-time quantitative PCR was performed using the NONHSAT017321 specific primers synthesized by Genewiz Biotechnology Co., Ltd. The 10 μL reaction system is as follows:

[0099]

[0100] Real-time quantitative PCR reaction program: 95℃ for 5 min;

[0101]

[0102] 5, -2 ΔΔCT Measurement of indicators: The data in this experiment were analyzed using a relatively quantitative method, with GAPDH as an internal reference gene. The data were analyzed using SPSS. The analysis revealed that, compared with normal colon tissue, the expression of lncRNA NONHSAT017321 was significantly upregulated in 50 patients with colon cancer, and the difference was statistically significant (P<0.001).

[0103] Example 4: Detection of the specificity and sensitivity of serum exosome-derived lncRNA NONHSAT017321 for colorectal cancer diagnosis.

[0104] 1. Isolation of exosomes from serum

[0105] 1.1 Separation of peripheral blood serum: 2 mL of blood was collected from the individual being tested using a blood coagulation tube. After collection, the blood was centrifuged at 3500 rpm for 10 min, and the serum was transferred to a 1.5 mL EP tube and stored at -80℃.

[0106] 1.2 Isolation of exosomes from serum: Add 100 μL of Total Exosome Isolation Reagent to 500 μL of serum sample, vortex to mix, and incubate at 4°C for 30 min. Centrifuge at 10000g for 10 min at room temperature. Exosomes are present at the bottom of the EP tube; resuspend the exosomes in 200 μL of PBS. (A commercially available exosome isolation kit was selected.)

[0107] 2. Extraction and purification of RNA from exosomes (using commercially available exosome RNA isolation and purification kits)

[0108] 2.1 RNA extraction from exosomes: Add 200 μL of 2×Denaturing Solution and mix well. Incubate on ice for 5 min, then add 400 μL of acid-Phenol:Chloroform and vortex for 60 s. Centrifuge at 12000g for 10 min at room temperature. The supernatant contains RNA.

[0109] 2.2 RNA Purification: Pipette 300 μL of supernatant into an enzyme-free EP tube, add 375 μL of anhydrous ethanol, and mix well. Add the mixture to a filter column, centrifuge at 10000g for 15 seconds, and discard the mixture in the collection tube. Add 700 μL of miRNA Wash Solution 1, centrifuge at 10000g for 15 seconds at room temperature, and discard the mixture in the collection tube. Add 500 μL of Wash Solution 2 / 3, centrifuge at 10000g for 15 seconds at room temperature, and repeat this step. Place the filter column in the collection tube and centrifuge at 10000g for 1 min. Place the filter column in a new collection tube, add 35 μL of Elixith Solution, and centrifuge at 10000g for 30 seconds at room temperature to obtain purified RNA.

[0110] 3. lncRNA NONHSAT017321 was detected using the reverse transcription and real-time quantification method described in step 3 of Example 2.

[0111] 4, -2 ΔΔCT Measurement of Indicators: The data in this experiment were analyzed using a relatively quantitative method, with GAPDH as an internal reference gene. SPSS was used for data analysis. Analysis revealed a significant difference in the expression of lncRNA NONHSAT017321 in the serum exosomes of 50 patients compared to normal individuals (P<0.001). In colorectal cancer patients, its expression was upregulated. This result is consistent with the detection results in tissues from Examples 2 and 3, indicating that detecting the expression level of lncRNA NONHSAT017321 derived from serum exosomes can determine whether a patient has colorectal cancer. Furthermore, the area under the ROC curve (AUC) for the early diagnosis of colorectal cancer using the expression level of lncRNA NONHSAT017321 in serum exosomes reached 0.9832, with a specificity of 96% and a sensitivity of 92%. Therefore, lncRNA NONHSAT017321 derived from serum exosomes can be effectively used for the early diagnosis of colorectal cancer.

[0112] The detection method of this invention only requires 500 μL of serum to separate enough exosomes for detecting the expression level of lncRNA NONHSAT017321, indicating that the method has good operability.

[0113] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. Application of the substance that detects lncRNA NONHSAT017321 in the preparation of products for the diagnosis, screening, detection or monitoring of colorectal cancer.

2. The application as described in claim 1, characterized in that, The lncRNA NONHSAT017321 was derived from the subject's serum exosomes.

Images