A tRF-1:28-glu-ctc-1-m2 and applications thereof
By discovering and verifying the significant upregulation of the tRF-1:28-Glu-CTC-1-M2 molecule, a specific detection and inhibition method was provided, solving the diagnostic and treatment challenges of nasopharyngeal carcinoma and achieving the effect of specific detection and treatment of nasopharyngeal carcinoma.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CENT SOUTH UNIV
- Filing Date
- 2023-02-28
- Publication Date
- 2026-06-12
AI Technical Summary
Current technologies lack effective diagnostic and treatment methods for nasopharyngeal carcinoma, especially since the function of the tRF-1:28-Glu-CTC-1-M2 molecule has not been fully utilized.
By discovering and validating the significant upregulation of tRF-1:28-Glu-CTC-1-M2 molecule expression in nasopharyngeal carcinoma, specific reverse transcription and PCR primers were provided for detection, and specific inhibitors were combined for treatment.
This has enabled specific diagnosis and treatment of nasopharyngeal carcinoma, providing new and reliable detection and treatment methods, which has profound clinical significance.
Smart Images

Figure CN116218853B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor molecular biology technology, specifically relating to a novel tRF molecule and its application in the preparation of tumor diagnostic and therapeutic agents. Background Technology
[0002] tsRNAs are a novel class of small non-coding RNAs produced by tRNA cleavage. Based on their origin and length, tsRNAs can be divided into two main categories: tiRNAs and tRFs. tiRNAs, also known as tRNA haves, are approximately 30-40 nt in length and include tiRNA-3 and tiRNA-5. They are produced by ANG cleavage of the anticodon loop of mature tRNA. tRFs originate from mature or precursor tRNAs and are 14-40 nt in length. Based on their origin, they can be further classified as tRF-1, tRF-2, tRF-3, and tRF-5. tRF-1 is produced by RNase Z / ELAC2 cleavage of the 3' tail sequence of pre-tRNA and is not included in the mature tRNA sequence. Its sequence conservation is poor, and its length is highly variable. tRF-3 is produced by cleavage of the 3' end of the TΨC loop of mature tRNA by enzymes such as Dicer and ANG. These typically include a CCA tail and can be further divided into tRF-3a (17-18 nt) and tRF-3b (19-22 nt) based on their length. tRF-5 cleaves in the D-loop or stem region of mature tRNA in a Dicer-dependent manner, producing fragments of varying lengths: tRF-5a (14-16 nt), tRF-5b (22-24 nt), or tRF-5c (28-32 nt). Initially thought to be a product of random tRNA degradation, advancements in deep sequencing technology and bioinformatics analysis, along with cross-species and large-sample studies, have provided strong evidence for the importance and functional diversity of tRF. Research has found that tRF is widely involved in gene silencing, ribosomeogenesis, translation efficiency, cell cycle, and epigenetic regulation, playing a crucial role in life processes. Simultaneously, tsRNA plays an important role in various human diseases, including cancer. Numerous studies have shown that tsRNA can regulate tumorigenesis and development at multiple levels and can serve as biomarkers for tumor diagnosis and prognosis, as well as therapeutic targets. Summary of the Invention
[0003] This invention identified a significantly upregulated tRF molecule in nasopharyngeal carcinoma RNA-seq sequencing data GSE159746. This molecule originates from tRNA: tRNA-Glu-CTC, named tRF-1:28-Glu-CTC-1-M2, MINTbase_ID: tRF-28-87R8WP9N1E0K, with the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCG and a molecular length of 28 nt.
[0004] The primary objective of this invention is to provide a novel tRF-1:28-Glu-CTC-1-M2 with the sequence: TCCCTGGTGGTCTAGTGGTTAGGATTCG. This provides a new tool for the diagnosis and treatment of nasopharyngeal carcinoma.
[0005] The second objective of this invention is to provide an application of a reagent for detecting tRF-1:28-Glu-CTC-1-M2 in the preparation of nasopharyngeal carcinoma diagnostic agents, wherein the tRF-1:28-Glu-CTC-1-M2 sequence is: TCCCTGGTGGTCTAGTGGTTAGGATTCG.
[0006] This invention, through experiments, revealed that real-time quantitative PCR detection of tRF-1:28-Glu-CTC-1-M2 expression in both normal nasopharyngeal epithelial tissue and nasopharyngeal carcinoma tissue showed upregulated expression of the molecule in nasopharyngeal carcinoma tissue. This provides a new and reliable detection method for the diagnosis of nasopharyngeal carcinoma.
[0007] Furthermore, the reagents for detecting tRF-1:28-Glu-CTC-1-M2 include reverse transcription primers and PCR primers.
[0008] The reverse transcription primers are:
[0009] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGAATC, PCR primers are:
[0010] Upstream primer: TCCCTGGTGGTCTAGTGGTT
[0011] Downstream primer: GTGCAGGGTCCGAGGT.
[0012] The reverse transcription primers and PCR primers of the present invention include, but are not limited to, the sequences described above.
[0013] A third objective of this invention is to provide a diagnostic agent for nasopharyngeal carcinoma, comprising a reagent for detecting tRF-1:28-Glu-CTC-1-M2, wherein the tRF-1:28-Glu-CTC-1-M2 sequence is: TCCCTGGTGGTCTAGTGGTTAGGATTCG.
[0014] The reagents for detecting tRF-1:28-Glu-CTC-1-M2 include reverse transcription primers and PCR primers.
[0015] The reverse transcription primers are:
[0016] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGAATC, PCR primers are:
[0017] Upstream primer: TCCCTGGTGGTCTAGTGGTT
[0018] Downstream primer: GTGCAGGGTCCGAGGT.
[0019] A fourth objective of this invention is to provide the application of a reagent that inhibits the expression of tRF-1:28-Glu-CTC-1-M2 in the preparation of a nasopharyngeal carcinoma therapeutic agent, wherein the tRF-1:28-Glu-CTC-1-M2 sequence is: TCCCTGGTGGTCTAGTGGTTAGGATTCG. This invention provides a new and reliable approach for the treatment of nasopharyngeal carcinoma.
[0020] The reagent for inhibiting tRF-1:28-Glu-CTC-1-M2 expression includes a tRF-1:28-Glu-CTC-1-M2 inhibitor with the sequence: AGGGACCACCAGATCACCAATCCTAAGC. The inhibitor is an oligonucleotide molecule based on the reverse complementarity of the tRF-1:31-Lys-CTT-2-M2 molecule.
[0021] A fifth object of the present invention is to provide a nasopharyngeal carcinoma therapeutic agent comprising a reagent for inhibiting the expression of tRF-1:28-Glu-CTC-1-M2, wherein the tRF-1:28-Glu-CTC-1-M2 sequence is:
[0022] TCCCTGGTGGTCTAGTGGTTAGGATTCG.
[0023] This invention provides a novel tRF-1:28-Glu-CTC-1-M2 molecule, offering new possibilities for the diagnosis and treatment of nasopharyngeal carcinoma. Studies have confirmed that tRF-1:28-Glu-CTC-1-M2 expression is upregulated in nasopharyngeal carcinoma, and inhibition of this tRF molecule has been found to have therapeutic potential for nasopharyngeal carcinoma. A real-time fluorescence quantitative detection reagent for tRF-1:28-Glu-CTC-1-M2 can be used as an adjunct to the diagnosis of nasopharyngeal carcinoma. Furthermore, the invention provides the application of tRF molecule inhibition in the treatment of nasopharyngeal carcinoma. This has profound clinical significance and important prospects for widespread application. Attached Figure Description
[0024] Figure 1 This is a schematic diagram of the molecular structure of tRF-1:28-Glu-CTC-1-M2 of the present invention;
[0025] Figure 2 This is a diagram showing the results of real-time quantitative PCR detection of the expression of the present invention in normal nasopharyngeal epithelial tissue and nasopharyngeal carcinoma tissue.
[0026] Figure 3 The expression results of mimics and inhibitors of the tRF-1:28-Glu-CTC-1-M2 molecule synthesized in this invention were detected after transfection into nasopharyngeal carcinoma cells 5-8F.
[0027] Figure 4 The present invention presents the results of the investigation of the effects of tRF-1:28-Glu-CTC-1-M2 molecules on the invasion and migration of nasopharyngeal carcinoma cells 5-8F using scratch healing assays and Transwell assays.
[0028] Figure 5 The results of this invention's CCK8 cell proliferation assay show the effect of inhibiting tRF-1:28-Glu-CTC-1-M2 molecules on the proliferation ability of nasopharyngeal carcinoma cells 5-8F. Detailed Implementation
[0029] The following examples are intended to further illustrate the present invention, but not to limit it.
[0030] Example 1
[0031] Analysis of nasopharyngeal carcinoma RNA-seq sequencing data GSE159746 revealed a significantly upregulated tRF molecule. This molecule originates from tRNA: tRNA-Glu-CTC, named tRF-1:28-Glu-CTC-1-M2, MINTbase_ID: tRF-28-87R8WP9N1E0K, with the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCG (see SEQ ID NO.1). The molecule is 28 nt in length. The structure is shown below. Figure 1 .
[0032] Example 2
[0033] Real-time quantitative PCR was used to detect the expression of tRF-1:28-Glu-CTC-1-M2 in 13 normal nasopharyngeal epithelial tissues and 32 nasopharyngeal carcinoma tissues. The results showed that tRF-1:28-Glu-CTC-1-M2 was significantly highly expressed in nasopharyngeal carcinoma tissues compared with normal nasopharyngeal tissues. (See attached results) Figure 2 .
[0034] Tissue RNA extraction:
[0035] (1) Add 1 mL of Trizol and lyse the tissue using a grinder;
[0036] (2) Add 0.2 mL of chloroform, vortex for 15 seconds, place on ice for 5 minutes, centrifuge at 12000 g and 4 °C for 15 minutes;
[0037] (3) Take the upper aqueous phase and place it in a new enzyme-free EP tube, add 0.5 mL of isopropanol, place on ice for 10 minutes, centrifuge at 12000 g and 4℃ for 10 minutes.
[0038] (4) Discard the supernatant, add 1 mL of 75% ethanol for washing, vortex mix, centrifuge at 7500g (2℃~8℃) for 5 minutes, discard the supernatant, and repeat once more;
[0039] (5) Allow the precipitated RNA to dry at room temperature for 6-10 minutes;
[0040] (6) Add 15-30 μl of DECP water to each sample tube, measure the concentration, and then perform subsequent reverse transcription experiments.
[0041] Reverse transcription was performed using the stem-loop method. The reverse transcription primers were: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC CGAATC See SEQ ID NO.2, where the preceding bases are stem-loop sequences and the underlined bases are the six bases on the tRF-1:28-Glu-CTC-1-M2 molecule that are anticomplementary to 3.
[0042] RNA was extracted using the Trizol method. The reverse transcription reaction system was prepared as follows: RNA: 1 μg, reverse transcription primer (5 μM) 1 μL, 5×RT Mix Buffer 2 μL, RT Enzyme Mix 2 μL, and enzyme-free water added to 10 μL.
[0043] The reverse transcription procedure is as follows:
[0044] temperature reaction time 42℃ 60 min 70℃ 10 min
[0045] After the reaction is complete, the product is removed and placed on ice for subsequent real-time quantitative PCR. Excess samples are stored at -20°C.
[0046] Real-time quantitative PCR (qRT-PCR)
[0047] The total reaction volume was prepared as follows: 2×SYBR Green MIX: 10 μL, upstream and downstream primers (10 mM): 1 μL each, cDNA template 2 μL, and enzyme-free water was added to bring the volume to 20 μL.
[0048] The reaction procedure is as follows:
[0049] Pre-denaturation at 95℃ for 10 min, followed by 2 s denaturation at 95℃, 20 s annealing at 60℃, and 10 s extension at 70℃, for a total of 40 cycles. Melting curve analysis was then performed: fluorescence signals were collected at temperatures ranging from 70℃ to 95℃. After the reaction, the amplification and melting curves of qRT-PCR were confirmed. The expression intensities of each gene were standardized according to CT values (threshold cycle values) and the internal reference gene (U6) using 2... -△△ct Calculate gene expression.
[0050] Real-time quantitative PCR was then performed, using the following primers:
[0051] Upstream primer: TCCCTGGTGGTCTAGTGGTT; see SEQ ID NO.3;
[0052] Downstream primer: GTGCAGGGTCCGAGGT, see SEQ ID NO.4.
[0053] The internal reference gene is U6.
[0054] The primer sequences are:
[0055] Upstream primer: 5'-CTCGCTTCGGCAGCACA-3', see SEQ ID NO.5;
[0056] Downstream primer: 5'-AACGCTTCACGAATTTGCGT-3', see SEQ ID NO.6;
[0057] Example 3
[0058] Subsequently, mimics of the tRF-1:28-Glu-CTC-1-M2 molecule and an inhibitor (based on reverse complementarity binding to tRF-1:31-Lys-CTT-2-M2 to inhibit its function) were synthesized and transfected into nasopharyngeal carcinoma cells 5-8F. Expression levels were then assessed. Figure 3 NC served as the blank control. The results indicate that we successfully overexpressed or knocked down tRF-1:28-Glu-CTC-1-M2 in nasopharyngeal carcinoma cells.
[0059] The mimics sequence is: sense:TCCCTGGTGGTCTAGTGGTTAGGATTCG, as shown in SEQ ID NO.7;
[0060] antisense:CGAATCCTAACCACTAGACCACCAGGGA, see SEQ ID NO.8;
[0061] The inhibitor sequence is: AGGGACCACCAGATCACCAATCCTAAGC, as shown in SEQ ID NO.9.
[0062] Cell transfection:
[0063] 1. Seed cells in good growth condition with about 80% confluence into well plates and incubate at 37°C in a 5% CO2 incubator for 12-20 hours. Transfection can begin when the cells grow to 40%-50% confluence.
[0064] 2. Add 5 μL of [a specific ingredient] to a sterile EP tube. Mix the reagent with 50 nM mimics in 200 μL DMEM medium and let stand for 20 min.
[0065] While the liposome transfection reagent is standing, wash the cells twice with D-Hank's solution, add 1.80 mL of complete culture medium (without antibiotics), add the above liposome mixture to the well plate, shake well, and incubate at 37°C and 5% CO2 for 36-72 h.
[0066] RNA extraction:
[0067] (1) Add 1 mL of Trizol to lyse the cells;
[0068] (2) Add 0.2 mL of chloroform, vortex for 15 seconds, place on ice for 5 minutes, centrifuge at 12000 g and 4 °C for 15 minutes;
[0069] (3) Take the upper aqueous phase and place it in a new enzyme-free EP tube, add 0.5 mL of isopropanol, place on ice for 10 minutes, centrifuge at 12000 g and 4℃ for 10 minutes.
[0070] (4) Discard the supernatant, add 1 mL of 75% ethanol for washing, vortex mix, centrifuge at 7500g (2℃~8℃) for 5 minutes, discard the supernatant, and repeat once more;
[0071] (5) Allow the precipitated RNA to dry at room temperature for 6-10 minutes;
[0072] (6) Add 15-30 μl of DECP water to each sample tube, measure the concentration, and then perform subsequent reverse transcription experiments.
[0073] Reverse transcription reaction:
[0074] Prepare the reverse transcription reaction system: RNA: 1ug, reverse transcription primer (5μM) 1μL, 5×RT Mix Buffer 2uL, RTEnzyme Mix 2μL, and enzyme-free water to 10uL.
[0075] The reverse transcription procedure is as follows:
[0076] temperature reaction time 42℃ 60min 70℃ 10min
[0077] After the reaction is complete, the product is removed and placed on ice for subsequent real-time quantitative PCR. Excess samples are stored at -20°C.
[0078] Real-time quantitative PCR (qRT-PCR)
[0079] The total reaction volume was prepared as follows: 2×SYBR Green MIX: 10 μL, upstream and downstream primers (10 mM): 1 μL each, cDNA template 2 μL, and enzyme-free water was added to bring the volume to 20 μL.
[0080] The reaction procedure is as follows:
[0081] Pre-denaturation at 95℃ for 10 min, followed by 2 s denaturation at 95℃, 20 s annealing at 60℃, and 10 s extension at 70℃, for a total of 40 cycles. Melting curve analysis was then performed: fluorescence signals were collected at temperatures ranging from 70℃ to 95℃. After the reaction, the amplification and melting curves of qRT-PCR were confirmed. The expression intensities of each gene were standardized according to CT values (threshold cycle values) and the internal reference gene (U6) using 2... -△△ct Calculate gene expression.
[0082] Example 4
[0083] The effects of scratch healing assay and Transwell assay on the invasion and migration of nasopharyngeal carcinoma cells 5-8F were examined. Results are shown below. Figure 4 The results indicate that overexpression of tRF-1:28-Glu-CTC-1-M2 promotes the invasion and migration of nasopharyngeal carcinoma cells, while knockdown of tRF-1:28-Glu-CTC-1-M2 inhibits the invasion and migration of nasopharyngeal carcinoma cells. NC is the blank control.
[0084] Scratch healing experiment:
[0085] 1. Pre-culture cells with a healing rate close to 100% in a medium containing 2% FBS for 12 hours;
[0086] 2. Use a 10μL pipette tip to make a cross in each well of a 6-well plate, and wash the cells 5 times with D-Hank's solution until there are almost no suspended cells under the microscope;
[0087] 3. Remove D-Hank's and add 2 mL of culture medium containing 2% serum to each well;
[0088] 4. Observe the healing of the scratches under an inverted microscope at the same time every day, take photos, and keep records;
[0089] 5. Use Image-Pro Plus image analysis software to analyze the scratch distance and obtain the average width of the scratch.
[0090] Transwell experiments:
[0091] 1. Take out the substrate gel stored at -20℃ and thaw it on ice;
[0092] 2. Mix the matrix gel and serum-free culture medium at a ratio of 1:8. Add 20 μL of the mixture to the bottom of the Transwell chamber in a 24-well plate and incubate at 37°C in a cell culture incubator containing 5% CO2 for 2-3 hours, until the matrix gel at the bottom turns white.
[0093] 3. After appropriate cell treatment, digest the cells with trypsin, centrifuge, resuspend the cells in serum-free culture medium, count the cells, and dilute the cell suspension to a cell density of 1×10⁻⁶. 5 cells / mL;
[0094] 4. Add 500 μL of complete culture medium containing 20% FBS to the wells of a 24-well plate, and place the incubated chambers into the wells containing the culture medium.
[0095] 5. Add 200 μL of cell suspension to the Transwell chamber and place the cell plate in a cell culture incubator at 37°C with 5% CO2 for 36-72 h.
[0096] 6. Remove the 24-well plate, discard the culture medium in the chamber, gently wash the chamber with PBS, and fix the chamber with 1% neutral formaldehyde for 15 min;
[0097] 7. Gently wash the chamber with PBS, and stain the chamber with 0.1% crystal violet solution for 15 min;
[0098] 8. Rinse off the crystal violet with pure water, gently wipe away the matrix gel and cells in the upper chamber with a cotton swab, and invert the chamber onto absorbent paper to dry at room temperature for 30 minutes.
[0099] 9. Observe the cell invasion under a microscope and take pictures. Use IPP software to count the number of cells in the pictures.
[0100] Example 5
[0101] The CCK8 cell proliferation assay was used to detect the effect of overexpression or knockdown of tRF-1:28-Glu-CTC-1-M2 on the proliferation of nasopharyngeal carcinoma cells 5-8F. Results are shown in […]. Figure 5 The results of the CCK8 cell proliferation assay showed that overexpression of tRF-1:28-Glu-CTC-1-M2 promoted cell proliferation, while knockdown of tRF-1:28-Glu-CTC-1-M2 inhibited cell proliferation. NC was the blank control.
[0102] CCK8 cell proliferation experiment:
[0103] 1. Inoculate 1×10⁶ cells per well of a 96-well plate. 3 100 cells per well, 200 μL of cell suspension per well, 6 replicates per group. The cells were evenly seeded in the 96-well plate to prevent cell aggregation and growth from affecting the subsequent absorbance measurement. The 96-well plate with the cells was placed in a cell culture incubator at 37°C with 5% CO2.
[0104] 2. Six hours after plating, once the cells have fully adhered, day 0 measurements can be performed. Remove the 96-well plate from the cell culture incubator and add 20 μL of CCK-8 working solution;
[0105] 3. Place the 96-well plate containing CCK-8 working solution in a cell culture incubator and incubate for 2 hours. Then, use a microplate reader to detect the absorbance of each well at a wavelength of 450 nm.
[0106] 4. CCK-8 was added at the same time points on days 1, 2, 3, 4, and 5 after cultivation, and measurements were taken.
[0107] 5. Collect the absorbance values daily and plot the growth curve according to the OD values.
Claims
1. The application of a reagent for detecting tRF-1:28-Glu-CTC-1-M2 in the preparation of nasopharyngeal carcinoma diagnostic agents, wherein the tRF-1:28-Glu-CTC-1-M2 sequence is: TCCCTGGTGGTCTAGTGGTTAGGATTCG.
2. The application according to claim 1, characterized in that, The reagents for detecting tRF-1:28-Glu-CTC-1-M2 include reverse transcription primers and PCR primers.
3. The application according to claim 2, characterized in that, The reverse transcription primers are: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGAATC, The PCR primers are: Upstream primer: TCCCTGGTGGTCTAGTGGTT Downstream primer: GTGCAGGGTCCGAGGT.
4. The application of a reagent that inhibits tRF-1:28-Glu-CTC-1-M2 in the preparation of a nasopharyngeal carcinoma therapeutic agent, wherein the tRF-1:28-Glu-CTC-1-M2 sequence is: TCCCTGGTGGTCTAGTGGTTAGGATTCG; The reagents for inhibiting tRF-1:28-Glu-CTC-1-M2 include: tRF-1:28-Glu-CTC-1-M2 inhibitor, sequence: AGGGACCACCAGATCACCAATCCTAAGC.