Applications of SDC2 gene single-specific-site methylation detection, colorectal cancer diagnostic reagents and systems
By detecting methylation at a single specific site in the SDC2 gene, the problem of insufficient sensitivity and specificity in the detection of colorectal cancer in existing technologies has been solved, realizing efficient and low-cost colorectal cancer diagnosis and providing a detection method with high sensitivity and high specificity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-10
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies for detecting colorectal cancer suffer from cumbersome procedures and low sensitivity and specificity, especially for the detection of SDC2 gene methylation, where the sensitivity is only 81.1% and the specificity is 93.3%.
Using single-site methylation of the SDC2 gene as a biomarker, specific primer pairs and probes are used to detect the methylation levels of chr8:96494187, chr8:96493501, chr8:96493590, or chr8:96494113. Combined with detection and comparison modules, diagnostic reagents and kits for colorectal cancer are provided to achieve efficient detection of colorectal cancer.
It significantly improves the sensitivity and specificity of colorectal cancer detection, has high detection efficiency, reduces detection costs, and can effectively distinguish colorectal cancer from normal samples, with a sensitivity of over 90% and a specificity of over 94%.
Smart Images

Figure CN116083582B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene diagnostic technology, and in particular to the application of single-site methylation detection of the SDC2 gene, and colorectal cancer diagnostic reagents and systems. Background Technology
[0002] In recent years, DNA methylation has been considered one of the most promising tumor markers. DNA methylation refers to the alteration of DNA function by the covalent bonding of a methyl group to the 5-carbon position of cytosine under the action of DNA methyltransferases.
[0003] Numerous studies have confirmed that DNA methylation is involved in regulating the entire process of tumor development and progression. In normal cells, the promoter regions of tumor suppressor genes are in a state of hypomethylation, and downstream DNA normally expresses tumor suppressor proteins. However, in tumor cells, the promoter regions are hypermethylated, inhibiting the normal expression of tumor suppressor genes. Therefore, it is generally believed that changes in DNA methylation often precede tumor development or are the earliest detectable tumor-related markers.
[0004] Existing technologies utilize gene methylation levels to detect colorectal cancer or its early lesions. However, these technologies typically detect the average methylation level within a specific region of the target gene, resulting in cumbersome procedures and low sensitivity and specificity. For example, Niu F et al. (2017) performed methylation detection on the SDC2 gene, achieving a specificity of 93.3%, but only a sensitivity of 81.1% for colorectal cancer detection.
[0005] In view of this, the present invention is proposed. Summary of the Invention
[0006] The purpose of this invention is to provide a product that uses methylation of a single specific site selected from the SDC2 gene as a biomarker for the preparation of products for the detection, prediction, or monitoring of colorectal cancer development. Simultaneously, it provides complementary colorectal cancer diagnostic reagents, colorectal cancer diagnostic kits, and systems for the detection, prediction, or monitoring of colorectal cancer development, thereby filling the gap in existing technologies for early colorectal cancer screening with broad application potential.
[0007] To solve the above-mentioned technical problems and achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] In a first aspect, the present invention provides the application of single-site methylation of the SDC2 gene in the preparation of products for detecting, predicting or monitoring the development of colorectal cancer, wherein the single-site methylation of the SDC2 gene is selected from chr8:96494187, chr8:96493501, chr8:96493590 or chr8:96494113.
[0009] In a second aspect, the present invention provides a colorectal cancer diagnostic reagent, wherein the colorectal cancer diagnostic reagent comprises a specific primer pair and a probe for detecting the methylation level of a single specific site chr8:96494187, chr8:96493501, chr8:96493590 or chr8:96494113 in the SDC2 gene, wherein the specific primer pair includes a forward primer and a capture primer;
[0010] The first forward primer for detecting the specific site chr8:96494187 of the SDC2 gene has the nucleotide sequence shown in SEQ ID No.1, and the first capture primer has the nucleotide sequence shown in SEQ ID No.2.
[0011] The second forward primer for detecting the specific site chr8:96493501 of the SDC2 gene has the nucleotide sequence shown in SEQ ID No.3, and the second capture primer has the nucleotide sequence shown in SEQ ID No.4;
[0012] The third forward primer for detecting the specific site chr8:96493590 of the SDC2 gene has the nucleotide sequence shown in SEQ ID No. 5, and the third capture primer has the nucleotide sequence shown in SEQ ID No. 6;
[0013] The fourth forward primer for detecting the specific site chr8:96494113 of the SDC2 gene has the nucleotide sequence shown in SEQ ID No.7, and the fourth capture primer has the nucleotide sequence shown in SEQ ID No.8.
[0014] Preferably, it also includes a reverse primer.
[0015] More preferably, the reverse primer has the nucleotide sequence shown in SEQ ID No. 9.
[0016] In an optional embodiment, the nucleotide sequence of the first forward primer for detecting the specific site chr8:96494187 of the SDC2 gene is shown in SEQ ID No.1, the nucleotide sequence of the first capture primer is shown in SEQ ID No.10, and the nucleotide sequence of the first probe is shown in SEQ ID No.11.
[0017] In an optional embodiment, the nucleotide sequence of the second forward primer used to detect the specific site chr8:96493501 of the SDC2 gene is shown in SEQ ID No. 3, the nucleotide sequence of the second capture primer is shown in SEQ ID No. 12, and the nucleotide sequence of the second probe is shown in SEQ ID No. 13.
[0018] In an optional embodiment, the nucleotide sequence of the third forward primer used to detect the specific site chr8:96493590 of the SDC2 gene is shown in SEQ ID No. 5, the nucleotide sequence of the third capture primer is shown in SEQ ID No. 14, and the nucleotide sequence of the third probe is shown in SEQ ID No. 15.
[0019] In an optional embodiment, the nucleotide sequence of the fourth forward primer used to detect the specific site chr8:96494113 of the SDC2 gene is shown in SEQ ID No. 7, the nucleotide sequence of the fourth capture primer is shown in SEQ ID No. 16, and the nucleotide sequence of the fourth probe is shown in SEQ ID No. 17.
[0020] In an optional embodiment, the probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
[0021] Thirdly, the present invention provides a diagnostic kit for colorectal cancer or advanced colorectal adenoma, the kit comprising the colorectal cancer diagnostic reagent described in any of the foregoing embodiments.
[0022] Fourthly, the present invention provides a system for detecting, predicting, or monitoring the development of colorectal cancer, the system comprising:
[0023] The detection module is used to detect the gene methylation level of known samples and test samples using the reagents or kits described in any of the foregoing embodiments;
[0024] The comparison module is used to determine the judgment reference data based on the methylation status data of known samples. It compares the SDC2 gene methylation status of the test sample obtained by the detection module with the judgment reference data and outputs the assessment result of colorectal cancer development based on the degree of similarity between the two.
[0025] The reference data are derived from at least one of the following populations: (a) patients without colorectal cancer, and (b) patients with colorectal cancer.
[0026] In an optional implementation, the sample to be tested is derived from the feces, tissues, or bodily fluids of the population being tested.
[0027] Preferably, the sample to be tested is derived from an advanced adenoma of colorectal cancer.
[0028] This invention is the first to use methylation of four single specific sites selected from the SDC2 gene: chr8:96494187, chr8:96493501, chr8:96493590 or chr8:96494113 as biomarkers in the preparation of products for detecting, predicting or monitoring tumor development. It has significant sensitivity and specificity and can effectively detect tumor patients.
[0029] This invention also provides reagents, kits, and systems for tumor diagnosis, used to detect methylation at any of the four sites including chr8:96494187, chr8:96493501, chr8:96493590, and chr8:96494113. This enables site-specific methylation detection of the SDC2 gene. Compared to existing methods for detecting SDC2 gene fragment methylation, this method eliminates the need for methylation conversion, significantly improving detection efficiency while reducing detection costs.
[0030] This invention has found that detecting the methylation level of a single specific site of a target gene associated with colorectal cancer or advanced colorectal adenoma has higher sensitivity and specificity for detecting, predicting, or monitoring colorectal cancer development compared to detecting the average methylation level of a region of the target gene. This may be because detecting the average methylation level of polymethylation sites can, to some extent, mask the detection performance of a single site. Attached Figure Description
[0031] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0032] Figure 1 The ROC curve obtained for colorectal cancer diagnosis using a single specific site provided in Embodiment 1 of the present invention;
[0033] Figure 2 The ROC curve obtained for colorectal cancer diagnosis using a single specific site provided in Embodiment 2 of the present invention;
[0034] Figure 3 The ROC curve obtained for colorectal cancer diagnosis using a single specific site provided in Embodiment 3 of the present invention;
[0035] Figure 4 The ROC curve obtained for colorectal cancer diagnosis using a single specific site provided in Embodiment 4 of the present invention. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The components of the embodiments of the present invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.
[0037] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.
[0038] It should be noted that similar reference numerals and letters in the following figures indicate similar items; therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures. Furthermore, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.
[0039] The full-length region of the SDC2 gene is chr8:96493169~96495331. The gene data is from: UCSGCenome Browser on Human Dec.2013(GRCh38 / hg38)Assembly.
[0040] In one specific embodiment, in a first aspect, the present invention provides the application of single-site methylation of the SDC2 gene in the preparation of products for detecting, predicting or monitoring the development of colorectal cancer, wherein the single-site methylation of the SDC2 gene is selected from chr8:96494187, chr8:96493501, chr8:96493590 or chr8:96494113.
[0041] In a second aspect, the present invention provides a colorectal cancer diagnostic reagent, wherein the colorectal cancer diagnostic reagent comprises a specific primer pair and a probe for detecting the methylation level of a single specific site chr8:96494187, chr8:96493501, chr8:96493590 or chr8:96494113 in the SDC2 gene, wherein the specific primer pair includes a forward primer and a capture primer;
[0042] The nucleotide sequence of the first forward primer for detecting the specific site chr8:96494187 of the SDC2 gene includes: CCCCGAGCCTGAGCC (SEQ ID No.1), and the nucleotide sequence of the first capture primer includes: GCACACGAATCCGGAGCCCGAGC (SEQ ID No.2).
[0043] The nucleotide sequence of the second forward primer for detecting the specific site chr8:96493501 of the SDC2 gene contains: GGGAAGAAA AGAGCATAGAGGAG (SEQ ID No. 3), and the nucleotide sequence of the second capture primer contains: GTTTTCTCAGTCCTTT (SEQ ID No. 4).
[0044] The nucleotide sequence of the third forward primer for detecting the specific site chr8:96493590 of the SDC2 gene includes: GGCGGCAGTGTGACTC (SEQ ID No. 5), and the nucleotide sequence of the third capture primer includes: GTGTAATCCTGTAGGAA (SEQ ID No. 6).
[0045] The nucleotide sequence of the fourth forward primer for detecting the specific site chr8:96494113 of the SDC2 gene contains: CAGCGATTGCGGCTCAGGCT (SEQ ID No. 7), and the nucleotide sequence of the fourth capture primer contains: GCCCCCGAGCCCCGCA (SEQ ID No. 8).
[0046] It should be noted that the nucleotide sequences contained in the forward primer and the capture primer correspond to the shortest core nucleotide fragments among the feasible primer pairs provided by this invention. These core nucleotide fragments are essential for achieving the targeted detection of the four sites of the SDC2 gene in this invention. Those skilled in the art can construct different primer pair combinations for practical applications based on this core nucleotide fragment, according to actual needs.
[0047] Preferably, it also includes a reverse primer.
[0048] More preferably, the nucleotide sequence of the reverse primer comprises: GCCTGTCAGCCAACGGTATTCATC (SEQ ID No. 9).
[0049] It should be noted that the reverse primer is a universal primer sequence, which can be any sequence, as long as it meets basic primer design principles. This sequence has a reasonable GC content, does not show significant binding to the human genome, and does not exhibit significant cross-binding with a large number of specific primers. For example, SEQ ID No. 9 does not cross-bind with the four primer pairs mentioned above, nor does it show significant binding to the human genome.
[0050] It is understood that, for methylation modification at a specific site among the four sites mentioned above, the specific primer pair can amplify a gene region including that methylation site. Accordingly, those skilled in the art can design and select probes within the amplification region for the purpose of detecting that specific methylation site. Therefore, the four probes described below are not specific probes targeting the aforementioned specific sites, but are merely examples and should not be construed as limiting the scope of protection of this invention. Those skilled in the art can design other primer pairs and refer to the design principles of the four probes below to perform conventional design; the resulting probe sequences should all be understood as falling within the scope of protection of this invention.
[0051] In an optional embodiment, the nucleotide sequence of the first forward primer for detecting the specific site chr8:96494187 of the SDC2 gene is CCCCGAGCCTGAGCC (SEQ ID No. 1), the nucleotide sequence of the first capture primer is GCCTGTCAGCCAACGGTATTCATCtttGCACACGAATCCGGAGCCCGAGCCCCGAGC CCG (SEQ ID No. 10), and the nucleotide sequence of the first probe is CAATCGCTGCGGTACTC (SEQ ID No. 11).
[0052] In an optional embodiment, the nucleotide sequence of the second forward primer used to detect the specific site chr8:96493501 of the SDC2 gene is GGGAAGAAAAGAGCATAGAGGAG (SEQ ID No. 3), the nucleotide sequence of the second capture primer is GCCTGTCAGCCAACGGTATTCATCtttGTTTTCTCAGTCCTTTGAAGGGA AAGAGAAAAGACAACG (SEQ ID No. 12), and the nucleotide sequence of the second probe is CCTTTCTCTCCCCAC (SEQ ID No. 13).
[0053] In an optional embodiment, the nucleotide sequence of the third forward primer used to detect the specific site chr8:96493590 of the SDC2 gene is GGCGGCAGTGTGACTC (SEQ ID No. 5), the nucleotide sequence of the third capture primer is GCCTGTCAGCCAACGGTATTCATCtttGTGTAATCCTGTAGGAATTGG GCGACTGGGGAGA (SEQ ID No. 14), and the nucleotide sequence of the third probe is CCAGATAAACCCGGGAGA (SEQ ID No. 15).
[0054] In an optional embodiment, the nucleotide sequence of the fourth forward primer used to detect the specific site chr8:96494113 of the SDC2 gene is CAGCGATTGCGGCTCAGGCT (SEQ ID No. 7), the nucleotide sequence of the fourth capture primer is GCCTGTCAGCCAACGGTATTCATCtttGCCCCCGAGCCCCGCACACGAATCCGGAGC AGAGTAC (SEQ ID No. 16), and the nucleotide sequence of the fourth probe is CCCGAGTCCCCGAGC (SEQ ID No. 17).
[0055] In an optional embodiment, the probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
[0056] Thirdly, the present invention provides a diagnostic kit for colorectal cancer or advanced colorectal adenoma, the kit comprising the diagnostic reagent for colorectal cancer or advanced colorectal adenoma as described in any of the foregoing embodiments.
[0057] It should be understood that the above-mentioned reagent kit also includes optional consumables, which are essential for ensuring the smooth implementation of the reagent kit detection and are packaged together with the reagent kit, including but not limited to liquid dispensing devices, reaction containers, cleaning devices and mixing devices. Those skilled in the art can make adaptive updates based on the improvements of the reagent kit consumables. Unless they have a decisive impact on the detection results, the above-mentioned adaptive choices should be understood as being within the scope of protection of this invention.
[0058] Fourthly, the present invention provides a system for detecting, predicting, or monitoring the development of colorectal cancer, the system comprising:
[0059] The detection module is used to detect the gene methylation level of known samples and test samples using the reagents or kits described in any of the foregoing embodiments;
[0060] The comparison module is used to determine the judgment reference data based on the methylation status data of known samples. It compares the SDC2 gene methylation status of the test sample obtained by the detection module with the judgment reference data and outputs the assessment result of colorectal cancer development based on the degree of similarity between the two.
[0061] The reference data are derived from at least one of the following populations: (a) patients without colorectal cancer, and (b) patients with colorectal cancer.
[0062] In an optional implementation, the sample to be tested is derived from the feces, tissues, or bodily fluids of the population being tested.
[0063] Preferably, the sample to be tested is derived from an advanced adenoma of colorectal cancer.
[0064] It should be noted that those skilled in the art can select the method for determining the closeness between the detection data and the reference data described in this invention according to different actual needs. The actual needs include detection speed, detection throughput, or detection accuracy, etc. The determination method may be to compare the methylation evaluation parameters (including but not limited to the ΔCt value or ΔΔCt value of the amplification curve, etc.) corresponding to the detection data and the reference data to obtain the matching degree between the detection data and the reference data; or it may be to build a prediction model based on the reference data and use the prediction model to analyze the detection data.
[0065] The following detailed description of some embodiments of the present invention is provided in conjunction with the accompanying drawings. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0066] Example 1
[0067] This embodiment provides a set of primer pairs and probes for detecting methylation at a single specific site chr8:96494187 in the SDC2 gene. The primer pair and probe information is as follows:
[0068]
[0069] It should be noted that the probe described in this embodiment can also be selected in other ways, as long as its target site is located within the amplification region chr8:96494118~96494187. The modified fluorescent group can also be VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
[0070] Example 2
[0071] The difference from Example 1 is that this example provides a new set of primer pairs and probes for detecting methylation at site chr8:96493501, with the amplification region being chr8:96493412~96493501. The specific sequence information is as follows:
[0072]
[0073] Example 3
[0074] The difference from Example 1 is that this example provides a new set of primer pairs and probes for detecting methylation at site chr8:96493590, with the amplification region being chr8:96493591~96493662. The specific sequence information is as follows:
[0075]
[0076] Example 4
[0077] The difference from Example 1 is that this example provides a new set of primer pairs and probes for detecting methylation at site chr8:96494113, with the amplification region being chr8:96494114~96494187. The specific sequence information is as follows:
[0078]
[0079] Experimental Example
[0080] This study included stool samples from 108 patients with colorectal cancer and 31 patients with advanced adenomas. The primer pairs and probes provided in Examples 1-4 were used for early screening of colorectal cancer according to the following methods:
[0081] 1. Extraction of human DNA from feces:
[0082] Human DNA from feces can be obtained by any method. In this example, a soil and fecal genomic DNA extraction kit (catalog number: TD601) from Beijing Tianmo Technology Development Co., Ltd. is used. The specific operation is as follows:
[0083] (1) Take 2g of fresh fecal sample into a fecal collection tube. The collection tube is pre-filled with 10ml of preservation solution (Beijing Tianmo Technology Development Co., Ltd., item number: TR110). Mix thoroughly. Take 600μL of the mixture into a lysis tube and vortex at maximum speed for more than 5 minutes to mix. Place the lysis tube in a centrifuge and centrifuge at ≥10000xg for 1 minute.
[0084] (2) Add 400 μL of the obtained supernatant to column F of column 3. Column F of column 3 is placed in a collection tube. Centrifuge at 8000 x g for 1 minute, discard the filter column, add 1200 μL of genomic DNA lysis buffer to the collection tube of the previous step and mix thoroughly. Place column 2 in a new collection tube, take 700 μL of the mixture and add it to column 2. Centrifuge at 10000 x g for 1 minute and discard the waste liquid in the collection tube.
[0085] (3) Repeat step (2) until all the mixture is used up.
[0086] (4) Place column 2 into a new collection tube, add 200 μL of genomic DNA washing buffer 1 to column 2, centrifuge at ≥10000xg for 1 minute, add 500 μL of genomic DNA washing buffer 2 to column 2, and centrifuge at ≥10000xg for 1 minute.
[0087] (5) Repeat step (4), discard the waste liquid in the collection tube, and put column No. 2 back into the collection tube. Centrifuge at ≥10000xg for 2 minutes to remove as much washing liquid as possible to avoid residual ethanol in the washing liquid inhibiting the downstream reaction. Transfer column No. 2 to a clean 1.5ml centrifuge tube and add 120μL of genomic DNA elution buffer directly onto the column matrix. Incubate at room temperature for 2-5 minutes, and centrifuge at ≥10000xg for 1 minute to elute genomic DNA. Put the inhibitor removal column into a collection tube, add 600μL of inhibitor removal buffer, and centrifuge at ≥8000xg for 3 minutes.
[0088] (6) Place the eluted genomic DNA into the prepared inhibitor removal column, which is placed in a clean 1.5 ml centrifuge tube and centrifuged at 16000 x g for 3 minutes.
[0089] (7) Repeat step (6) to obtain genomic DNA for subsequent methylation detection experiments.
[0090] 2. Enzyme digestion reaction
[0091] Enzyme digestion reaction system:
[0092]
[0093]
[0094] After thorough mixing and momentary incubation, place in a constant temperature incubator at 30℃ for 20 min, 65℃ for 30 min, and store at 4℃; the product after reaction is the template for methylation detection.
[0095] 3. Methylation detection:
[0096] PCR reaction system:
[0097]
[0098]
[0099] composition main components PCR reaction solution 1 Buffer, dNTPs, primers, probes PCR reaction solution 2 Taq DNA polymerase Positive control Methylation-positive genome
[0100]
[0101] (1) Take out PCR reaction solution 1, PCR reaction solution 2, primers and positive control, thaw them, shake for 30s, and centrifuge for 30s to prevent reagent residue from remaining in the tube cap.
[0102] (2) Preparation of reaction solution: Calculate the number of reaction solution tubes to be dispensed based on the number of samples to be amplified and detected.
[0103] composition main components PCR reaction solution 1 1.8μL Primers 9.6μL PCR reaction solution 2 0.6μL
[0104] (3) Dispensing: Dispense the prepared reaction solution into reaction tubes / reaction plates at a rate of 12 μL / tube.
[0105] (4) Sample addition: Add 8 μL each of the prepared negative control NC, enzyme digestion product, and positive control PC to each reaction tube containing the pre-allocated reaction solution in sequence. After adding the samples, cap the tubes or seal them with a membrane, centrifuge briefly for 30 seconds, and immediately perform the PCR amplification reaction.
[0106] Set up and run the PCR amplification program according to the table below.
[0107] PCR amplification procedure:
[0108]
[0109] Result judgment:
[0110] After the positive control, negative control, and internal control are qualified, the sample test results can be judged according to the following CT value interpretation criteria.
[0111]
[0112] Using the primer pairs and probes provided in Examples 1-4 above, 108 fecal samples from enrolled colorectal cancer patients were validated and tested. The results are as follows:
[0113] chr8:96494187 Single-point detection result
[0114]
[0115] chr8:96493501 Single-point detection result
[0116]
[0117] chr8:96493590 Single-point detection result
[0118]
[0119] chr8:96494113 Single-point detection result
[0120]
[0121] The corresponding ROC curve is as follows Figures 1-4 As shown, the detection results for single specific loci chr8:96494187, chr8:96493501, chr8:96493590, and chr8:96494113 are respectively derived from... Figures 1-4 The detection of the four single-site methylation sites of SDC2 provided by the present invention, as shown in the table above, has achieved a sensitivity of over 90% and a specificity of over 94%. It can be seen that the methylation detection of the above four single specific sites provided by the present invention can be used as an effective marker to distinguish colorectal cancer from normal tissue.
[0122] The results of sensitivity and specificity analysis of the four single-site methylation sites of SDC2 are summarized below:
[0123] Site information Gene Sensitivity Specificity AUC chr8: 96494187 SDC2 92.96% 97.30% 0.949 chr8: 96493501 SDC2 91.55% 97.30% 0.947 chr8: 96493590 SDC2 90.14% 94.59% 0.932 chr8: 96494113 SDC2 91.55% 94.59% 0.924
[0124] The primer pairs and probes provided in Examples 1-4 above were used to validate and detect 31 enrolled advanced adenoma samples. The detection rates are as follows:
[0125] Site information Gene Positive detection rate chr8: 96494187 SDC2 61.29% chr8: 96493501 SDC2 35.48% chr8: 96493590 SDC2 51.61% chr8: 96494113 SDC2 51.61%
[0126] Comparative Example 1
[0127] This comparative example uses conventional bisulfite transformation and quantitative real-time PCR to detect the SDC2 gene. The specific steps are as follows:
[0128] 1. Purification and enrichment of human DNA in feces
[0129] Add an equal volume of 6 mol / L guanidine isothiocyanate solution (containing 10 pmol of biotinylated SDC2 and actin capture probe) to 300 μL of crude fecal DNA and incubate at room temperature for 4 h.
[0130] Add 50 μL of streptavidin-modified magnetic beads M-280 (Thermo Fisher Scinetific) and incubate at room temperature for 1 h.
[0131] The magnetic bead / nucleic acid hybridization complex was washed twice with 1× washing buffer (1.0 mol / L NaCl, 5 mmol / L Tris-HCl pH 7.5, and 0.5 mmol / L EDTA), and the nucleic acids on the magnetic beads were eluted with 50 μL of nuclease-free water (containing 20 ng / μL transfer RNA). The target gene SDC2 and the internal reference gene β-actin (ACTB) were simultaneously captured in one reaction.
[0132] 2. Bisulfite Conversion
[0133] DNA bisulfite conversion was performed using the EZ DNA Methylation Kit (Zymo Research), following the product instructions. 50 μL of captured fecal DNA positive sample was added to the reaction, followed by elution with 15 μL of TE buffer.
[0134] 3. Real-time quantitative methylation-specific PCR
[0135] Real-time quantitative methylation-specific PCR was used to detect fecal DNA samples. Primers and probes were designed at the CpG island position of the SDC2 gene, and the ACTB gene was used as an internal reference gene for bisulfite conversion and DNA input.
[0136] Primer and probe sequences:
[0137]
[0138]
[0139] The PCR reaction system is as follows: 5 μL fecal DNA sample, 25 μL reaction solution (primer concentration 400 nmol / L, probe concentration 200 nmol / L, 5 mmol / L MgSO4). 2+ The PCR reaction system consisted of 400 μmol / L dNTPs, 0.1 U / μL GoTaq Hot Star 4t Polymerase (Promegea), and 1× buffer. The PCR reaction was performed on a Lightcycler 96 instrument. PCR reaction program: 95℃ for 5 min;
[0140]
[0141] The amount of SDC2 methylation in fecal DNA samples was calculated based on the test results.
[0142] The sensitivity and specificity analysis of the comparative examples for detecting fecal samples from the above-enrolled colorectal cancer patients showed a sensitivity of 81.1% and a specificity of 93.3%. The detection rate for validation testing of enrolled advanced adenoma samples was 58.2%. Compared to the comparative examples, Examples 1–4 demonstrated higher detection sensitivity and specificity for colorectal cancer patients.
[0143] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of a reagent for detecting methylation at a single specific site of the SDC2 gene in the preparation of colorectal cancer detection products, wherein the single specific site of the SDC2 gene is selected from chr8:96494187, chr8:96493501, chr8:96493590 or chr8:96494113; The gene pool is sourced from: UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly; The reagent contains specific primer pairs, probes, reverse primers, and Gla I enzymes for detecting the methylation levels of a single specific site chr8:96494187, chr8:96493501, chr8:96493590, or chr8:96494113 in the SDC2 gene. The specific primer pairs include forward primers and capture primers. The nucleotide sequence of the first forward primer for detecting the specific site chr8:96494187 of the SDC2 gene is shown in SEQ ID No.1, the nucleotide sequence of the first capture primer is shown in SEQ ID No.10, and the nucleotide sequence of the first probe is shown in SEQ ID No.
11. The nucleotide sequence of the second forward primer for detecting the specific site chr8:96493501 of the SDC2 gene is shown in SEQ ID No.3, the nucleotide sequence of the second capture primer is shown in SEQ ID No.12, and the nucleotide sequence of the second probe is shown in SEQ ID No.
13. The nucleotide sequence of the third forward primer for detecting the specific site chr8:96493590 of the SDC2 gene is shown in SEQ ID No. 5, the nucleotide sequence of the third capture primer is shown in SEQ ID No. 14, and the nucleotide sequence of the third probe is shown in SEQ ID No.
15. The nucleotide sequence of the fourth forward primer for detecting the specific site chr8:96494113 of the SDC2 gene is shown in SEQ ID No.7, the nucleotide sequence of the fourth capture primer is shown in SEQ ID No.16, and the nucleotide sequence of the fourth probe is shown in SEQ ID No.
17. The reverse primer is the nucleotide sequence shown in SEQ ID No.
9.
2. The application according to claim 1, characterized in that, The probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
3. A system for detecting colorectal cancer, characterized in that, The system includes: The detection module is used to detect gene methylation levels in known samples and samples to be tested using reagents; The comparison module is used to determine the judgment reference data based on the methylation status data of known samples. It compares the SDC2 gene methylation status of the test sample obtained by the detection module with the judgment reference data and outputs the assessment result of colorectal cancer development based on the degree of similarity between the two. The reference data includes the following populations: (a) patients without colorectal cancer, and (b) patients with colorectal cancer. The reagent contains specific primer pairs, probes, reverse primers, and Gla I enzymes for detecting the methylation levels of a single specific site chr8:96494187, chr8:96493501, chr8:96493590, or chr8:96494113 in the SDC2 gene. The specific primer pairs include forward primers and capture primers. The nucleotide sequence of the first forward primer for detecting the specific site chr8:96494187 of the SDC2 gene is shown in SEQ ID No.1, the nucleotide sequence of the first capture primer is shown in SEQ ID No.10, and the nucleotide sequence of the first probe is shown in SEQ ID No.
11. The nucleotide sequence of the second forward primer for detecting the specific site chr8:96493501 of the SDC2 gene is shown in SEQ ID No.3, the nucleotide sequence of the second capture primer is shown in SEQ ID No.12, and the nucleotide sequence of the second probe is shown in SEQ ID No.
13. The nucleotide sequence of the third forward primer for detecting the specific site chr8:96493590 of the SDC2 gene is shown in SEQ ID No. 5, the nucleotide sequence of the third capture primer is shown in SEQ ID No. 14, and the nucleotide sequence of the third probe is shown in SEQ ID No.
15. The nucleotide sequence of the fourth forward primer for detecting the specific site chr8:96494113 of the SDC2 gene is shown in SEQ ID No.7, the nucleotide sequence of the fourth capture primer is shown in SEQ ID No.16, and the nucleotide sequence of the fourth probe is shown in SEQ ID No.
17. The reverse primer is the nucleotide sequence shown in SEQ ID No.
9.
4. The system according to claim 3, characterized in that, The samples to be tested are derived from the feces, tissues, or bodily fluids of the population being tested.
Citation Information
Patent Citations
Early diagnosis reagent for colorectal cancer based on combined detection of methylation levels of SDC2 gene and SFRP2 gene
CN108977543A
Application of detection reagent for detecting methylation of genes related to colorectal cancer and kit
CN110343764A