A molecular marker related to sheep growth traits and its application

Abstract

The present invention provides a molecular marker related to sheep growth traits and its application. The molecular marker related to sheep growth has a nucleotide sequence as shown in SEQ ID NO.1, wherein Y at the 262 bp position represents C or T, and the mutation leads to C / T polymorphism of the molecular marker. The present invention performs PCR amplification and sequence analysis on the sheep PHYHIPL gene, detects the genes of 1132 Hu sheep and establishes a least squares model, and performs association analysis on the genotype and growth traits. It is found that there is a C / T polymorphic site at the 262nd position of the sequence of the amplified fragment as shown in SEQ ID NO.1, and finally determines that the PHYHIPL gene fragment amplified by the present invention can be used as a molecular marker related to sheep growth. The present invention can be used to select sheep with CC homozygous genes to enter the core group as breeding sheep by detecting molecular markers, and the growth traits of sheep are helpful to improve the economic efficiency of production and breeding industry.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a PHYHIPL gene fragment as a molecular marker affecting sheep growth traits and an application thereof. Background Art

[0002] At present, the demand for rich meat products with the improvement of people's living standards has promoted the development of various breeding industries. The current sheep farming industry has a good development trend. While continuously enriching the varieties of sheep and goats, it has also accelerated the selection and breeding of sheep varieties to ensure the high quality and high yield of sheep varieties (Dai Pengcheng. The basic status and development prospects of my country's sheep farming industry [J]. Agricultural Science and Technology Weekly, 2014, 000 (005): 48-48.). Sheep are an important source of meat, dairy products and wool, and play a vital role in the global agricultural economy. Weight and body shape are key characteristics of the sheep industry (Tao L, XY He, Pan LX, et al. Genome-wide association study of body weight and conformation traits inneonata l sheep [J]. Animal Genetics, 2020.). In the production practice of sheep, it is very important to select sheep with good growth traits. Good growth and fast weight gain can greatly save production costs. However, past studies have little understanding of the potential genetic mechanisms of sheep weight and body shape.

[0003] PHYHIPL (phytyl-CoA 2-hydroxylase interacting protein gene) is a protein coding gene. This gene may play a role in the development of the central system. PHYHIPL genotype, overall and other aspects have undergone significant changes. It is produced by proteins that are found to be significantly regulated by global ischemia, involving proteins that regulate energy production and oxidative stress (James R, Searcy JL, Bihan TL, et al. Proteomic analysis of mitochondriain APOE transgenic mice and in response to an ischemic challenge [J]. Journal of Cerebral Blood Flow & Metabolism, 2012, 32 (1): 164-176.). PHYHIPL may be a target gene for GBM treatment and prognosis. Protein-protein interactions suggest that PHYHIPL may play a crucial role in cell metabolism (Fu HD, Ge B, Chen DK, et al. Phytanoyl-CoA2-Hydroxylase-Interacting Protein-Like Gene Is a Therapeutic Target Gene for Glioblastom a Multiforme[J]. Medical Science Monitor: International Medical Journal of Experimental and Clinical Research, 2019, 25: 2583-2590.). However, it is not clear whether PHYHIPL is related to the growth traits of sheep, or what the relationship is.

[0004] The present invention sequences and analyzes the PHYHIPL gene to explore the correlation between its different genotypes and sheep growth traits, aiming to provide genetic materials for improving the genetic improvement of sheep growth traits and accelerate the breeding process of high-quality meat sheep with independent intellectual property rights. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the prior art and provide a molecular marker related to sheep growth and its application. The molecular marker of the present invention is amplified from the sheep PHYHIPL gene, and its nucleotide sequence is shown in SEQ ID NO.1. Through a large number of experiments, the sheep PHYHIPL gene sequence is amplified and sequenced, the polymorphic sites of the PHYHIPL gene are found, the correlation between different genotypes and sheep growth is analyzed, and a detection method for the polymorphic site is established, and the molecular marker is applied to the breeding of new high-quality mutton sheep.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A molecular marker related to sheep growth traits, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at the 262 bp position represents C or T, and since the above sequence has a C / T mutation at the 262 base position, it leads to the C / T polymorphism of the sheep PHYHIPL gene at this site.

[0008] A primer set for detecting the above molecular markers comprises an upstream primer and a downstream primer having nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] A KASPar primer set for detecting the above-mentioned molecular markers related to sheep growth traits includes a forward primer 1 for detecting AlleleC, a forward primer 2 for detecting AlleleT and a universal reverse primer C with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0010] A kit for detecting the above-mentioned molecular markers related to sheep growth traits, wherein the detection kit comprises the above-mentioned primer set or KASPar primer set.

[0011] A method for detecting molecular markers related to sheep growth traits, wherein the molecular markers are as described above, the method comprises using the above primer set or kit to detect sheep genomic DNA, and the specific detection method comprises the following steps:

[0012] 1) amplifying sheep genomic DNA using the above primer set, KASPar primer set or a kit for detecting the above molecular markers related to sheep growth traits;

[0013] 2) Identifying the polymorphic sites of the amplified product obtained in step 1).

[0014] Wherein, in step 2), the above-mentioned typing and identification method is direct sequencing method, probe method, gene chip method, fluorescent probe method or high-resolution melting curve method.

[0015] The KASPar method for detecting molecular markers for sheep growth-related traits comprises the following steps:

[0016] a) extracting genomic DNA from sheep blood as a sample, and performing high-throughput water bath PCR amplification on the genomic DNA extracted using the KASPar primer set with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0017] b) After amplification, use the BMG PHERAstar instrument to detect the fluorescence signal and view the typing results.

[0018] The molecular markers, primer sets or kits described above are used in the detection of sheep growth-related traits. By detecting the molecular markers provided by the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, the growth height traits of the sheep can be determined, and then sheep with rapid growth can be screened out.

[0019] The molecular markers, primer sets or kits described above are used in sheep breeding. The genotype of the PHYHIPL gene of the sample to be tested is determined by amplifying and detecting the genomic DNA of the sheep using the primer sets or kits described above, so that a fast-growing sheep breed can be bred therefrom.

[0020] Finding the mutation sites of genes and discovering the relationship between genes and traits through association analysis is an important means of studying gene function and is also the basis for marker-assisted selection.

[0021] The present invention performs PCR amplification and sequencing on the PHYHIPL gene of sheep, finds that there is a C / T polymorphic site at the 262nd position of the amplified fragment, and determines a molecular marker related to sheep growth by detecting the polymorphism of 1132 Hu sheep and establishing a least squares model. The molecular marker can be used for the selection and breeding of high-yield sheep and the cultivation of new high-yield high-quality mutton sheep varieties, provides an effective genetic engineering means for the genetic improvement of sheep growth, and has great practical application value.

[0022] The present invention detects the above molecular markers by designing the KASPar primer group required for competitive allele-specific PCR (KASP). The detection method does not need to synthesize specific fluorescent probes for each SNP site, but is based on its own unique ARM PCR principle, so that all site detections are ultimately amplified using universal fluorescent primers, which greatly reduces the cost of reagents and has high accuracy, providing a simple, accurate and low-cost operating method for the detection of molecular markers of the present invention.

[0023] The beneficial effects of the present invention are:

[0024] The present invention provides a molecular marker related to sheep growth traits, specifically a C / T polymorphic site at position 262 of the SEQ ID NO.1 fragment, providing an effective detection means for the selection and breeding of fast-growing sheep. The present invention can be used to select sheep with CC homozygous genes as breeding sheep for breeding, shorten the breeding cycle, improve the growth traits of sheep, and help improve the economic benefits of the sheep breeding industry by detecting molecular markers related to sheep growth traits and the polymorphic sites that cause them. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the gel electrophoresis diagram of the sheep PHYHIPL gene fragment used as a molecular marker.

[0026] Figure 2 This is the sequencing result of the mutation site of the sheep PHYHIPL gene in the present invention.

[0027] Figure 3 This is the KASPar SNP typing result of the g.262C>T mutation site of the sheep PHYHIPL gene in the present invention. DETAILED DESCRIPTION

[0028] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0029] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the present method are of analytical grade or above.

[0030] Example 1 Amplification of PHYHIPL gene

[0031] Using sheep PHYHIPL gene DNA (GenBank accession number: NC_040260.1) as a template, a pair of primers were designed using Oligo7.0 software: upstream primer and downstream primer. The primer sequences are as follows:

[0032] Upstream primer (SEQ ID NO.2): 5'-GTCATTGTACCATGCCGCCAG-3'

[0033] Downstream primer (SEQ ID NO.3): 5'-CAAGCCTGAAGTACAACCCT-3'

[0034] (2) Amplification and sequencing of PHYHIPL gene

[0035] The genomic DNA extracted from sheep whole blood cells was used as a DNA template for PCR amplification. The total reaction volume of the amplification was 25 μL, including 1 μL DNA template, 12.4 μL 2× PCR Master Mix, 0.8 μL upstream primer (concentration of 10 μmol / L), 0.8 μL downstream primer (concentration of 10 μmol / L), ddH 2 O10μL. PCR amplification reaction conditions: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 54.5℃ annealing for 30s, 72℃ extension for 30s, 35 cycles, and finally 72℃ extension for 10min.

[0036] The above PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the result showed that a 351 bp specific amplified fragment was obtained. Figure 1 As shown, wherein lane M: DL 2000Marker, lanes 1-10: results of PHYHIPL gene amplification. The amplified PCR fragment was sequenced, and the specific nucleotide sequence of the amplified fragment is shown in SEQ ID NO.1, wherein there is a polymorphic site in the fragment, specifically, Y at the 262 bp site is C or T, that is, the amplified PHYHIPL gene fragment (SEQ ID NO.1) has C / T polymorphism at the 262 bp site. The peak graph obtained by sequencing was subjected to double peak detection to identify the mutation site, and the result is shown in Figure 2 shown.

[0037] Among them, SEQ ID NO.1 is as follows: GTCATTGTACCATGCCGCCAGGGCCAGCATTCCCTCCTTTCATTTTTGTCCCACGTTTACTGATGTCATCTTCTACTCTGGTTGTGCAGTAATTCATTGTCTTTTGCTTAAGGTTTTACTTCCTCCTTCTGTGGGATTGTACATGTTGGATCTCCCAGTAATTCTAGAGAT TGCTTTCCTTTGAATTCAATCACAGTTATCCTCTTTTAATGATTGTTTATTCTATTTCAGAATTATTTTGTGCTCCTCTTGCATGTTAYTTATATTCATTACTTTTTATCTTACATCAAATACAGTTGCATTTATGTGCTTTTTGTTGCTAAGTACTCAGGGTTGTACTTCAGGCTTG.

[0038] Sequence homology search and identification:

[0039] The DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search results showed that the sequence was 99% identical to the partial sequence of the sheep PHYHIPL gene DNA (GenBank accession number: NC_040260.1).

[0040] Example 2 Establishment of genotyping detection method

[0041] 1. Primer sequence design

[0042] A KASPar primer pair was designed for the C / T polymorphic site shown in the amplified fragment SEQ ID NO.1 in Example 1, so as to be used for specific detection of the polymorphic site. The nucleotide sequence of the designed KASPar primer pair is:

[0043] Forward primer 1 for detecting AlleleC, SEQ ID NO.4: 5'-GAAGGTGACCAAGTTCATGCTTATTTTGTGCTCCTCTTGCATGTTAC-3';

[0044] Forward primer 2 for detecting AlleleT, SEQ ID NO.5: 5'-GAAGGTCGGAGTCAACGGATTAATTATTTTGTGCTCCTCTTGCATGTTAT-3';

[0045] Universal reverse primer C, such as SEQ ID NO.6: 5'-GCAACTGTATTTGATGTAAGATAAAAAGTAATGAAT-3'.

[0046] The above primers were commissioned to Beijing Shenggong Biotechnology Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer 1: forward primer 2: reverse primer C.

[0047] 2. DNA quality control

[0048] The extraction of genomic DNA from the whole blood of sheep can be carried out using a DNA extraction kit. The quality of the extracted genomic DNA is tested by 1% agarose electrophoresis and Nanodro p2100 respectively. The qualified DNA is required to meet the following requirements: agarose electrophoresis shows a single DNA band without obvious diffusion; Nanodrop2100 detection A260 / 280 is between 1.8-2.0, indicating that the DNA sample has no protein contamination; A260 / 230 is between 1.8-2.0, indicating that the DNA sample has a low salt ion concentration; A270nm has no obvious light absorption, indicating that the DNA sample has no phenol contamination. According to the KASP detection technology of LGC Company in the UK and the size of the genome, the amount of DNA used is calculated to be 10-20ng / sample, and the concentration of the diluted DNA template is diluted to 10-20ng / μL for standby use.

[0049] 3. Genotyping test

[0050] First, use the K-pette dispensing workstation to add 1.5 μL of the diluted test DNA template (10-20 ng / μL) and the blank control (No template control, NTC, using sterile water) into a 384-well reaction plate, and dry at 60°C for 30 min (drying oven, LGC Company) to convert the DNA into dry powder for use.

[0051] Then, under the Kraken operating system, 1× Master mix (1536 microplate, Part No. KBS-1016-011) and primer mixture were added to each reaction well using the Meridian loading workstation. After the mix was dispensed, the microplate was immediately placed on the Kube heat sealer and the Fusion laser sealer for sealing, and high-throughput water bath PCR amplification was performed using the Hydrocyler.

[0052] The PCR reaction was carried out in a high-throughput water bath system, Hydrocycler, and the specific procedure was as follows:

[0053] Pre-denaturation at 94°C for 15 minutes;

[0054] 94℃, 20 seconds (denaturation) - 61℃-55℃, 1 minute (renaturation & extension), 10 cycles of touch down sequence, decreasing 0.6℃ per cycle;

[0055] Amplification was continued for 26 cycles from 94°C, 20 seconds (denaturation) to 55°C, 60 seconds.

[0056] After amplification, the BMG PHERAstar instrument was used to detect the fluorescence signal and check the typing. The specific results are as follows Figure 3 Each dot in the figure represents a sample to be tested, where the red dot near the left side indicates that the site is a homozygous genotype "TT"; the blue dot near the right side indicates that the site is a homozygous genotype "CC"; the green dot near the middle indicates that the site is a heterozygous genotype "TC" or "CT"; the black dot indicates NTC (i.e., sterile water control, Figure 3 not shown).

[0057] 4. Application of the molecular markers of the present invention in association analysis of sheep growth traits

[0058] A total of 1,132 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and growth traits.

[0059] Y ijkl =μ+Genotype i +Batch j +Father k +Mother l +ε ijkl

[0060] Among them, Y ijkl is the observed value of the growth trait, μ is the overall mean, and Genotype i is the genotype effect, Batch jis the batch effect, Father k For the paternal effect, Mother l is the maternal effect, ε ijkl The results were random errors and the P value (P<0.05) was considered statistically significant.

[0061] The genotype test results showed that among the 1132 individuals, there were 965 individuals with TT genotype, 132 individuals with TC genotype, and 35 individuals with CC genotype. The results of the genotype-trait association analysis are shown in Table 1.

[0062] Among them, BW in the table represents the stage body weight, in kg. BW80 represents the weight of the sheep on the 80th day of age; BW100 represents the weight of the sheep on the 100th day of age, and so on. The values ​​in the table represent the average weight of the same genotype.

[0063] Table 1 Analysis of association between sheep PHYHIPL g.262C>T gene polymorphism and growth

[0064]

[0065] Note: Data in the same row with different letters in the subscripts indicate significant differences (P<0.05), and data with the same letters in the subscripts indicate no significant differences (P>0.05).

[0066] The results showed that as the measurement period was prolonged, the C / T polymorphic site at the 262bp position of the nucleotide sequence as shown in SEQ ID NO.1 was significantly correlated with the weight of sheep. The weight of individuals with CC genotype was significantly higher than that of individuals with TT and TC genotypes (P<0.05). It can be seen that the CC genotype is the dominant genotype and the C allele is the dominant allele, indicating that the PHYHIPL g.262C>T mutation site can be used as a potential molecular marker affecting the weight of sheep (P<0.05). Selecting the CC genotype for seed preservation during breeding, using the CC genotype as a breeding sheep during breeding, and hybridizing with other sheep can effectively improve the production efficiency of offspring sheep.

Claims

1. A primer set for detecting a molecular marker related to sheep growth traits in sheep breeding, wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein Y at the 262 bp position represents C or T, resulting in C / T polymorphism of the molecular marker, characterized in that: The body weight of individuals carrying CC genotype is significantly higher than that of individuals carrying TT and TC genotypes; the purpose of the breeding is to select sheep that can gain weight quickly.

2. The use according to claim 1, characterized in that: The primer set includes an upstream primer and a downstream primer whose nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the Y at the 262 bp position represents C or T, resulting in the C / T polymorphism of the molecular marker; the weight of individuals carrying the CC genotype is significantly higher than that of individuals carrying the TT and TC genotypes.

3. The use according to claim 1, characterized in that: The primer set is a KASPar primer set, which includes a forward primer 1 for detecting AlleleC, a forward primer 2 for detecting AlleleT and a universal reverse primer C, whose nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at the 262 bp position represents C or T, resulting in C / T polymorphism of the molecular marker; the weight of individuals carrying the CC genotype is significantly higher than that of individuals carrying the TT and TC genotypes.

4. Use of a kit for detecting molecular markers related to sheep growth traits in sheep breeding, characterized in that: The kit comprises a primer set with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or a KASPar primer set with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein Y at the 262 bp position represents C or T, resulting in C / T polymorphism of the molecular marker; the weight of individuals carrying the CC genotype is significantly higher than that of individuals carrying the TT and TC genotypes, and the purpose of the breeding is to screen fast-growing sheep.

5. Application of a method for detecting molecular markers associated with sheep growth traits in sheep breeding, comprising the following steps: 1) amplifying sheep genomic DNA using a PCR primer set with nucleotide sequences as shown in SEQ ID NOs. 2-3 or a KASPar primer set with nucleotide sequences as shown in SEQ ID NOs. 4-6; 2) The nucleotide sequence of the amplified product obtained in step 1) is subjected to typing identification for the specific site where Y represents C or T at 262 bp as shown in SEQ ID NO. 1, wherein the weight of individuals carrying the CC genotype is significantly higher than that of individuals carrying the TT and TC genotypes; The purpose of the breeding is to select fast-growing sheep.

6. The use according to claim 5, characterized in that: The typing and identification method in step 2) is direct sequencing, gene chip, fluorescent probe or high-resolution melting curve method.

7. The use according to claim 5, characterized in that: Amplification was performed using a KASPar primer pair with nucleotide sequences as shown in SEQ ID NO. 4-6. After amplification, the typing result was determined by detecting the fluorescent signal.

Images