Bimodal camel milk fat rate related gene card11 and its application as a molecular marker

Abstract

The application belongs to the technical field of biology, and particularly relates to a bactrian camel milk fat rate related gene CARD11 and application thereof as a molecular marker. The application discloses a bactrian camel milk production trait related gene CARD11, and a breeding method and application of using a single nucleotide polymorphism site (SNP) of the gene as a molecular marker for assisted selection. The CARD11 gene and a site related to high / low milk fat rate in a bactrian camel lactation trait are found for the first time, which provides a candidate gene for breeding a bactrian camel variety with excellent traits and improving camel milk quality. The application uses a second-generation sequencing technology to perform genome resequencing on 162 bactrian camels, performs whole genome association analysis on camel milk fat rate traits, and identifies a molecular marker related to the bactrian camel milk fat rate in the CARD11 gene. The marker is located at a 9786961bp site on chromosome 18, a C>T single base mutation (g.9786961C>T) occurs at the site, the mutation site can improve the camel milk fat rate, and the marker can be used for carrying out molecular marker assisted selection on the bactrian camel milk fat rate trait.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to the Bactrian camel milk fat percentage-related gene CARD11 and its application as a molecular marker. Background Technology

[0002] Bactrian camel milk is highly valued for its rich nutritional content, high insulin content, and easy digestibility, making it popular in both domestic and international markets. However, my country's Bactrian camel breed is primitive and has not undergone targeted breeding for dairy production. The average milk yield is low, around 1 kg per camel per day, although some individual camels can produce over 6 kg per day, indicating significant individual variation and substantial potential for improved milk production through selective breeding. However, research on genes related to milk production traits in Bactrian camels is limited, and technologies using modern biomolecular markers to assist in breeding and improve milk production performance have not yet been reported. Current research on milk-producing traits at the molecular level focuses primarily on cattle and sheep, while research on Bactrian camel milk production performance mainly concentrates on the collection and processing of phenotypic data and the analysis of early lactation patterns and characteristics. Therefore, further in-depth research at the molecular genetic level into the mechanisms and regulation of Bactrian camel lactation is urgently needed and is one of the main ways to accelerate the improvement of Bactrian camel milk production performance. Bactrian camels are a unique livestock resource in Inner Mongolia. Their role as draft animals has significantly diminished, and production is shifting from traditional, single-species methods to specialized and commercialized production. The rise of the camel product industry signifies the gradual decline of traditional camel farming. Camel products mainly include camel milk, camel meat, camel hide, and camel bones. Camel milk is a crucial component, highly sought after by consumers due to its health benefits, and in high demand. Milk fat percentage, the percentage of fat in milk, is a key indicator for assessing milk quality and dairy animal productivity. Therefore, increasing milk production directly impacts the development of the camel milk industry, significantly contributing to increased income for farmers and herders in pastoral areas and maintaining social stability. Traditional breeding methods primarily utilize phenotypic and pedigree information for hybridization and selection. However, for traits with low heritability and complex measurement requirements, these methods are costly, time-consuming, and involve complex breeding processes. With the rapid development of high-throughput sequencing technology, bioinformatics, and statistical methods, genome-wide association study (GWAS) has become the main means of discovering and identifying major genes for important traits in poultry and livestock. Summary of the Invention

[0003] Given the current lack of in-depth research on the mechanism and regulation of Bactrian camel lactation at the molecular genetic level in existing technologies, this invention provides a gene CARD11 related to milk production traits in Bactrian camels and its application as a molecular marker.

[0004] This invention applies selected molecular markers to screen Bactrian camels with high / low milk fat percentages, providing technical support for breeding Bactrian camel breeds with superior traits.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] This invention first provides the application of CARD11, a gene associated with milk production in Bactrian camels, as a molecular genetic marker associated with milk production in Bactrian camels.

[0007] Furthermore, the milk production trait specifically refers to the fat content of Bactrian camel milk.

[0008] Furthermore, a SNP molecular marker related to the milk fat percentage of Bactrian camels is provided, located at nucleic acid site 9786961 on chromosome 18 of Bactrian camels, with the bases at this site being C or T, contained within an intron of the CARD11 gene, wherein the nucleotide sequence of the CARD11 gene is shown in SEQ ID NO.1.

[0009] The present invention further provides a method for selecting or assisting in the selection of Bactrian camel lactation-related breeds or strains using the SNP molecular marker, specifically for selecting or assisting in the selection of Bactrian camels with high / low milk fat content.

[0010] Furthermore, the detailed steps for selecting or assisting in the breeding of Bactrian camels with high / low milk fat percentage based on the SNP molecular markers are as follows: collect tissue or blood samples from Bactrian camels, extract genomic DNA from Bactrian camels, detect whether the sequence of nucleotide 9786961 on chromosome 18 of Bactrian camels is C or T, determine whether the genotype of the Bactrian camel to be tested is CC, CT or TT, and select Bactrian camels with TT or CC genotypes for the next step of selection and / or breeding as needed.

[0011] To further clarify, the milk fat percentage of the TT genotype Bactrian camel is higher than that of the CT genotype Bactrian camel, while the milk fat percentage of the CT genotype Bactrian camel is higher than that of the CC genotype Bactrian camel.

[0012] This invention also provides a method for identifying the SNP molecular markers described above, the specific steps of which are as follows:

[0013] 1) Record milk production traits:

[0014] Milk production traits of Bactrian camels were collected and recorded, including milk fat percentage and its influencing factors, such as herd, year, parity, age, feeding method, and sampling date.

[0015] 2) Obtain Bactrian camel samples:

[0016] Tissue samples from the ear of a Bactrian camel were collected in centrifuge tubes, submerged in anhydrous ethanol, sealed, numbered, and stored at -80°C for later use.

[0017] 3) Genomic DNA extraction:

[0018] Following the instructions of the animal tissue DNA extraction kit, camel genomic DNA samples were extracted. The concentration and quality of the DNA samples were detected using NanoDrop 2000, and the integrity of the DNA was detected by agarose gel electrophoresis.

[0019] 4) Genome resequencing:

[0020] Sequencing libraries were prepared using Illumina's standard library preparation process, and Bactrian camel genome resequencing was performed using the Hiseq sequencing platform at a sequencing depth of 4x.

[0021] 5) Detection of variant sites:

[0022] The raw library data obtained by PLINK software was filtered to reduce the impact of base errors on the results. The filtering criteria were as follows: (1) Remove sequences with adapters; (2) Remove sequences whose base information cannot be determined; (3) If a single-end sequence contains a quality of less than 5, the sequence pair needs to be removed; (4) Only retain paired-end sequences.

[0023] 6) Genome-wide association analysis:

[0024] The SNPs in the variation were filtered according to the population variation distribution using Vcftools software. The filtering thresholds included: (1) the number of minor alleles was greater than 3; (2) the SNP deletion rate was greater than 5%; (3) the SNP quality was greater than 30; (4) the minimum sequencing depth was 5; and (5) the minimum allele frequency was less than 0.05. Finally, the filtered SNPs were used for genome-wide association analysis. The rMVP software was used to perform genome-wide association analysis using the general linear model (GLM), the mixed linear model (MLM), and the unified method of fixed and randomized cyclic probability (FarmCPU) to identify key candidate genes and loci affecting milk production traits.

[0025] Furthermore, in step 5), the specific method for detecting variant sites is as follows:

[0026] The genome sequence was aligned to the camel reference genome (BCGSAC_Cfer_1.0 assembly) using BWA-mem software, and the alignment results were sorted and indexed using Samtools software. Then, downstream analysis was performed using GATK software: first, GATK MarkDuplicates was used to remove sequence duplications caused by PCR; then, GATK HaplotypeCaller was used to search for variants across the entire genome; finally, GATK VariantFiltration was used for hard filtering of variant sites. Specifically, the thresholds for SNP filtering were set to "QD<2.0, MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0", and the thresholds for INDEL filtering were set to "QD<2.0, FS>200.0, SOR>10.0, MQRankSum<-12.5, ReadPosRankSum<-8.0".

[0027] The present invention further provides a method for breeding Bactrian camels, comprising the following steps:

[0028] The genotype of the tested Bactrian camels was detected based on SNP molecular markers. Bactrian camels were bred according to the genotype. The sequence of nucleotide 9786961 on chromosome 18 of the Bactrian camel was C or T. The genotype of the Bactrian camel to be tested was determined to be CC, CT or TT. The milk fat percentage of the TT genotype Bactrian camel was higher than that of the CT genotype Bactrian camel, and the milk fat percentage of the CT genotype Bactrian camel was higher than that of the CC genotype Bactrian camel.

[0029] This invention discloses the gene CARD11, which is associated with milk production traits in Bactrian camels, and a breeding method and application using its single nucleotide polymorphism (SNP) site as a molecular marker for assisted selection. This invention is the first to discover a locus in the CARD11 gene that is associated with high / low milk fat percentage in Bactrian camels, providing a candidate gene for breeding Bactrian camel breeds with superior traits and improving camel milk quality.

[0030] Specifically, this invention utilizes next-generation sequencing technology to resequently sequence the genomes of 162 Bactrian camels. Through genome-wide association analysis with camel milk fat percentage, a molecular marker in the CARD11 gene associated with Bactrian camel milk fat percentage was identified. This marker is located at a 9786961 bp site on chromosome 18, exhibiting a C>T single-base mutation (g.9786961C>T). This mutation site can increase the milk fat percentage of camel milk, and this marker can be used to conduct marker-assisted selection for the camel milk fat percentage trait in Bactrian camels.

[0031] The nucleotide sequence of the CARD11 gene is shown in SEQ ID NO.1.

[0032] The specific information for the 9786961bp site on chromosome 18 is as follows:

[0033] >18:9786861-9787061

[0034] CAGGGCAGGAGGAGGGGCCGCCCCCACCCTGAGCATCGGTCCTGCAGG

[0035] AGCAGACGCGCCTGCCCGGGCC

[0036] CCTTCTCGTCAGGTGGCGCCTCTCCTGCAGCGGGGGTCACTAGGCAGTG

[0037] AGTCTGTCGGGGACACCCTGC

[0038] AGGGGATTCCCGCTTCACATACAAGGCTGGACTGGACGAAATTTCCTTCTGGCTCTAAGAG.

[0039] Compared with the prior art, the beneficial effects of the present invention are:

[0040] This invention is the first to discover a locus in the CARD11 gene associated with milk fat percentage in Bactrian camels, providing an effective candidate gene for breeding Bactrian camel breeds with superior traits. Simultaneously, this invention uses marker-trait association analysis to identify a SNP (g.9786961C>T) in the CARD11 gene that is significantly associated with milk fat percentage in Bactrian camels. This locus can be applied to association analyses related to milk production traits in Bactrian camels, providing a new genetic marker resource for marker-assisted selection of high / low milk fat percentage in Bactrian camels. In short, this invention employs a genome-wide association analysis method to screen and identify milk production-related genes in Bactrian camels. For the identified candidate genes, this invention further uses a candidate gene method strategy to determine whether there are loci in the studied genes associated with milk production traits in Bactrian camels, thereby further verifying the relationship between candidate genes and lactation performance. Furthermore, the SNP loci identified through the candidate gene method that are associated with milk production traits can serve as molecular markers for breeding superior traits in Bactrian camels, contributing to the genetic progress of milk production performance in Bactrian camels. This invention features simple operation, short processing time, and high accuracy of the selected markers, and also provides technical support for the genetic analysis of other important economic traits of livestock and poultry. Attached Figure Description

[0041] Figure 1 Genome-wide association analysis identified the CARD11 gene and SNP sites associated with the fat percentage of Bactrian camels. Detailed Implementation

[0042] This invention provides the application of the Bactrian camel milk production trait gene CARD11 as a molecular genetic marker associated with the milk production trait in Bactrian camels. Specifically, the milk production trait refers to the milk fat percentage of Bactrian camels. The SNP molecular marker associated with the milk fat percentage of Bactrian camels is located at nucleic acid locus 9786961 on chromosome 18 of the Bactrian camel, with a base of C or T, and is contained within an intron of the CARD11 gene. The nucleotide sequence of the CARD11 gene is shown in SEQ ID NO.1.

[0043] This invention also provides a method for selecting or assisting in the breeding of Bactrian camel lactation-related breeds or strains based on the aforementioned SNP molecular markers, specifically for selecting or assisting in the breeding of Bactrian camels with high / low milk fat percentages. The detailed steps for selecting or assisting in the breeding of Bactrian camels with high / low milk fat percentages based on the aforementioned SNP molecular markers are as follows: collecting tissue or blood samples from Bactrian camels, extracting genomic DNA from Bactrian camels, detecting whether the sequence of nucleotides 9786961 on chromosome 18 of the Bactrian camel is C or T, determining whether the genotype of the Bactrian camel to be tested is CC, CT, or TT, and selecting Bactrian camels with TT or CC genotypes for further selection and / or breeding as needed. The milk fat percentage of TT genotype Bactrian camels is higher than that of CT genotype Bactrian camels, and the milk fat percentage of CT genotype Bactrian camels is higher than that of CC genotype Bactrian camels.

[0044] This invention also provides a method for identifying the SNP molecular markers described above, the specific steps of which are as follows:

[0045] 1) Record milk production traits:

[0046] Milk production traits of Bactrian camels were collected and recorded, including milk fat percentage and its influencing factors, such as herd, year, parity, age, feeding method, and sampling date.

[0047] 2) Obtain Bactrian camel samples:

[0048] Tissue samples from the ear of a Bactrian camel were collected in centrifuge tubes, submerged in anhydrous ethanol, sealed, numbered, and stored at -80°C for later use.

[0049] 3) Genomic DNA extraction:

[0050] Following the instructions of the animal tissue DNA extraction kit, camel genomic DNA samples were extracted. The concentration and quality of the DNA samples were detected using NanoDrop 2000, and the integrity of the DNA was detected by agarose gel electrophoresis.

[0051] 4) Genome resequencing:

[0052] Sequencing libraries were prepared using Illumina's standard library preparation process, and Bactrian camel genome resequencing was performed using the Hiseq sequencing platform at a sequencing depth of 4x.

[0053] 5) Detection of variant sites:

[0054] The raw library data obtained was filtered using PLINK software to reduce the impact of base errors on the results. The filtering criteria were as follows: (1) Remove sequences with adapters; (2) Remove sequences whose base information could not be determined; (3) If a single-end sequence contains a quality of less than 5, the sequence pair needs to be removed; (4) Only retain paired-end sequences. The specific method was as follows: The genome sequence was aligned to the camel reference genome (BCGSAC_Cfer_1.0 assembly) using BWA-mem software, and the alignment results were sorted and indexed using Samtools software. Then, downstream analysis was performed using GATK software: First, GATKMarkDuplicates was used to remove sequence duplications caused by PCR; then, GATK HaplotypeCaller was used to search for variations across the entire genome; finally, GATK was used. VariantFiltration performs hard filtering on variant sites; the threshold for SNP filtering is set to "QD<2.0, MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0", and the threshold for INDEL filtering is set to "QD<2.0, FS>200.0, SOR>10.0, MQRankSum<-12.5, ReadPosRankSum<-8.0".

[0055] 6) Genome-wide association analysis:

[0056] The SNPs in the variation were filtered according to the population variation distribution using Vcftools software. The filtering thresholds included: (1) the number of minor alleles was greater than 3; (2) the SNP deletion rate was greater than 5%; (3) the SNP quality was greater than 30; (4) the minimum sequencing depth was 5; and (5) the minimum allele frequency was less than 0.05. Finally, the filtered SNPs were used for genome-wide association analysis. The rMVP software was used to perform genome-wide association analysis using the general linear model (GLM), the mixed linear model (MLM), and the unified method of fixed and randomized cyclic probability (FarmCPU) to identify key candidate genes and loci affecting milk production traits.

[0057] The present invention further provides a method for breeding Bactrian camels, comprising the following steps: detecting the genotype of the tested Bactrian camels based on SNP molecular markers, breeding Bactrian camels according to the genotype, wherein the sequence of nucleotide 9786961 on chromosome 18 of the Bactrian camel is C or T, determining that the genotype of the tested Bactrian camel is CC, CT or TT, wherein the milk fat percentage of the TT genotype Bactrian camel is higher than that of the CT genotype Bactrian camel, and the milk fat percentage of the CT genotype Bactrian camel is higher than that of the CC genotype Bactrian camel.

[0058] This invention discloses the gene CARD11, which is associated with milk production traits in Bactrian camels, and a breeding method and application using its single nucleotide polymorphism (SNP) site as a molecular marker for assisted selection. This invention is the first to discover a locus in the CARD11 gene that is associated with high / low milk fat percentage in Bactrian camels, providing a candidate gene for breeding Bactrian camel breeds with superior traits and improving camel milk quality.

[0059] The nucleotide sequence of the CARD11 gene is shown in SEQ ID NO.1.

[0060] The specific information for the 9786961bp site on chromosome 18 is as follows:

[0061] >18:9786861-9787061

[0062] CAGGGCAGGAGGAGGGGCCGCCCCCACCCTGAGCATCGGTCCTGCAGG

[0063] AGCAGACGCGCCTGCCCGGGCC

[0064] CCTTCTCGTCAGGTGGCGCCTCTCCTGCAGCGGGGGTCACTAGGCAGTG

[0065] AGTCTGTCGGGGACACCCTGC

[0066] AGGGGATTCCCGCTTCACATACAAGGCTGGACTGGACGAAATTTCCTTCTGGCTCTAAGAG.

[0067] Genome-wide association analysis identified CARD11 genes and SNPs associated with the fat percentage of Bactrian camels, such as... Figure 1 As shown.

[0068] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0069] Example

[0070] Bactrian camel 162 with detailed milk production records was selected, and the milk fat percentage data are shown in Table 1. 30–50 mg of ear tissue from the corresponding Bactrian camel was collected in 5 mL centrifuge tubes. The samples were submerged in anhydrous ethanol, sealed, numbered, and stored at -80°C for later use.

[0071] Table 1. Milk fat percentage of 162 Bactrian camels

[0072]

[0073]

[0074]

[0075] Cut approximately 30 mg of Bactrian camel ear tissue into a centrifuge tube, add 1 ml of PBS to wash and remove most of the ethanol. Transfer the tissue to a new centrifuge tube and mince it as finely as possible. Add 200 μl of proteinase K to the centrifuge tube, invert to mix, and incubate at 56°C in a shaking water bath or metal bath until the tissue is completely dissolved (approximately 6 hours). Extract camel genomic DNA samples according to the instructions of the animal tissue sample DNA extraction kit. Detect the concentration and quality of the DNA samples using a NanoDrop 2000 spectrophotometer. Assess the integrity of the DNA using agarose gel electrophoresis.

[0076] For genomic DNA samples that passed quality control, sequencing libraries were prepared using Illumina's standard library preparation process, and Bactrian camel genome resequencing was performed using the Hiseq sequencing platform at a sequencing depth of 4x.

[0077] The raw sequencing data was processed using the method described in this patent. First, PLINK software was used for filtering. Then, BWA-mem software was used to align the genome sequence to the camel reference genome. Next, Samtools software was used to sort and index the alignment results, and GATK software was used for hard filtering of variant sites. Further, Vcftools software was used to filter SNPs in the variants based on the population variation distribution. After quality control, 3,102,334 SNP variant sites were finally obtained and can be used for genome-wide association analysis of the milk fat percentage trait.

[0078] Genome-wide association studies (GWAs) were performed using rMVP software, employing general linear modeling (GLM), mixed linear modeling (MLM), and the unified cycle probability method (FarmCPU) for fixed and randomized models. Nine significant SNPs associated with Bactrian camel milk fat percentage were screened and identified, with a significance level of P < 1.61 × 10⁻⁶. -8The gene location of the significant site was determined. The g.9786961C>T variant was located within the CARD11 gene, and the corresponding p-value was 2.35 × 10⁻⁶ using the FarmCPU model. -13 .

[0079] Finally, a comparative analysis was conducted on the genotypes corresponding to the target locus g.9786961C>T and the milk fat percentage of Bactrian camels: 118 Bactrian camels were identified with the TT genotype, with a milk fat percentage of 7.05±0.43%; 35 Bactrian camels were identified with the CT genotype, with a milk fat percentage of 5.36±0.22%; and 9 Bactrian camels were identified with the CC genotype, with a milk fat percentage of 4.73±0.12%. The milk fat percentage of Bactrian camels from the TT genotype was higher than that of the CT and CC genotypes. Therefore, g.9786961C>T was identified as a variant locus that can increase the milk fat percentage of camel milk. In production practice, Bactrian camels with the CC genotype can be selected for further breeding or selection to improve the milk fat percentage of camel milk.

[0080] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. The use of a reagent for detecting a SNP molecular marker associated with the fat percentage trait of Bactrian camels in the preparation of a kit for selecting or assisting in the selection of Bactrian camels with high fat percentage, characterized in that: The SNP molecular marker is a SNP variation site g.9786961 C>T of a CARD11 gene, a reference genome of a Bactrian camel is BCGSAC_Cfer_1.0, and a nucleotide sequence of the CARD11 gene is shown as SEQ ID NO. 1; wherein the milk fat rate of the Bactrian camel with the TT genotype is higher than that of the Bactrian camel with the CT genotype, and the milk fat rate of the Bactrian camel with the CT genotype is higher than that of the Bactrian camel with the CC genotype.

2. The application of a reagent for detecting a SNP molecular marker associated with the fat percentage trait of Bactrian camels in the selection or assisted selection of Bactrian camel breeds with high fat percentage, characterized in that: The SNP molecular marker is a SNP variation site g.9786961 C>T of a CARD11 gene, a reference genome of a Bactrian camel is BCGSAC_Cfer_1.0, and a nucleotide sequence of the CARD11 gene is shown as SEQ ID NO. 1; wherein the milk fat rate of the Bactrian camel with the TT genotype is higher than that of the Bactrian camel with the CT genotype, and the milk fat rate of the Bactrian camel with the CT genotype is higher than that of the Bactrian camel with the CC genotype.

Images