Methods for identifying Tieguanyin, Benshan and Fuyun No. 6 tea varieties and SNP molecular marker combinations and their applications

Abstract

The present invention relates to the technical field of molecular identification, and in particular to a method for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, a SNP molecular marker combination and an application thereof. The method comprises the following steps: amplifying a sample to be tested by PCR; if the SEQ ID NO.1 sequence and the SEQ ID NO.2 sequence are not amplified, and the SEQ ID NO.3 sequence is successfully amplified, the sample to be tested is determined to be the Tieguanyin tea tree variety; if the SEQ ID NO.1 sequence, the SEQ ID NO.2 sequence and the SEQ ID NO.3 sequence are all not amplified, the sample to be tested is determined to be the Benshan tea tree variety; if the SEQ ID NO.1 sequence, the SEQ ID NO.2 sequence and the SEQ ID NO.3 sequence are all successfully amplified, the sample to be tested is determined to be the Fuyun No. 6 tea tree variety. The beneficial effect of the present invention is that PCR amplification is performed on the sample to be tested by using 3 pairs of primers to directly obtain the identification result, without relying on the morphological identification experience of the relevant identification personnel, the detection accuracy is high, the repeatability is high, and the identification time is short.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular identification, and in particular to a method for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, and a SNP molecular marker combination and application thereof. Background Art

[0002] Tea tree varieties are one of the main factors affecting the flavor quality of tea products. Oolong tea products are mostly named after their raw material varieties. For example, Tieguanyin is both a variety name and a product name. Tieguanyin originated in Anxi County, Quanzhou City, Fujian Province. As one of the top ten famous teas in China, the possibility of adulteration of Anxi Tieguanyin is relatively high. Among them, Benshan and Fuyun No. 6 are the main tea tree varieties from which the finished Tieguanyin tea is adulterated. Due to the unique wrapping and rolling processing technology, Minnan Oolong tea has a unique granular appearance. Since the finished tea dry tea using the Minnan Oolong tea processing technology has a similar appearance, it is difficult to judge the source of the raw material tea tree variety of Minnan Oolong tea by appearance. It is necessary to rely on professional tea appraisers to conduct sensory evaluation of the appearance, taste, and leaf bottom of Minnan Oolong tea. Therefore, it is necessary to develop an efficient, stable, and low-cost detection technology to assist market supervision and protect the national geographical indication product Anxi Tieguanyin. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a rapid, accurate and high-throughput method for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties and a SNP molecular marker combination and application thereof.

[0004] In order to solve the above problems, the technical solution adopted by the present invention is: to provide a SNP molecular marker combination for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, and the base sequences of the SNP molecular marker combination are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively.

[0005] tagtttttca aagtaaatgt tggggttcca actgaagctg attgttgttg atgatgggtattttagtaga agctttagga ttttgtcttc ttcaatacca tatattgtgt tctgtcagag g(SEQ IDNO.1);

[0006] aagggatcga tgaagcttat agtggacagg tcaggtcgtg ttgaagtcac tgagcctgctaatttctctg tgaaagaaaa taacaatttg tccctgatcg agtttgaacg tgtggacgtc g(SEQ IDNO.2);

[0007] ggaacttttc ctctgtgtga tggaagccat gtgaagcaca ataaagctaa tggagataacgttggacctt tgcttgtgaa gaagcaatag ctataatagt gttgttctta tgttgtttac tgttggacctttgcttgtga agaagcaata gctataatag tgttgttctt atgttgttta ct (SEQ ID NO. 3).

[0008] Another technical solution adopted by the present invention is: a method for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, comprising the following steps:

[0009] Amplify the sequences of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 of the sample to be tested by PCR;

[0010] If the SEQ ID NO.1 sequence and the SEQ ID NO.2 sequence are not amplified, and the SEQ ID NO.3 sequence is successfully amplified, then the sample to be tested is determined to be the Tieguanyin tea tree variety;

[0011] If the sequence of SEQ ID NO.1, the sequence of SEQ ID NO.2 and the sequence of SEQ ID NO.3 are not amplified, it is determined that the sample to be tested is the Camellia sinensis variety;

[0012] If the SEQ ID NO.1 sequence, the SEQ ID NO.2 sequence and the SEQ ID NO.3 sequence are all successfully amplified, then the sample to be tested is determined to be the Fuyun No. 6 tea tree variety.

[0013] Furthermore, in the above-mentioned identification of Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, the PCR amplification primer sequences corresponding to the SEQ ID NO.1 sequence are: SEQ ID NO.4 and SEQ ID NO.5, the PCR amplification primer sequences corresponding to the SEQ ID NO.2 sequence are: SEQ ID NO.6 and SEQ ID NO.7, and the PCR amplification primer sequences corresponding to the SEQ ID NO.3 sequence are: SEQ ID NO.8 and SEQ ID NO.9.

[0014] Furthermore, in the above-mentioned identification of Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, the samples to be tested are selected from tea tree plants or finished tea products of Tieguanyin, Benshan and Fuyun No. 6.

[0015] Furthermore, in the above-mentioned identification of Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, before the PCR amplification of the test sample, the genomic DNA of the test sample was extracted using the CTAB method.

[0016] Furthermore, in the above-mentioned identification of Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, the reaction conditions of PCR amplification are: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 45 seconds, extension at 72°C for 15 seconds, for a total of 30 cycles; extension at 72°C for 4 minutes; and insulation at 4°C.

[0017] Another technical solution adopted by the present invention is: to provide an application of a SNP molecular marker combination in identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, wherein the base sequences of the SNP molecular marker combination are respectively as shown in SEQ ID NO.1, SEQID NO.2 and SEQ ID NO.3.

[0018] The beneficial effects of the present invention are as follows: compared with traditional morphological identification methods and DNA fingerprint markers, the method for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties and the SNP molecular marker combination and application thereof of the present invention use three pairs of primers to perform PCR amplification on the test samples to directly obtain the identification results without relying on the morphological identification experience of relevant identification personnel, and the detection accuracy is high, the repeatability is high, and the identification time is short. DETAILED DESCRIPTION

[0019] In order to explain the technical content, achieved objectives and effects of the present invention in detail, the following is an explanation in conjunction with the implementation modes.

[0020] Example 1

[0021] A combination of three SNP molecular markers for identifying Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, wherein the three SNP molecular markers are three rDNA sequences;

[0022] The SNP molecular marker combination includes SNPTGY261, SNPTGY11 and SNPTGY3, among which:

[0023] The SNP molecular marker SNPTGY261 is located at the 60th position of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is A or G, wherein the base of the 60th nucleotide molecule in SEQ ID NO.1 is A;

[0024] The SNP molecular marker SNPTGY11 is located at the 60th position of the nucleotide sequence shown in SEQ ID NO.2, and the polymorphism is A or T, wherein the base of the 60th nucleotide molecule in SEQ ID NO.2 is T;

[0025] The SNP molecular marker SNPTGY3 is located at the 60th position of the nucleotide sequence shown in SEQ ID NO.3, and the polymorphism is T or C, wherein the base of the 60th nucleotide molecule in SEQ ID NO.3 is C.

[0026] The SNP molecular marker site SNPTGY261 of the tea tree variety is located at the CSS0008078 gene of the tea tree genome chromosome Chr4;

[0027] The SNP molecular marker site SNPTGY11 of the tea tree variety is located at the CSS0038541 gene of the tea tree genome chromosome Chr6;

[0028] The SNP molecular marker site SNPTGY3 of the tea tree variety is located at the CSS0025032 gene of the tea tree genome chromosome Chr7.

[0029] The information of the three SNP molecular markers is shown in Table 1, and the polymorphism information of the three SNP molecular markers of Tieguanyin, Benshan and Fuyun No. 6 tea varieties is shown in Table 2.

[0030] Table 1

[0031]

[0032] Table 2

[0033] Tea tree varieties SNPTGY261 SNPTGY11 SNPTGY3 Tieguanyin G:G A:A T:C Motoyama G:G A:A T:T Fuyun No. 6 A:G A:T T:C

[0034] The PCR amplification primer sequences of the above SEQ ID NO.1 sequence may be: SEQ ID NO.4 and SEQ ID NO.5; the PCR amplification primer sequences of the above SEQ ID NO.2 sequence may be: SEQ ID NO.6 and SEQ ID NO.7; the PCR amplification primer sequences of the above SEQ ID NO.3 sequence may be: SEQ ID NO.8 and SEQ ID NO.9.

[0035] One sample each of buds and shoots of Tieguanyin, Benshan and Fuyun No. 6 tea plants were collected from the tea germplasm resource nursery of Fujian Agriculture and Forestry University, and five samples of finished tea labeled "Tieguanyin" purchased from an online platform were collected.

[0036] The genomic DNA of the above samples was extracted by the CTAB method, and SEQ ID NO.1 was amplified using SNPTYG261aF primer and SNPTYG261R primer, SEQ ID NO.2 was amplified using SNPTYG11tF primer and SNPTYG11R primer, and SEQ ID NO.3 was amplified using SNPTYG3cF primer and SNPTYG3R primer. PCR amplification used 2×Taq PCR Master Mix (TIANGEN, Beijing, China).

[0037] SNPTYG261aF: 5'-GAAGAAGACAAAATCCTAAAGCTTCTACTA AAAT-3' (SEQ ID NO. 4);

[0038] SNPTYG261R: 5'-TGGGGTTCCAACTGAAGCTGA-3' (SEQ ID NO.5);

[0039] SNPTYG11tF: 5'-TTGAAGTCACTGAGCCTGCT-3' (SEQ ID NO. 6);

[0040] SNPTYG11R: 5'-CGATCAGGGACAAATTGTTATTTTCTTTCACA-3' (SEQ ID NO. 7);

[0041] SNPTYG3cF: 5'-CTTCACAAGCAAAGGTCCAACG-3' (SEQ ID NO. 8);

[0042] SNPTYG3R: 5'-GATGGAAGCCATGTGAAGCACA-3' (SEQ ID NO. 9).

[0043] The three PCR amplification systems were: 2×PCR Mix, 10 μL; 10 μM concentration of upstream primer, 1 μL; 10 μM concentration of downstream primer, 1 μL; sample DNA, 1 μL; supplemented with sterile water to 20 μL.

[0044] The three PCR amplification conditions were as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s, 60°C annealing for 45 s, 72°C extension for 15 s, for a total of 30 cycles; 72°C extension for 4 min; 4°C insulation. 1% agarose gel electrophoresis was used to determine whether the amplification was successful.

[0045] The PCR amplification primer sequences corresponding to the polymorphism A of the SEQ ID NO.1 are: SEQ ID NO.4 and SEQ ID NO.5;

[0046] The PCR amplification primer sequences corresponding to the polymorphism T of the SEQ ID NO.2 are: SEQ ID NO.6 and SEQ ID NO.7;

[0047] The PCR amplification primer sequences corresponding to the sequence polymorphism C of SEQ ID NO.3 are: SEQ ID NO.8 and SEQ ID NO.9.

[0048] As shown in Table 3, if the SEQ ID NO.1 sequence and the SEQ ID NO.2 sequence are not amplified, and the SEQ ID NO.3 sequence is successfully amplified, then the sample to be tested is determined to be the Tieguanyin tea tree variety;

[0049] If the sequence of SEQ ID NO.1, the sequence of SEQ ID NO.2 and the sequence of SEQ ID NO.3 are not amplified, it is determined that the sample to be tested is the Camellia sinensis variety;

[0050] If the SEQ ID NO.1 sequence, the SEQ ID NO.2 sequence and the SEQ ID NO.3 sequence are all successfully amplified, then the sample to be tested is determined to be the Fuyun No. 6 tea tree variety.

[0051] Table 3

[0052] Tea tree varieties SEQ ID NO.1 SEQ ID NO.2 SEQ ID NO.3 Tieguanyin 0 0 1 Motoyama 0 0 0 Fuyun No. 6 1 1 1

[0053] Note: Successful amplification is 1, and unsuccessful amplification is 0.

[0054] Table 4 shows the PCR amplification results of the Tieguanyin tea tree sample, Benshan tea tree sample, Fuyun No. 6 tea tree sample and 5 finished tea products in this embodiment. The tea tree varieties of the 8 samples can be determined as follows: sample 1 is Tieguanyin, sample 2 is Benshan, sample 3 is Fuyun No. 6, sample 4 is Fuyun No. 6, sample 5 is Benshan, sample 6 is Benshan, sample 7 is Tieguanyin, and sample 8 is Tieguanyin.

[0055] Table 4

[0056] Sample No. Sample source SEQ ID NO.1 SEQ ID NO.2 SEQ ID NO.3 1 Tieguanyin Tea Tree 0 0 1 2 Camellia sinensis 0 0 0 3 Fuyun No. 6 Tea Tree 1 1 1 4 Finished tea 1 1 1 1 5 Finished tea 2 0 0 0 6 Finished tea 3 0 0 0 7 Finished tea 4 0 0 1 8 Finished tea 5 0 0 1

[0057] Note: Successful amplification is 1, and unsuccessful amplification is 0.

[0058] Compared with traditional morphological identification methods and DNA fingerprint markers, the method of the present invention uses three SNP molecular markers to identify Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, uses three pairs of primers to perform PCR amplification on the sample genomic DNA, and directly obtains the identification results without relying on the morphological identification experience of relevant identification personnel. The detection accuracy is high, the repeatability is high, and the identification time is short.

[0059] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent transformations made using the contents of the present invention specification, or directly or indirectly applied in related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A SNP molecular marker combination, characterized in that: Used to distinguish Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties, the base sequences of the SNP molecular marker combination are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively.

2. A method for distinguishing Tieguanyin, Benshan and Fuyun No. 6 tea varieties, characterized in that: The following steps are involved: Amplify the sequences of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 of the sample to be tested by PCR; If the SEQ ID NO.1 sequence and the SEQ ID NO.2 sequence are not amplified, and the SEQ ID NO.3 sequence is successfully amplified, the sample to be tested is determined to be the Tieguanyin tea tree variety; if the SEQ ID NO.1 sequence, the SEQ ID NO.2 sequence and the SEQ ID NO.3 sequence are all not amplified, the sample to be tested is determined to be the Benshan tea tree variety; if the SEQ ID NO.1 sequence, the SEQ ID NO.2 sequence and the SEQ ID NO.3 sequence are all successfully amplified, the sample to be tested is determined to be the Fuyun No. 6 tea tree variety.

3. The method for distinguishing Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties according to claim 2, characterized in that: The PCR amplification primer sequences corresponding to the SEQ ID NO.1 sequence are: SEQ ID NO.4 and SEQ ID NO.5, the PCR amplification primer sequences corresponding to the SEQ ID NO.2 sequence are: SEQ ID NO.6 and SEQ ID NO.7, and the PCR amplification primer sequences corresponding to the SEQ ID NO.3 sequence are: SEQ ID NO.8 and SEQ ID NO.

9.

4. The method for distinguishing Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties according to claim 2, characterized in that: The samples to be tested are selected from tea plants or finished tea products of Tieguanyin, Benshan and Fuyun No.

6.

5. The method for distinguishing Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties according to claim 4, characterized in that: Before the PCR amplification of the sample to be tested, the genomic DNA of the sample to be tested is extracted by the CTAB method.

6. The method for distinguishing Tieguanyin, Benshan and Fuyun No. 6 tea tree varieties according to claim 2, characterized in that: The reaction conditions of the PCR amplification were as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 45 s, and extension at 72°C for 15 s, for a total of 30 cycles; extension at 72°C for 4 min; and insulation at 4°C.

Images