A crop genetic intelligent breeding and seed production system based on a gms2 gene and application thereof

Abstract

The present application relates to a kind of crop genetic intelligent breeding system based on GMS2 gene and its application.The genetic intelligent breeding system provided by the present application includes six functional element expression boxes: plant male fertility restoration gene element expression box;Plant pollen abortion gene element expression box K 5400 And K hv Both are used to remove GAT-containing pollen and maintain the heterozygous state or hemizygous state of GAT maintainer line;Chemical herbicide positive selection expression box for gene transformation and GAT maintainer line impurity purification;Chemical herbicide negative selection expression box for removing herbicide-sensitive GAT maintainer line pollen and seed escape and GAT sterile line impurity purification;Seed screening element expression box.The present application can be used for hybrid breeding and hybrid seed production of plant recessive nuclear male sterile material, thereby obtaining high-quality, high-yield, widely-adapted and high-resistance plant new varieties and their seeds, which have great economic value.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to an intelligent crop genetic breeding system based on the GMS2 gene and its application. Background Technology

[0002] Heterosis is the phenomenon where hybrid offspring surpass their parents in one or more traits, and it is prevalent in the biological world. Utilizing heterosis in crops is an important means of increasing agricultural production, and the core of the industrialization of heterosis utilization lies in the male sterility of the maternal parent.

[0003] The "three-line method" has been applied to rice since the 1970s. Its main principle is to use sterile lines, maintainer lines, and restorer lines to produce hybrid varieties. The basic process involves self-pollinating the maintainer line to propagate it, crossing the sterile line with the maintainer line to produce another sterile line, and then crossing the restorer line with the sterile line to produce hybrid seeds. However, because the male sterility of the sterile line in the "three-line method" is caused by gene interaction between the cell nucleus and cytoplasm, this method has a limitation: only when the restorer line, whose cell nucleus contains a specific restorer gene, is crossed with the sterile line can the hybrid's fertility be restored, thus producing hybrid rice seeds. Therefore, the "three-line method" has a low germplasm resource utilization rate, and the homogenization of the cytoplasm also poses a potential risk of pests and diseases.

[0004] The principle of the "two-line method" for rice is to use a photoperiod-temperature-sensitive genic male sterile line (PTMS) and a restorer line to produce hybrids. During a specific developmental stage of rice, when the ambient temperature is above 23.5 degrees Celsius, the males of the PTMS remain sterile, allowing for successful hybridization with the restorer line. If the ambient temperature is below 23.5 degrees Celsius, the male fertility of the PTMS recovers, and the rice will self-pollinate. The "two-line method" only requires the PTMS and restorer line, saving on seed production costs. However, because the fertility conversion of the PTMS in the "two-line method" is affected by photoperiod and temperature, this technology carries significant environmental risks during both PTMS propagation and hybrid seed production. Furthermore, the specific temperature requirements greatly limit the production season and geographical area.

[0005] Recessive nuclear male sterility differs from "three-line" and "two-line" hybrids in that its male fertility is controlled by only one pair of recessive nuclear genes, unaffected by light, temperature, or environmental factors. Furthermore, because its genes are recessive mutations, theoretically almost any variety can be used as a restorer line to produce fertile offspring. However, for a long time, its industrial application has been limited by the inability to maintain male sterility in its offspring. Therefore, developing a technology capable of maintaining and propagating recessive nuclear male sterile materials and supporting commercial production is particularly necessary. Summary of the Invention

[0006] The purpose of this invention is to provide an intelligent crop genetic breeding system based on the GMS2 gene and its application. Specifically, this invention uses GAT technology to establish an intelligent crop genetic breeding system based on the GMS2 gene.

[0007] GAT (Genetic Automation Technology) is a novel hybrid seed breeding technology that can successfully utilize recessive nuclear male sterile lines. Its core idea is to use modern biotechnology to construct crop pollen fertility restoration genes, pollen abortion genes, herbicide sensitivity genes, and selection marker genes in a specific order and direction on a GAT vector. Then, it is introduced into recessive nuclear male sterile lines through high-throughput gene transformation technology to obtain a large number of transformation events.

[0008] In existing technologies, multi-gene transformation often encounters problems such as only partial gene transfer, inability of various transgenic elements to function simultaneously, and transgene silencing. Therefore, multi-gene transformation frequently results in transformation events where all genes achieve the desired trait. This invention, through screening of each functional element, obtains an initial maintainer line where all elements function normally, creating a maintainer line for the recessive nuclear male-sterile line. This maintainer line is used for the production of GAT-sterile lines and hybrids, thus successfully achieving the maintenance and propagation of the recessive nuclear male-sterile line, and ultimately realizing its commercial utilization.

[0009] This invention provides a genetically intelligent breeding system for hybrid crop seed production, comprising a GAT sterile line, a GAT maintainer line, and a common restorer line; wherein the GAT sterile line is a recessive nuclear male sterile line, and the GAT maintainer line is a recessive nuclear male sterile maintainer line;

[0010] The GAT retention system contains a single copy of the GAT vector;

[0011] The GAT vector contains a plant male fertility restoration gene element expression cassette and a plant pollen abortion gene element expression cassette K. 5400 Plant pollen abortion gene element expression cassette K hv Gene transformation and maintenance line screening element expression cassette, herbicide sensitive element expression cassette, and seed screening element expression cassette.

[0012] In the genetic intelligent breeding system provided by this invention, the GAT sterile line is a sterile line controlled by a single recessive nuclear gene. When the gene locus is in a recessive homozygous state, it exhibits male sterility; when it is in a heterozygous state or a dominant homozygous state, it exhibits male fertility.

[0013] In the genetically intelligent breeding system provided by this invention, the GAT maintainer line self-pollinates and produces seeds, resulting in a 1:1 separation of the GAT maintainer line and the GAT sterile line. The two types of seeds are separated by a maintainer line selection element, enabling the GAT maintainer line to reproduce itself. The GAT maintainer line pollinates the GAT sterile line, causing the GAT sterile line to produce seeds and maintain the male sterility of its offspring, thereby achieving the reproduction of the recessive male sterile line.

[0014] This invention provides a GAT vector for a GAT genetically intelligent breeding system based on the GMS2 gene. The GAT vector is constructed on a final vector by linking functional element expression cassettes via adapter sequences. The functional element expression cassettes are as follows:

[0015] (1) Plant male fertility restoration gene element expression cassette C 48490 It is used to restore male fertility in the recessive nuclear sterility mutant gms2, and its nucleotide sequence is shown in SEQ ID NO.1;

[0016] gms2 is a mutant of the rice GMS2 gene, characterized by a deletion of the AACAGCTAC base sequence at positions 118–126 of the coding region of the rice GMS2 gene (disclosed in Chinese Patent 202010491100.4). The gms2 mutant was crossed, backcrossed, and self-crossed with a fertile recipient. Molecular markers were used for selection of the gms2 gene and genetic background during this process, ultimately yielding a recessive nuclear male-sterile line carrying the homozygous gms2 gene in the target recipient background.

[0017] (2) Plant pollen abortion gene element expression cassette K 5400 It is used to remove pollen containing GAT and maintain the heterozygous state of the GAT maintainer line, and its nucleotide sequence is shown in SEQ ID NO.2;

[0018] (3) Plant pollen abortion gene element expression cassette K hv It is used to remove pollen containing GAT and maintain the heterozygous state of the GAT maintainer line, and its nucleotide sequence is shown in SEQ ID NO.3;

[0019] (4) Gene transformation and maintainer line screening element expression cassette M ALS It is used for gene transformation and purification of GAT maintainer lines, and its nucleotide sequence is shown in SEQ ID NO.4;

[0020] (5) Herbicide Sensitive Element Expression Cascade M i It is used to remove pollen from herbicide-sensitive GAT retainer lines, to purify GAT sterile lines, and to prevent seed leakage. Its nucleotide sequence is shown in SEQ ID NO.5.

[0021] (6) Seed screening element expression cassette M zfn It is used for mechanical sorting of seeds, and its nucleotide sequence is shown in SEQ ID NO.6.

[0022] In the GAT vector provided by this invention, the plant male fertility restoration gene element expression cassette C 48490 The promoter, the coding region of the male fertility restoration gene, and the terminator are linked together in sequence and can function normally; the male fertility restoration gene is the wild-type gene of GMS2.

[0023] Preferably, the plant male fertility restoration gene element expression cassette C of the present invention 48490 In this expression cassette, the promoter is the 2000 bp sequence upstream of the start codon ATG of the rice GMS2 gene, the coding region is the coding region of the GMS2 gene, and the terminator is the 500 bp sequence downstream of the stop codon TGA of the GMS2 gene. The function of this expression cassette is to restore male fertility in the recessive homozygous mutant gms2 of the GMS2 gene.

[0024] The plant male fertility restoration gene element expression cassette C 48490 The sequence is shown in SEQ ID NO.1.

[0025] In the GAT vector provided by this invention, the plant pollen abortion gene element expression cassette K 5400 or K hv The structure consists of a plant pollen-specific promoter, a signal peptide, a sterility gene coding region, and a terminator linked together in sequence, all functioning normally. Preferred promoters are the maize PG47 promoter, rice PCHF4, PCHF7, PCHF10, PCHF15, PCHF40, or OsPC32 promoter. Preferred sterility genes are the rice α-amylase gene OsAA, the maize α-amylase gene Zm-AA1, the barley α-amylase gene HvAA1, the millet α-amylase gene SiAA, genes encoding cytokinin oxidase, genes encoding cysteine ​​proteases, or genes encoding gibberellin oxidase. The terminator is the maize IN2-1 or NosT terminator.

[0026] Preferably, the plant pollen abortion gene element expression cassette K of the present invention 5400 It consists of the promoter PG47, the OsAA coding region, and the Nos terminator (NosT), as shown in SEQ ID NO.2; or the plant pollen abortion gene element expression cassette K. hv It consists of the promoter OsPC32, the coding region of the barley α-amylase gene HvAA1, and NosT, and its sequence is shown in SEQ ID NO.3. K 5400 or K hvThe function of the element is to cause pollen containing the GAT element to abort, to maintain the heterozygous state of GAT transformants or GAT maintainers, and to prevent GAT element drift.

[0027] In the GAT vector provided by this invention, the gene transformation and maintainer line screening element expression cassette M ALS The promoter, the coding region of the selection marker gene, and the terminator are connected in sequence and can function normally. The preferred promoter is the Actin promoter, the OsUbi promoter, or the 2180bp sequence upstream of the ATG start codon of the OsALS gene. The preferred coding region of the selection marker gene is the OsALSm1, OsALSm2, OsALSm3 sequence, the glyphosate resistance gene EPSPSm sequence, the glyphosate N-acetyltransferase sequence, or the glufosinate resistance gene Bar sequence. The terminator is the OsUbi terminator, the OsUbiT terminator, or the NosT terminator.

[0028] Preferably, the gene transformation and maintainer line selection element expression cassette M consists of OsALSP, OsALSm1, and OsUbiT. ALS The sequence is shown in SEQ ID NO.4. M ALS The function of expression cassettes is to screen for resistance markers during gene transformation and to distinguish between GAT maintainer lines and sterile lines.

[0029] In the GAT vector provided by this invention, the herbicide-sensitive element expression cassette M i It consists of a promoter, a herbicide-sensitive element, and a terminator connected in sequence for normal operation;

[0030] The preferred promoter is the ZmUbi promoter, the herbicide dominant sensitive element is the RNAi structural sequence P450i of the cytochrome P450 gene CYP81A6, and the terminator is either the PinII terminator or the NosT terminator.

[0031] The herbicide-sensitive element expression cassette M provided by this invention i It consists of ZmUbiP, P450i, and NosT, and its sequence is shown in SEQ ID NO.5. M i The function of the element is to prevent GAT element drift, to maintain the GAT line from being mixed with other materials, and to be used for the production of GAT sterile lines.

[0032] In the GAT vector provided by this invention, the seed screening element expression cassette M zfn The promoter, seed coat chromogenic gene, and terminator are linked together in sequence to function normally;

[0033] Preferably, the promoter is the seed-specific promoter ZZ1; the seed coat chromogenic gene is dark red fluorescent protein FP635, red fluorescent protein RFP, or green fluorescent protein GFP; and the terminator is the OS-T28 terminator or the NosT terminator.

[0034] Preferably, the seed screening element expression cassette M zfn It consists of the ZZ1 promoter, FP635, and NosT, and its sequence is shown in SEQ ID NO.6. M zfn The component is used for mechanical sorting of GAT seeds.

[0035] In the GAT vector of the present invention, the adapter sequence multiple cloning site MCSII has the sequence shown in SEQ ID NO.23.

[0036] In the GAT vector provided by the present invention, the final vector is pC0309, the sequence of which is shown in SEQ ID NO.7, or the final vector is pC1300, the sequence of which is shown in SEQ ID NO.8.

[0037] In the GAT carrier provided by this invention, the GAT carrier is pC0309-K hv M ALS M i M zfn C 48490 K 5400 Their nucleotide sequences are shown in SEQ ID NO.9.

[0038] Based on the understanding of those skilled in the art, the above-mentioned intelligent genetic breeding system or the above-mentioned GAT vector can be used in plant hybrid breeding, production of non-transgenic hybrids, large-scale maintenance of recessive nuclear male sterile lines, or large-scale propagation of recessive nuclear male sterile lines.

[0039] In the applications provided by this invention, the plants include rice, corn, wheat, barley, soybean, cotton, rapeseed, sorghum, millet, oats, rye, highland barley, chili pepper, and watermelon.

[0040] This invention provides a method for maintaining the homozygous recessive state of recessive male sterile plants. The method involves introducing the aforementioned GAT vector into a GAT sterile line with a recessive homozygous genotype to create a GAT transformant containing only a single copy of the GAT vector. The genotype of the GAT transformant is recessive homozygous / GAT-. When the GAT transformant is pollinated with the GAT sterile line, the resulting seeds retain a recessive homozygous genotype, thus maintaining the male sterility of the offspring of the GAT sterile line and successfully propagating the GAT sterile line.

[0041] Specifically, ms represents the recessive nuclear male sterility mutant gene, and MS represents the wild-type gene. The GAT element is introduced into GAT-sterile material (genotype ms ms) to create GAT transformants containing only a single copy of the GAT vector (genotype ms ms / GAT-). Because the GAT vector contains a restoration gene element, male fertility can be restored. The pollen and female gametes produced by the GAT transformants are of two types: (ms GAT) and (ms-). The (ms GAT) type pollen will abort because it contains the pollen abortion gene element from the GAT vector; therefore, only the (ms-) type pollen survives. Therefore, when the GAT transformant is pollinated with the GAT-sterile plant, the resulting seeds will still have a recessive homozygous genotype (ms ms), maintaining the male sterility of the offspring of the GAT-sterile plant. Since the GAT-sterile plant and the GAT transformant have the same genetic background except for the GAT element, all genotypes and phenotypes of the GAT-sterile plant obtained by this method remain unchanged.

[0042] This invention provides a method for maintaining the heterozygous state of recessive nuclear male sterile plants. The method involves introducing the aforementioned GAT vector into a GAT sterile line with a recessive homozygous genotype to create a GAT transformant containing only a single copy of the GAT vector. The genotype of this GAT transformant is recessive homozygous / GAT-. The GAT transformant is then self-pollinated to produce two genotypes of seeds: one recessive homozygous / GAT-, which serves as the GAT maintainer line; and the other recessive homozygous / --, which is the GAT sterile plant. According to the laws of inheritance, the two genotypes segregate in a 1:1 ratio, meaning that the GAT locus with the recessive homozygous / GAT- genotype in the self-pollinated offspring of the GAT transformant remains heterozygous.

[0043] This invention provides a method for screening or distinguishing self-pollinated seeds and plants of GAT transformants. The above-mentioned GAT vector is introduced into a GAT sterile line with a recessive homozygous genotype to create a GAT transformant containing only a single copy of the GAT vector. The genotype of the GAT transformant is recessive homozygous / GAT-. The seeds produced by self-pollination of the GAT transformant show a 1:1 segregation.

[0044] 50% of the seeds produced by self-pollination of GAT transformants are seeds and plants containing the GAT vector. Their genotype is recessive homozygous / GAT-, and they have high resistance to various herbicides targeting acetolactate synthase, EPSPS, or Bar genes. The herbicides are bispyribac-sodium, imidazoline, metribuzin, glyphosate, glufosinate, or glufosinate-ammonium.

[0045] 50% of the seeds produced by self-pollination of GAT transformants do not contain the GAT vector. They are genotyped as recessive homozygous, do not contain the GAT element, and do not have high resistance to herbicides.

[0046] This invention provides a method for preventing pollen drift in GAT-containing plants. The method involves transferring the aforementioned GAT vector into the plant, so that when the pollen matures, the plant material containing the GAT vector will specifically cause pollen containing the GAT vector to abort due to the presence of pollen abortion gene elements, while ensuring that pollen without the GAT vector develops and releases pollen normally, thereby reducing the probability of pollen containing the GAT vector escaping.

[0047] This invention provides a method for preventing the drift or contamination of GAT seeds or plants, wherein the seeds or plants contain the aforementioned GAT carrier, and a specific concentration of herbicide is applied during the seed stage by coating or during the seedling to flowering stage to kill the material containing GAT seeds or plants at a specific time, thereby preventing GAT seeds or plants from contaminating other common materials; the herbicide is bentazon, bensulfuron-methyl, or nicosulfuron.

[0048] This invention provides a method for producing sterile seeds using a recessive nuclear male sterile line in plants. The method employs the aforementioned intelligent genetic breeding system, mixing and sowing a GAT maintainer line and a GAT sterile line in a certain proportion. The GAT maintainer line pollinates the GAT sterile line. After pollination, a herbicide is applied to specifically kill the GAT maintainer line, leaving only the GAT sterile line for seed harvesting. The herbicide is bentazon, bensulfuron-methyl, or nicosulfuron-methyl.

[0049] This invention provides a method for purifying recessive nuclear male sterile lines in plants. The method employs the aforementioned intelligent genetic breeding system. GAT sterile lines are screened by seed coating or by applying a specific concentration of herbicide during the seedling to flowering stage to ensure the purity of the GAT sterile lines. The herbicide is bentazon, bensulfuron-methyl, or nicosulfuron-methyl.

[0050] This invention provides a method for hybrid seed production using a recessive nuclear male sterile line in plants. The method employs the aforementioned intelligent genetic breeding system, which utilizes the GAT maintainer line to produce GAT maintainer line seeds and GAT sterile line seeds through self-pollination; uses the GAT maintainer line to pollinate the GAT sterile line to produce GAT sterile line seeds; and uses the GAT sterile line and conventional materials to hybridize and produce common commercial hybrids.

[0051] This invention provides a method for hybridization breeding using recessive nuclear male sterile lines in plants. The method employs the aforementioned intelligent genetic breeding system, using GAT maintainer lines to hybridize and select with ordinary materials. GAT maintainer lines and sterile lines are selected through conventional backcrossing or pedigree methods. The selection process is supplemented by screening for various molecular markers of GAT or herbicides.

[0052] This invention provides a method for preparing commercial hybrids without GAT elements using the above-mentioned intelligent genetic breeding system. The method involves crossing a GAT maintainer line with conventional material A to obtain F1 hybrids. Subsequently, F2 hybrids are obtained through self-pollination. In the F2 generation, materials containing homozygous recessive nuclear male sterility sites and GAT elements are selected using GAT molecular markers and herbicide screening. Through continuous self-pollination, stable materials are obtained for higher generations, from which new GAT maintainer lines and GAT-sterile lines are obtained. The newly selected GAT-sterile lines are then crossed with ordinary restorer lines to select ordinary commercial hybrids. These hybrids do not contain GAT elements and are conventional commercial hybrids.

[0053] This invention provides a method for detecting transgenic positive plants containing the GAT vector, using any of the following primer pairs for PCR detection of the genome of the sample to be tested.

[0054] Expression cassette of plant male fertility restoration gene element C 48490 The primer sequences for detection are shown in SEQ ID NO.10-12; or

[0055] Plant pollen abortion gene element expression cassette K hv The primer sequences for detection are shown in SEQ ID NO.13-14; or

[0056] Plant pollen abortion gene element expression cassette K 5400 The primer sequences for detection are shown in SEQ ID NO.15-16; or

[0057] Selection of expression cassettes for gene transformation and maintainer lines ALS The primer sequences for detection are shown in SEQ ID NO.17-18; or

[0058] herbicide-sensitive element expression cassette M i The primer sequences used for detection are shown in SEQ ID NO.19-20;

[0059] Seed screening element expression cassette M zfn The primer sequences used for detection are shown in SEQ ID NO.21-22;

[0060] If SEQ ID NO.10-12 is used as primers for amplification, the 92bp band in the final product represents the wild-type band of the GMS2 gene in the original genome, the 83bp band represents the gms2 mutant band, and the 222bp band represents the GAT vector band. If the 83bp and 222bp bands appear, but the 92bp band is not present, it indicates that the plant has a male sterility mutant background and that the expression cassette of the plant male fertility restoration gene element is present.

[0061] If a 1274bp band is amplified using primers SEQ ID NO.13-14, it indicates that the plant pollen abortion gene element expression cassette K... hv exist;

[0062] If a 914bp band is amplified using primers SEQ ID NO.15-16, it indicates that the plant pollen abortion gene element expression cassette K... 5400 exist;

[0063] If SEQ ID NO.17-18 is used as primers for amplification, and an 831bp band is amplified, it indicates that the gene transformation and maintainer line selection element expression cassette M... ALS exist;

[0064] If SEQ ID NO.19-20 is used as primers for amplification, and a 923bp band is amplified, it indicates that the herbicide-sensitive element expression cassette M... i exist;

[0065] If SEQ ID NO.21-22 is used as primers for amplification, and a 375bp band is amplified, it indicates that the seed selection element expression cassette M... zfn exist.

[0066] This invention provides a method for sorting plants and offspring with different functions. The above-mentioned GAT vector is transferred into the plant. The gene transformation and maintainer line selection element expression cassette and herbicide sensitive element expression cassette in the GAT vector are used to sort plants and offspring with different functions based on a combination of positive and negative bidirectional selection of chemical herbicides and phenotypic selection.

[0067] The positive and negative bidirectional selection of chemical herbicides refers to the same plant exhibiting resistance to one herbicide and sensitivity to another.

[0068] Preferably, the positive selection of chemical herbicides is for bispyribac-sodium, imidacloprid, or metsulfuron-methyl, while the negative selection of chemical herbicides is for sensitivity to bentazon, bensulfuron-methyl, or nicosulfuron.

[0069] The beneficial effects of this invention are as follows:

[0070] (1) This invention constructs a genetic intelligent breeding system targeting the GMS2 gene. Using this system, the industrial production of the maintenance and propagation of recessive nuclear male sterile lines is realized. This invention also introduces the GAT vector into the recessive nuclear male sterile line of plants and combines positive and negative bidirectional selection of chemical herbicides to achieve the sorting of plants and offspring with different functions.

[0071] (2) This invention constructs a GAT vector based on the GMS2 gene, including six functional element expression cassettes: plant male fertility restoration gene element expression cassette C48490 Used to restore male fertility in recessive nuclear sterility mutants; plant pollen abortion gene element expression cassette K 5400 and K hv Used to remove GAT-containing pollen and maintain the heterozygous state of GAT maintainer lines; chemical herbicide positive selection expression cassette M ALS Used for gene transformation and purification of GAT maintainer lines; chemical herbicide negative selection expression cassette M i Used for removing pollen and seed leakage from herbicide-sensitive GAT maintainer lines and for purifying and removing impurities from GAT sterile lines; seed screening element expression cassette M zfn Used for mechanical sorting of seeds.

[0072] (3) The six key elements in the GAT vector provided by this invention work organically together and are combined with mechanization. In particular, the simultaneous use of two pollen abortion gene elements can effectively reduce pollen escape rate, ensure transgenic safety, and ensure the successful commercial utilization of recessive nuclear male sterile lines in automated processing. This invention can be applied to hybridization breeding and hybrid seed production of recessive nuclear male sterile materials in plants, thereby obtaining high-quality, high-yield, widely adaptable, and highly resistant new plant varieties and their seeds. This invention creates a possible application pathway for encoding bundle-like arabinogalactosamine proteins in rice breeding, which has great economic value. Attached Figure Description

[0073] Figure 1 Schematic diagram of pC1300 carrier.

[0074] Figure 2 Schematic diagram of pC0309 carrier.

[0075] Figure 3 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Schematic diagram of the carrier.

[0076] Figure 4 pC0309-K hv M ALS M i M zfn C 48490 K 5400 The vector enzyme digestion verification results are shown in the figure. M is the D15000 Marker, CK is the undigested plasmid, lane 1 is Kpn I single digestion; lane 2 is Xho I single digestion; lane 3 is BamH I single digestion; lane 4 is BamH I + Pst I double digestion; lane 5 is Kpn I + Pac I double digestion.

[0077] Figure 5 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Transgenic T0 plant pollen abortion gene element expression cassette K hv The detection results are shown in the figure. The detection primer sequences are as shown in SEQ ID NO.13-14. M2000 is the DNA Marker, ddH2O is the negative control, ZH11 is the negative control Zhonghua 11, CK is the positive plasmid control, and the right lane is the template of the transgenic T0 plant.

[0078] Figure 6 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Transgenic T0 plant pollen abortion gene element expression cassette K 5400 The detection results are shown in the figure. The detection primer sequences are as shown in SEQ ID NO.15-16. M2000 is the DNA Marker, ddH2O is the negative control, ZH11 is the negative control Zhonghua 11, CK is the positive plasmid control, and the right lane is the template of the transgenic T0 plant.

[0079] Figure 7 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Transgenic T0 plant gene transformation and maintainer line selection element expression cassette M ALS The detection results are shown in the figure. The detection primer sequences are as shown in SEQ ID NO.17-18. M2000 is the DNA Marker, ddH2O is the negative control, ZH11 is the negative control Zhonghua 11, CK is the positive plasmid control, and the right lane is the template of the transgenic T0 plant.

[0080] Figure 8 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Transgenic T0 plant herbicide-sensitive element expression cassette M iThe detection results are shown in the figure. The detection primer sequences are as shown in SEQ ID NO.19-20. M2000 is the DNA Marker, ddH2O is the negative control, ZH11 is the negative control Zhonghua 11, CK is the positive plasmid control, and the right lane is the template of the transgenic T0 plant.

[0081] Figure 9 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Transgenic T0 plant seed selection element expression cassette M zfn The detection results are shown in the figure. The detection primer sequences are as shown in SEQ ID NO.21-22. M2000 is the DNA Marker, ddH2O is the negative control, ZH11 is the negative control Zhonghua 11, CK is the positive plasmid control, and the right lane is the template of the transgenic T0 plant.

[0082] Figure 10 pC0309-K hv M ALS M i M zfn C 48490 K 5400 Fertility restoration gene element expression cassette C of transgenic T0 plants 48490 The detection results are shown in the image. The primer sequences are as shown in SEQ ID NO. 10-12. Lane 1 is the negative control ddH2O, lane 2 is the control Zhonghua 11, lane 3 is the homozygous mutant of gms2, lane 4 is the exogenous GMS2 gene plasmid, and lanes 5-7 are T0 generation single plants. The PCR product size is labeled on the right side of the gel image.

[0083] Figure 11 Results of spraying some GAT T0 generation transformants with bispyribac-sodium.

[0084] Figure 12 Results of partial leaf spraying with bentazon on some GAT T0 generation transformants.

[0085] Figure 13 The results of iodine staining of mature pollen from GAT T0 generation transformants show that black indicates fertile pollen and light-colored indicates sterile pollen.

[0086] Figure 14 Image showing fluorescence identification results of seeds from GAT transformants (T0 generation). Red indicates seeds of the transgenic GAT maintainer line, and colorless indicates non-transgenic seeds of the GAT sterile line.

[0087] Figure 15 GAT transformant (T0 generation) transgenic maintainer line (left) and non-transgenic sterile line (right) whole plant.

[0088] Figure 16 GAT transformant (T0 generation) transgenic maintainer line (left) and non-transgenic sterile line (right) whole ears.

[0089] Figure 17 GAT transformant (T0 generation) transgenic maintainer line (left) and non-transgenic sterile line (right) florets. Detailed Implementation

[0090] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0091] Example 1: Construction and Validation of GAT Vector

[0092] The GAT vector employs a segmented construction strategy, using expression cassettes as units, followed by unit assembly. First, it is constructed in the transition vector pC1300 (… Figure 1 An expression cassette was constructed on the vector and verified by enzyme digestion and sequencing. The expression cassette was then spliced ​​into the final vector. The specific steps for vector construction are as follows:

[0093] I. Construction of GAT Carrier

[0094] 1. Synthesize the MCS pC0309 fragment (SEQ ID NO.24), and link it to pC1300 using Sac II and Pme I. Figure 1 After that, pC0309 was obtained. Figure 2 ).

[0095] 2. Synthesizing DNA fragments NSPT-Construct V1.81-M i pC1300 was ligated into the enzyme by double digestion with Kpn I and Hind III, producing pC1300-M. i NSPT-Construct V1.81-M i The sequence consists of the Kpn I restriction site ggtacc, MCSI (sequence shown in SEQ ID NO.25), and the herbicide-sensitive element expression cassette M. i (SEQ ID NO.5), MCSII (SEQ ID NO.23), is composed of the spacer sequence tgcagggacccttgccaac and the Hind III restriction site aagctt, linked sequentially. The MCSI sequence is composed of Pst I, Srf I, Afe I, and Xmn I restriction sites linked sequentially. Herbicide-sensitive element expression cassette M iThe sequence consists of the NosT terminator, a stem-loop structure sequence of an RNAi gene CYP81A6 from the cytochrome P450 gene, and the ZmUbiP promoter linked sequentially. The stem-loop structure sequence of the CYP81A6 RNAi gene consists of an inverted stem sequence formed by the CYP81A6 coding region, a loop sequence formed by a rice intron, and a forward stem sequence complementary to the CYP81A6 coding region linked sequentially. The MCSII sequence consists of HpaI, PshAI, BspEI, and PacI restriction sites linked sequentially.

[0096] 3. Synthesize DNA fragments using NSPT-Construct V1.9-M ALS pC1300 was ligated into the enzyme by double digestion with EcoRI and HindIII to produce pC1300-M. ALS NSPT-Construct V1.9-M ALS The sequence consists of the EcoRI restriction site gaattc, the PstI restriction site ctgcag, the spacer sequence ggacccttgccaaca, the multiple cloning site MCSII (sequence shown in SEQ ID NO.23), and the gene transformation and maintenance line selection element expression cassette M. ALS (SEQ ID NO.4), MCSIII (SEQ ID NO.26), is composed of the spacer sequence tgcagtcccaaggcttccg and the Hind III restriction site aagctt linked sequentially. The MCSII sequence is composed of Hpa I, PshA I, BspE I, and Pac I restriction sites linked sequentially. The gene transformation and maintainer line selection element expression cassette M... ALS The sequence consists of the NosT terminator, the ALS gene coding region sequence OsALSm1, and the ActinP promoter linked sequentially. The MCSIII sequence consists of the BsrGI, BaeI, AsiSI, and FspAI restriction sites linked sequentially.

[0097] 4. Synthesize DNA fragments NSPT-Construct V1.81-C 48490 pC1300 was ligated into the enzyme by double digestion with Sac I and Hind III, producing pC1300-C. 48490 NSPT-Construct V1.81-C 48490 The sequence consists of the Sac I restriction site gagctc, the Pst I restriction site ctgcag, the spacer sequence tcccaaggcttccga, the multiple cloning site MCSIII (SEQ ID NO.26), and the plant male fertility restoration gene element expression cassette C. 48490(SEQ ID NO.1), MCSIV (SEQ ID NO.27), is formed by sequentially linking the spacer sequence tgcagcctgttgccaggga and the Hind III restriction site aagctt. The MCSIII sequence is composed of sequentially linked BsrGI, BaeI, AsiSI, and FspAI restriction sites. Plant male fertility restoration gene element expression cassette C 48490 The MCSIV sequence consists of the 2000bp sequence upstream of the start codon ATG of the rice GMS2 gene, the coding region of the GMS2 gene after codon optimization, and the 500bp sequence downstream of the stop codon TGA of the GMS2 gene. The MCSIV sequence is composed of the sequentially linked Swa I, BstBI, Mlu I, and RsrII restriction sites.

[0098] 5. Synthesizing DNA fragments NSPT-Construct V1.81-K 5400 pUC57-Simple was ligated into pUC57-Simple by double digestion with Nde I and EcoR V, producing pUC57-Simple-K. 5400 NSPT-Construct V1.81-K 5400 The sequence consists of the Nde I restriction site catatg, the spacer sequence cagggacccttgccaaca, the Nru I restriction site tcgcga, the Pac I restriction site ttaattaa, the Pst I restriction site ctgcag, the spacer sequence cctgttgccagggaa, the multiple cloning site MCSIV (SEQ ID NO. 27), and the plant pollen abortion gene element expression cassette K. 5400 (SEQ ID NO.2), the spacer sequence tcgacgcggccgatcccccgg, the Stu I restriction site aggcct, the Sac I restriction site gagctc, the multiple cloning site MCSV (SEQ ID NO.28), the spacer sequence tggcactggccgtcgtttt, the Hind III restriction site aagctt, the EcoR I restriction site gaattc, and the spacer sequence ggcgcgccgggccca are sequentially linked. The MCSIV sequence is composed of Swa I, BstBI, Mlu I, and Rsr II restriction sites sequentially linked. Plant pollen abortion gene element expression cassette K 5400 It consists of the promoter PG47, the Zm-AA1 coding region, and the terminator IN2-1 sequence. The MCSV sequence is composed of Avr II, Pml I, SnaB I, and AloI restriction sites linked sequentially.

[0099] 6. Digest pC1300-M with Pac I + Hind III enzymes.i and pUC57-Simple-K 5400 , express box K 5400 Connect to pC1300-M i Generate pC1300-M i -K 5400 .

[0100] 7. Digest pC1300-M with BsrG I + Hind III enzyme. ALS and pC1300-C 48490 , express box C 48490 Connect to pC1300-M ALS Generate pC1300-M ALS -C 48490 .

[0101] 8. Digest pC1300-M with Pac I + Swa I enzyme. i -K 5400 and pC1300-M ALS -C 48490 Connect the two expression boxes M ALS -C 48490 Connect to pC1300-M i -K 5400 Generate GAT vector pC1300-M i -M ALS -C 48490 -K 5400 .

[0102] 9. Digest pC1300-M with Pst I + Hind III enzyme. i -M ALS -C 48490 -K 5400 pC0309, connects four connected expression boxes M i -M ALS -C 48490 -K 5400 Incorporation of pC0309 produces GAT vectors and pC0309-M i -M ALS -C 48490 -K 5400 .

[0103] 10. K 5400 The fragment is from the multiple cloning site MCSIV (SEQ ID NO.27), the plant pollen abortion gene element expression cassette K. 5400 (SEQ ID NO.2), and the multiple cloning site MCSV (SEQ ID NO.28) are sequentially linked. Plant pollen abortion gene element expression cassette K 5400It includes the PG47 promoter, the coding region of the rice α-amylase gene OsAA (i.e., 5400), and the NosT terminator.

[0104] 11. Digest pUC57-Simple-K with Swa I + SnaB I double enzymes. 5400 And pC0308-MMCK, recycled expression cassette K 5400 And the enzyme digestion product pC0308-MMC, K 5400 Connecting to pC0308-MMC generates pC0308-M i -M ALS -C 48490 -K 5400 (pC0308-MMCK 5400 ).

[0105] 12. Synthesize DNA fragment M zfn pC0308-MMCK was ligated into the pC0308-MMCK by double digestion with Pst I and Xma I. 5400 pC0308-M is generated. zfn -M i -M ALS -C 48490 -K 5400 (pC0308-MMMCK). M zfn The fragment sequence consists of the Pst I restriction site ctgcag, the seed selection element expression cassette M. zfn (SEQ ID NO.6), consisting of a spacer sequence g and an Xma I restriction site cccggg linked sequentially. Seed selection element expression cassette M zfn In sequence, it includes the NosT terminator, the coding region of the deep red fluorescent protein FP635 gene, and the ZZ1P promoter.

[0106] 13. Synthesize the OsALSP fragment (SEQ ID NO.29), digest it with Nco I and BsrGI, and ligate it into pC1300-NSPT-Construct V1.9-M. ALS The DNA fragment OsUbiT (SEQ ID NO.30) was synthesized, digested with Pac I and Kpn I, and ligated into pC1300-M. ALS AAN generates another gene transformation and maintainer line selection element expression cassette M. ALS (SEQ ID NO.4) (i.e., the gene transformation and maintainer line screening element expression cassette of this application), the corresponding vector is pC1300-M ALS M ALS The expression cassette includes the OsUbiT terminator, the ALS gene coding region sequence OsALSm1, and the OsALSP promoter.

[0107] 14. Digest pC1300-M with Pac I + BsrGI double enzyme. ALS M recycling ALS Expression cassette. pC0308-MMMCK was double-digested with Pac I and BsrGI. 5400 Recover larger fragments and M ALS The connection generates the GAT carrier pC0308-M zfn -M i -M ALS -C 48490 -K 5400 .

[0108] 15. Digest the vector pC0308-M generated in step 14 with Xma I and BspE I double enzymes. zfn -M i -M ALS -C 48490 -K 5400 A smaller fragment M can be obtained. i and a larger fragment pC0308-M_M ALS CK 5400 The ends of the above fragments were repaired using high-fidelity Taq polymerase, and the fragments were then recovered. pC0308-M_M ALS CK 5400 Self-ligation, followed by digestion with AsiSA I, then end-filling with high-fidelity Taq polymerase, and finally combined with the end-filled M... i Flat-end connection yields transition carrier pC0308-M zfn -M ALS -M i -C 48490 -K 5400 (pC0308-MM ALS MCK 5400 M i The direction of transcription remains unchanged.

[0109] 16. Synthesize K hv The fragment was digested with Pst I and ligated into the transition vector pC0308-MM generated in step 15. ALS MCK 5400 The GAT vector pC0308-K was obtained. hv -M zfn -M ALS -M i -C 48490 -K 5400 (pC0308-K hv MM ALS MCK 5400 K hv The transcription direction and Mzfn The transcription direction is opposite. K hv The sequence consists of the Pst I restriction site ctgcag, and the plant pollen abortion gene element expression cassette K. hv (SEQ ID NO.3) is formed by sequentially linking the AsiS I restriction site gcgatcgc, the SrfI restriction site gcccgggc, the Pac I restriction site ttaattaa, and the Pst I restriction site ctgcag. Plant pollen abortion gene element expression cassette K hv It consists of the promoter OsPC32, the HvAA1 coding region, and the terminator IN2-1 sequence.

[0110] 17. Digest the K synthesized in step 16 with Pst I + Pac I double enzyme digestion. hv The fragment was then recovered. Simultaneously, the transition vector pC0308-MM generated in step 16 was digested with Pst I and Pac I. ALS MCK 5400 The largest fragment pC0308-_M in the enzyme digestion product was recovered. ALS MCK 5400 The K enzyme digested hv Connect to pC0308-_M ALS MCK 5400 The transition vector pC0308-K was obtained. hv -M ALS -M i -C 48490 -K 5400 (pC0308-K hv M ALS MCK 5400 ).

[0111] 18. Digest the transition vector pC0308-MM generated in step 17 with Pst I and Pac I. ALS MCK 5400 Recover smaller fragments M from the enzyme digestion products zfn The transition vector pC0308-K obtained in step 17 was then leveled using high-fidelity Taq polymerase. hv M ALS MCK 5400 The M after filling zfn Linked to obtain the GAT vector pC0308-K hv -M ALS -M i -C 48490 -M zfn -K 5400 (pC0308-K hv M ALS MCMK5400 M zfn The transcription direction remains unchanged.

[0112] 19. Digest the GAT vector pC0308-K obtained in step 18 with Pst I and SnaB I double enzymes. hv M ALS MCMK 5400 The largest fragment K in the enzyme digestion product was recovered. hv M ALS MCMK 5400 pC0309 was digested with Pst I and SnaB I, and the linearized pC0309 was recovered. K hv M ALS MCMK 5400 By linking pC0309, the GAT vector pC0309-K was obtained. hv -M ALS M i C 48490 M zfn K 5400 pC0309-K hv M ALS MCMK 5400 A schematic diagram of the carrier is shown below. Figure 3 As shown, the nucleotide sequence is shown in SEQ ID NO.9.

[0113] II. Validation of GAT Carrier

[0114] The pC0309-K constructed above hv M ALS M i C 48490 M zfn K 5400 The vector was verified by enzyme digestion and sequencing.

[0115] 1 μl of the above plasmid was mixed with 50 μl of competent *E. coli* cells, and transformed by electroporation at 1.8 kV. The transformation product was plated on LA culture plates containing kanamycin and incubated at 37°C for approximately 16 h. Single colonies were picked and subjected to colony PCR detection using specific primers. The specific primer sequences are shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, and SEQ ID No. 23. Positive single colonies were inoculated into LB medium containing kanamycin for expansion culture, and plasmids were extracted after approximately 16 h of incubation at 37°C. The method is as follows:

[0116] 1. Pour the turbid bacterial solution into a 2ml centrifuge tube, centrifuge briefly for 30 seconds, and precipitate the bacterial cells.

[0117] 2. Discard the supernatant, add 200 μl Solution I, shake to suspend the bacterial culture, and incubate at room temperature for 1 min.

[0118] 3. Add 300 μl Solution II, invert rapidly several times, and incubate on ice for 1 minute.

[0119] 4. Add 400 μl of Solution III, gently shake, incubate on ice for 2 min to condense, and then centrifuge briefly for 30 s.

[0120] 5. Aspirate the supernatant, centrifuge at 12000 rpm for 2 min, transfer the supernatant to a 1.5 ml EP tube, add 0.6 times the volume of isopropanol, and incubate on ice for 2 min.

[0121] 6. Centrifuge briefly for 1 minute and discard the supernatant.

[0122] 7. Add 500 μl of 70% ethanol to rinse the precipitate twice, and then air dry.

[0123] 8. Add 50 μl ddH2O (RNase A has been added, concentration is 1%) and melt.

[0124] Select Kpn I, Xho I, BamH I, BamH I and Pst I, Kpn I and Pac I for pC0309-K hv M ALS M i C 48490 M zfn K 5400 Enzyme digestion verification was performed. The digestion system consisted of 1 μl of 10×Buffer, 3 μl of plasmid DNA, 0.2 μl of DNA restriction endonuclease, and ddH2O to a final volume of 10 μl. The digestion conditions were incubation at 37°C for 10–15 min, followed by inactivation at 70°C for 5 min. The digestion products were detected by electrophoresis on a 1% agarose gel.

[0125] like Figure 4 As shown, pC0309-K hv M ALS M i C 48490 M zfn K 5400The plasmid size was 29033 bp; after Kpn I single enzyme digestion, the band size in lane 1 was 2886 bp + 10846 bp + 15301 bp; after Xho I single enzyme digestion, the band size in lane 2 was 1709 bp + 5346 bp + 21978 bp; after BamHI single enzyme digestion, the band size in lane 3 was 7042 bp + 21991 bp; after double enzyme digestion with BamHI and PstI, the band size in lane 4 was 7042 bp + 9612 bp + 12379 bp; after double enzyme digestion with KpnI and PacI, the band size in lane 4 was 2886 bp + 7383 bp + 7918 bp + 10846 bp. The enzyme digestion results were completely consistent with expectations. Sequencing was performed on the correctly digested plasmid, and the sequence was completely consistent with expectations. The sequence is shown in SEQ ID NO. 9.

[0126] Example 2: Agrobacterium-mediated GAT vector genetic transformation of rice

[0127] I. Transformation of Agrobacterium tumefaciens using GAT vector and its validation

[0128] Agrobacterium EHA105 stored at -80℃ was streaked onto a YEP plate containing rifampicin (25 μg / ml) + streptomycin (50 μg / ml) and incubated at 28℃. A single colony was picked and inoculated into 5 ml of YEP liquid medium containing the above antibiotics, and cultured at 220 rpm and 28℃ with shaking for 12-16 hours. 2 ml of the bacterial culture was transferred to 100 ml of YEP liquid medium containing the above antibiotics and cultured at 28℃ and 220 rpm with shaking until OD reached the target value. 600 =0.5. Pre-cool on ice for 10 min, centrifuge at 5000 rpm for 10 min at 4°C (pre-cool the centrifuge to 4°C). Wash twice with sterile deionized water (10 ml each time), wash once with 10% sterile glycerol, centrifuge at 5000 rpm for 10 min at 4°C, and resuspend the bacterial cells in 3 ml of 10% sterile glycerol. Take 1 μl of the correctly sequenced GAT plasmid pC0309-K obtained in Example 1. hv M ALS M i C 48490 M zfn K 5400 Add 50 μl of each Agrobacterium competent cell and transform by electroporation at 1.8 kV. Spread the mixture onto YEP culture plates containing kanamycin, rifampin, and streptomycin, and incubate at 28°C for approximately 48 hours. Pick single colonies and shake them overnight.

[0129] Colony PCR was performed on transformed Agrobacterium clones using specific primers to verify the amplification of the target fragment. Positive clones were selected, cultured for 36-48 hours, and the bacterial culture was preserved for future infection.

[0130] II. Agrobacterium-mediated genetic transformation

[0131] Induction: Seeds of Zhonghua 11 (ZH11) background carrying the homozygous recessive male sterility gene gms2 were sterilized with sodium hypochlorite and then placed on induction medium (N6 + 2,4-D 3mg / L + CH 0.6g / L + Pro 0.5g / L + sucrose 30g / L + Phytagel 3g / L) and cultured in the dark at room temperature at 28℃ for 30-40 days. The induced callus was then subcultured for 30-40 days.

[0132] Screening: The engineered Agrobacterium obtained in step 1 of Example 2 was transformed into the above-mentioned callus tissue by Agrobacterium-mediated genetic transformation. After co-culturing for 3 days, the tissue was washed 5-6 times and transferred to a medium containing bispyribac-sodium resistance screening medium (N6 + 2,4-D 2 mg / L + CH 0.6 g / L + Pro 0.5 g / L + sucrose 30 g / L + Phytagel 3 g / L + Cn 500 mg / L + bispyribac-sodium 0.3-0.6 μm / L or hygromycin 50 mg / L). The medium was incubated in the dark at 30°C for 30-50 days to screen for resistant callus.

[0133] Differentiation: The resistant callus obtained by screening was transferred to a bispyribac-containing differentiation medium (MS + KT 2 mg / L + NAA 0.5-2 mg / L + sorbitol 30 g / L + sucrose 30 g / L + Phytagel 3 g / L + bispyribac-containing medium 0.1-0.3 μm / L) and positive seedlings were obtained after 25-30 days of differentiation;

[0134] Rooting: Positive seedlings obtained after differentiation were transferred to a rooting medium containing bispyribac-resistant bispyribac-containing medium (1 / 2 MS + 20 g / L sucrose + 1 mg / L paclobutrazol + 3 g / L Phytagel + 0.15-0.5 μm / L bispyribac-containing ...

[0135] Hardening off and transplanting: For vigorous root growth of the transformed lines, the sealing film on the bottle opening was removed, and sterile water was added to cover the culture medium to a thickness of 1-2 cm. After hardening off for 2-3 days at room temperature, the seedlings were transplanted to a greenhouse for cultivation. A total of 125 GAT transformed lines were obtained through screening. 124 lines survived 7-14 days after transplanting. Simultaneously with the transplanting of the GAT transformed lines, a certain number of ZH11 seedlings at the 2-leaf-1-heart stage were transplanted as controls.

[0136] Example 3 Molecular identification of T0 generation transformation materials from GAT-transformed lines

[0137] Using leaves from the five-leaf stage of the transgenic plant obtained in Example 2, total genomic DNA was extracted using the CTAB method, as follows:

[0138] 1. Take 2-4cm of leaf and put it into a mortar. Add 800-900μl of 1.5% CTAB solution and grind it. Then transfer the ground liquid into a 1.5ml centrifuge tube and place it on ice or in a low-temperature freezer for later use.

[0139] 2. Place the sample in a water bath at 65℃ for 30 minutes, inverting and mixing several times during the process. In a fume hood, add 650 μL of chloroform and isoamyl alcohol solution (chloroform:isoamyl alcohol = 24:1, i.e., 500 ml of chloroform to 22 ml of isoamyl alcohol, and mix gently) using a glass pipette. After mixing, place the sample on a shaker and shake for 30 minutes or shake by hand for about 10 minutes. At this point, you can see obvious stratification. Centrifuge the shaken sample at 8000-10000 rpm for 8 minutes.

[0140] 3. Aspirate about 400 μL of the supernatant and transfer it to a new centrifuge tube. Add 800 μL of 95% ethanol pre-cooled at -20°C, gently invert and mix, and freeze at -20°C for 30 minutes.

[0141] 4. Take out the sample frozen at -20℃, centrifuge at 12000rpm for 10min, remove the supernatant, add 75% ethanol, let stand for about 1min, remove the supernatant, and then air dry; add 200-300ul of sterile water (ddH2O) to dissolve the air-dried sample DNA, and set aside for later use.

[0142] Using the plant pollen abortion gene element expression cassette K hv Primers SEQ ID NO.13-14; Plant pollen abortion gene element expression cassette K 5400 Primers SEQ ID NO.15-16; Gene transformation and maintainer line screening element expression cassette M ALS Primers SEQ ID NO.17-18; herbicide-sensitive element expression cassette M i Primers SEQ ID NO.19-20; Seed selection element expression cassette M zfn Primers SEQ ID NO.21-22 for pC0309-K hv M ALS M i C 48490 M zfn K 5400 Total DNA from T0 transgenic plants was detected by PCR to be positive. Figures 5-9 Select the amplification capability that simultaneously amplifies 1274bp (). Figure 5 ); 914bp ( Figure 6 ); 831bp ( Figure 7 ); 923bp ( Figure 8 ); 375bp ( Figure 9 The striped plants are ready for use.

[0143] Take the pC0309-K that was screened through PCR positive detection. hv M ALS M i C 48490 M zfn K 5400 DNA from T0 transgenic positive plants was first amplified by PCR using specific primers SEQ ID No. 26 and SEQ ID No. 27, then the amplified products were digested with HaeIII enzyme, and finally detected by 6% SDS-PAGE gel. Plants that only showed 84bp and 66bp bands were selected for subsequent phenotypic identification.

[0144] Take the pC0309-K that was screened through PCR positive detection. hv M ALS M i C 48490 M zfn K 5400 DNA from T0 transgenic positive plants was amplified using specific primers SEQ ID No. 10, SEQ ID No. 11, and SEQ ID No. 12. The amplified regions contained GMS2 mutant mutation sites, and a 9-base deletion mutation was observed in the background plants of the gms2 mutant in polyacrylamide gel electrophoresis. The primer amplified regions also contained a C→G SNP introduced into the coding region of GMS2 (CDS position 174) in the expression cassette of plant male fertility restoration gene element during vector construction, and SNP polymorphisms (AG / TC) at positions 304 and 305 with the exogenous gene.

[0145] Based on the above differences, a set of three primers was designed to distinguish the three genotypes. Using these primer pairs to amplify the DNA of GAT vector-transformed plants, three fragments were possible: 92 bp representing the wild-type genotype of the rice genome, 83 bp representing the gms2 mutant genotype, and 222 bp representing the genotype of the transformed fragment (results are shown below). Figure 10 Using the above method, plants with a genetic background of gms2 homozygous mutant and containing the GAT vector were identified. A total of 476 plants were transformed, and 403 plants with intact elements were obtained by molecular detection, with a positive rate of 84.66%. Phenotypic identification of the plants with intact elements was subsequently performed.

[0146] Example 4: Phenotypic identification of T0 generation transformed materials from GAT transformed lines

[0147] I. Herbicide Screening – Identification of Bis-propargyl Resistance Phenotypic

[0148] To test the efficiency of the screening marker element in the GAT system, a 600 mg / L bispyribac-sodium solution was prepared using 10% bispyribac-sodium emulsion (Nippon Nomura). This solution was sprayed on 3-5 leaf stage seedlings of GAT generation T0 and the wild-type control ZH11, and continuous observation was conducted after spraying. Three days after spraying, the control ZH11 showed yellowing leaves. Seven days after spraying, the control ZH11 plants were yellowing and near death. Some GAT-transformed plants grew normally, while others showed yellowing or growth stagnation. Figure 11 Of the 56 normally growing lines, 56 were bispyribac-resistant, indicating that the screening marker element was highly effective in these lines, with 56 out of 110 plants being highly resistant. The 54 lines that showed yellowing or growth retardation were bispyribac-sensitive, indicating that the screening marker element was ineffective or had low efficiency in these lines. No phenotype was collected from 14 lines.

[0149] In this process, it can be observed that the more functional elements integrated onto a single vector, the less likely a transformation event will occur where all corresponding phenotypes of the functional elements are expressed. This confirms the current consensus in the field: the more elements integrated into the same vector, the more difficult it is to achieve simultaneous conformation of traits; that is, the more functional elements, the lower the probability of the transformation event producing the expected phenotype. However, in the process of screening marker elements in the GAT system constructed in this invention, the inventors screened each phenotype and found that the probability of GAT-transformed lines becoming normally growing lines with high resistance to bispyribac-sodium was 51%. This success rate is far higher than the success rate of transformation events after the current three- or four-functional-element sets in the field. In actual transgenic events, the success rate of a single trait phenotype is 30%-50%. Theoretically, for transformation events with a set of multifunctional elements, the probability that all elements conform to the expected phenotype should be between 30% to the power of N and 50% to the power of N, where N is the number of functional elements.

[0150] II. Herbicide Screening – Identification of Bentasol Sensitivity Phenotype

[0151] To assess the efficiency of the herbicide-sensitive element in the GAT system, after identifying the bispyribac-resistant phenotype, a 3 g / L bentazon solution was prepared using 48% bentazon stock solution (Changzhou Precision Biotechnology Co., Ltd.). This solution was sprayed onto the marked areas on the leaves of GAT T0 generation and wild-type control ZH11 plants, and continuous observation was conducted after spraying. Three days after spraying, some GAT T0 transformed lines showed leaf tip curling and yellowing; seven days after spraying, 11 lines exhibited irreversible leaf wilting, classifying them as highly sensitive lines. Figure 12The results indicate that the herbicide-sensitive elements were highly efficient in these lines, with 11 / 61 plants being highly sensitive. Twenty lines showed severe leaf wilting initially but gradually recovered, classifying them as moderately sensitive lines; the herbicide-sensitive elements in these lines generally showed moderate efficiency. Another 30 lines showed no significant changes before and after spraying, classifying them as low-sensitivity or non-phenotypic lines; the herbicide-sensitive elements in these lines were poorly efficient. Phenotypic data were not collected for 63 lines.

[0152] III. Pollen Fertility Identification

[0153] To assess the functional efficiency of the restorer gene element and the pollen abortion gene element, pollen from GAT transformants was stained with iodine during flowering to detect pollen fertility. Because the GAT vector contains the restorer gene element, if it functions normally, male fertility can be restored, resulting in two types of pollen: (ms / GAT) and (ms / -). The (ms / GAT) type pollen contains the pollen abortion gene element from the GAT vector; if this element functions normally, the pollen will abort, therefore only the (ms / -) type pollen survives. Therefore, if a GAT transformant contains only one copy of the GAT vector, and both the restorer gene element and the pollen abortion gene element function normally, its pollen will exhibit a 1:1 segregation ratio of fertile pollen to aborted pollen. Thus, during iodine staining, approximately 50% will be blue-black fertile pollen, and 50% will be unstained sterile pollen. The specific method for iodine staining microscopy is as follows:

[0154] (1) Preparation of potassium iodide staining solution: Dissolve 2g KI in 5-10mL of distilled water, then add 1g I2 and dissolve with an appropriate amount of anhydrous ethanol. After complete dissolution, add distilled water to make up to 300mL. Store in a brown bottle for later use. When using, dilute with potassium iodide and deionized water at a ratio of 1:1 to prepare the iodine staining working solution.

[0155] (2) Pollen collection: Take fully mature anthers that are about to release pollen, remove the glumes, take out the anthers, and place them on a glass slide.

[0156] (3) Microscopic examination: Take about 70 μl of iodine staining working solution and drop it onto the anther. Use tweezers to thoroughly crush the anther to release the pollen grains. Cover with a coverslip and observe under a low-power microscope. Pollen grains that are stained blue-black are fertile pollen grains, while those that are light yellow are aborted pollen grains.

[0157] Iodine staining microscopic examination results showed that the gms2 mutant with the background of Zhonghua 11 had no pollen (e.g. Figure 13 (B); compared to ZH11, the vast majority of pollen can be stained blue-black, and is male-fertile pollen ( Figure 13 (A). Of the 29 GAT transformants, approximately 50% of their pollen stained blue-black, indicating normal fertility; approximately 50% of their pollen failed to stain blue-black, indicating aborted pollen (e.g., ...). Figure 13As shown in GAT in C), the ratio of fertile pollen to aborted pollen is 1:1, indicating that in these lines, the fertile pollen and aborted pollen gene elements exist as single copies and have high efficiency.

[0158] If the ratio of fertile pollen to aborted pollen does not meet the 1:1 segregation ratio and shows partial segregation, it indicates that the efficiency of the recovery gene elements and pollen abortion gene elements is poor in these lines or that the genome contains multiple copies.

[0159] IV. Pollen drift identification

[0160] In the superior initial maintainer line of GAT, the pollen and seeds showed a 1:1 segregation ratio, which initially indicated that the pollen abortion element in GAT was functioning normally. To further investigate whether the pollen was escaping, this example used the superior initial maintainer line of GAT to pollinate ordinary sterile rice materials and tested whether the resulting hybrid seeds had resistance to bispyribac-sodium. If so, the pollen containing GAT had escaped; if not, it indicated that the pollen abortion element in GAT was functioning well and could effectively prevent the escape of transformed pollen containing GAT.

[0161] GAT lines were selected as male parents to pollinate the female sterile line gms2, yielding 221 and 373 hybrid seeds respectively. The hybrid seeds were screened using bispyribac-sodium. After 21 days, observation revealed that the hybrid seeds germinated normally on the medium without selection pressure (1 / 2 MS), but failed to germinate on the medium with selection pressure (1 / 2 MS + 3 μM BS), consistent with the non-transgenic ZH11, 9311, and MH63, with a germination rate of 0%. This indicates that the hybrid seeds do not contain GAT elements, and pollen containing GAT cannot pollinate ordinary materials. This further proves that the pollen sterility element in GAT functions normally and can be stably inherited.

[0162] V. Seed Fluorescence Identification

[0163] Twenty-six lines exhibiting excellent herbicide and pollen staining phenotypes were selected. Seeds from the T0 generation were harvested from these lines through self-pollination. Based on pollen fertility testing, if the GAT transformant contained only one copy of the GAT vector and both the restoration gene element and the pollen abortion gene element functioned normally, its self-pollinated seeds would show a 1:1 segregation ratio. Specifically, 50% of the seeds containing the GAT vector (genotype ms ms / GAT-) exhibited deep red fluorescence under 560-595 nm excitation light; the other 50% of the seeds without the GAT vector (genotype ms ms) showed no fluorescence under 560-595 nm excitation light. The results indicated that some seeds from the GAT transformant exhibited deep red fluorescence (…). Figure 14Chi-square analysis showed that 18 GAT transformants exhibited a 1:1 segregation ratio of fluorescent to non-fluorescent seeds in their T0 generation seeds, indicating that the seed selection elements in these lines were single copies and highly efficient. One line showed a segregation ratio close to 1:1, possibly due to a slightly lower seed set rate in the T0 generation, and was therefore also considered a superior transformant line. Seven other lines did not exhibit a 1:1 segregation ratio, showing partial segregation and weak fluorescence, indicating that the seed selection elements in these lines were less efficient or contained multiple copies in the genome.

[0164] VI. Phenotypic Identification

[0165] Select key plants that have undergone the above phenotypic identification screening, photograph them for phenotypic identification, such as... Figures 15-17 As shown, the left side consists of GAT-containing transgenic maintainer lines, which are fertile, produce normal fruit, and have yellowish, plump anthers; the right side consists of non-transgenic sterile lines without GAT, containing the gms2 homozygous mutant genotype, which are male-sterile, do not produce fruit, and have whitish, small anthers.

[0166] Example 5: Transformation of GAT sterile lines

[0167] gms2 is a mutant of the rice GMS2 gene, characterized by a deletion of the AACAGCTAC base sequence at positions 118-126 of the GMS2 gene coding region (disclosed in Chinese Patent 202010491100.4). The gms2 mutant is crossed, backcrossed, and self-crossed with a fertile recipient. Molecular markers are used for selection based on the gms2 gene and genetic background during this process, ultimately obtaining a recessive nuclear male-sterile line carrying the homozygous gms2 gene in the target recipient background. The specific conversion steps are as follows, using H28B as an example:

[0168] 1. The F1 generation is obtained by crossing the recipient parent, such as H28B, as the male parent with gms2.

[0169] 2. Use F1 as the female parent and the recipient parent, such as H28B, to backcross and obtain BC1F1.

[0170] 3. Plant BC1F1 and use primers with sequences such as SEQ ID NO.10-12 to detect the gms2 genotype. Select plants with the gms2 heterozygous genotype, i.e., those that can amplify both 83bp and 92bp bands.

[0171] 4. Using a set of molecular markers (such as 100 or 200) that exhibit polymorphism between the gms2 mutant and the recurrent parent genome and are evenly distributed (which may be, but are not limited to, SSR, SNP, INDEL, EST, RFLP, AFLP, RAPD, SCAR, etc.), the genetic background of the single plants selected in step 3 is identified, and plants with high genotype similarity to the recurrent parent (such as greater than 88% similarity or 2% selection rate) are selected.

[0172] 5. Use the plants selected in step 4 and the recipient parent, such as H28B, to backcross and obtain BC2F1.

[0173] 6. Plant BC2F1, repeat steps 3 and 4, select plants with heterozygous gms2 genotype and high genetic background recovery rate (e.g., greater than 98%, or 2% selection rate), and harvest them from crossbred BC2F2.

[0174] 7. Plant BC2F2, repeat steps 3 and 4, and select the plants with the highest heterozygosity of the gms2 genotype and the highest genetic background homozygosity. Harvest these plants from the cross BC2F3. The gms2 homozygous genotype plants that segregate from the BC2F3 progeny are the gms2 recessive nuclear male sterile lines. BC2F3 is used to preserve the germplasm resources of the gms2 recessive nuclear male sterile lines. The recessive nuclear male sterile lines are named with the letter G. For example, in this embodiment, the gms2 homozygous recessive nuclear male sterile line H28B is named H28G.

[0175] The above example uses H28B as a breeding example, but it is not limited to H28B and can be any rice material.

[0176] Example 6: Transformation of GAT Maintainer Lines

[0177] In the transgenic plants of the GAT large vector obtained in Example 2, plants with homozygous mutations at the gms2 site, positive GAT transgenic PCR results, and exhibiting the phenotype controlled by each GAT element were selected as donor parents for GAT maintainer line development. Heterozygous gms2 plants obtained in Example 5, such as heterozygous H28G plants, were selected as recipient parents. Donor and recipient plants were hybridized, backcrossed, and self-crossed. During this process, molecular markers were used to select for the gms2 gene, GAT elements, and genetic background, ultimately obtaining a GAT maintainer line with homozygous gms2 gene and GAT elements in the H28B background.

[0178] The specific implementation steps are as follows:

[0179] 1. Obtain F1 by crossing the donor parent with the recipient parent of the gms2 heterozygous genotype, such as the gms2 heterozygous H28G.

[0180] 2. Backcross F1 with a gms2 heterozygous recipient parent, such as gms2 heterozygous H28G, to obtain BC1F1.

[0181] 3. Plant BC1F1 plants and perform PCR amplification of their genomic DNA using primers with sequences such as SEQ ID NO.10-12. Determine the plant's genotype based on the bands in the amplification products. Select plants with 83bp and 222bp bands, i.e., plants carrying the gms2 gene and the GAT transgene.

[0182] 4. Using a set of molecular markers (such as 100 or 200) that exhibit polymorphism between the gms2 mutant and the recurrent parent genome and are evenly distributed (which may be, but are not limited to, SSR, SNP, INDEL, EST, RFLP, AFLP, RAPD, SCAR, etc.), the genetic background of the single plants selected in step 3 is identified, and plants with high genotype similarity to the recurrent parent (such as greater than 88% similarity or 2% selection rate) are selected.

[0183] 5. Use the plants selected in step 4 and the gms2 heterozygous recipient parent, such as gms2 heterozygous H28G, to backcross and obtain BC2F1.

[0184] 6. Plant BC2F1, repeat steps 3 and 4, select plants with high genetic background recovery rate (e.g., greater than 98%, or 2% selection rate), and harvest them from crossbred BC2F2.

[0185] 7. Plant BC2F2, repeat steps 3 and 4, and select the plant with the highest genetic background homozygosity. Harvest the BC2F3 cross, which is the GAT maintainer line. Name the GAT maintainer line with the letter T. For example, in this embodiment, the GAT maintainer line of H28G is named H28T.

[0186] The above example uses H28B as a breeding example, but it is not limited to H28B and can be any rice material.

[0187] Example 7: GAT Retention System Production

[0188] GAT maintainer line seeds are planted in legally designated transgenic areas, self-pollinate to produce seeds, and then screened using a fluorescent seed sorter to obtain seeds with deep red fluorescence. These seeds are the GAT maintainer line seeds and can be used for self-propagation of the GAT maintainer line or for pollination of the GAT sterile line to produce sterile seed lines.

[0189] Example 8: GAT system for impurity removal and purity preservation

[0190] For GAT maintainer line sowing, spray with 30-90 mg / m² during the seedling stage. 2Use bispyribac-sodium, 50-100 mg / L methomyl, or 375-750 mg / L imidacloprid to remove impurities and maintain purity; spray with 60-120 mg / m³ during the tillering stage. 2 Use bispyribac-sodium, 100-200 mg / L methomyl, or 500-1000 mg / L imidacloprid to remove impurities and maintain purity; spray 100-200 mg / m² of bispyribac-sodium during the heading stage. 2 Use bispyribac-sodium, 200-500 mg / L methomyl, or 750-1500 mg / L imidacloprid to remove impurities and maintain purity; spray with 120-300 mg / m³ during the flowering period. 2 Use bispyribac-sodium or 200-750 mg / L metribuzin or 1000-3000 mg / L imidacloprid to remove impurities and maintain purity;

[0191] Spraying the above-mentioned herbicides can not only kill non-GAT maintainer materials, but also help with weed control in the field, achieving two goals at once.

[0192] Example 9 Production of GAT sterile lines (1)

[0193] GAT maintainer line seeds are planted in legally designated transgenic areas, self-pollinate to produce seeds, and then screened using a fluorescent seed sorter to obtain non-fluorescent seeds, which are the seeds of the GAT sterile line. These seeds can be used as female parents for seed production with other varieties (male parents), or for the re-propagation of GAT sterile lines.

[0194] Example 10 Production of GAT sterile lines (2)

[0195] The GAT sterile line seeds obtained from Example 9 were sown together with the GAT maintainer line seeds in the legally permitted transgenic area. During the flowering period, the GAT maintainer line would shed pollen for the GAT sterile line to produce seeds. After pollen shedding, a spray of 1.5-2 g / m² was applied. 2 The GAT maintainer line was killed by bensulfuron-methyl or 300-800 mg / L bensulfuron-methyl. All seeds were harvested mechanically, and non-fluorescent seeds were selected using a fluorescent seed sorter. These non-fluorescent seeds are the seeds of the GAT sterile line, which can be used as male parents for seed production with other varieties or for the propagation of sterile lines.

[0196] Example 11: Purification and Impurity Removal of GAT Sterile Lines

[0197] For GAT sterile lines, spray with 0.1-0.5 g / m² of fertilizer during the seedling stage. 2 Use bentazon or 30-100 mg / L bensulfuron-methyl to remove impurities and maintain purity; spray 0.5-1 g / m² during the tillering stage. 2 Use bentazon or 100-200 mg / L bensulfuron-methyl for impurity removal and purity maintenance; spray 1-1.5 g / m² during the heading stage. 2Use bentazon or 200-500 mg / L bensulfuron-methyl to remove impurities and maintain purity; spray with 1.5-2 g / m² during the flowering period. 2 Use bentazon or 300-600 mg / L bensulfuron-methyl to remove impurities and maintain purity; spray with 1.5-2 g / m³ 3-5 days after flowering. 2 Alternatively, use 400-800 mg / L benzylsulfamethoxazole or bentazon for purification;

[0198] Spraying the above-mentioned herbicides can not only kill GAT maintainer line materials and maintain the purity of GAT sterile lines, but also help with weed control in the field, achieving two goals at once.

[0199] Example 12 GAT hybrid production

[0200] The GAT sterile lines obtained in Examples 9 and 10 were crossed with the male parent to produce seeds. After pollination, the seeds produced on the sterile lines were harvested and were all non-GMO seeds.

[0201] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Hainan Bolian Rice Gene Technology Co., Ltd. <120> A Crop Genetic Intelligent Breeding System Based on the GMS2 Gene and Its Application <130> KHP211123763.6 <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 29033 <212> DNA <213> Artificial Sequence <400> 1 aattgacgct tagacaactt aataacacat tgcggacgtt tttaatgtat gctccaccat 60 gttggcaagc tgctctagcc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 120 taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 180 aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 240 atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 300 tacctgcagg tccggacgga ggtgcggtaa agcttgccga aaacatgcag aagagcaacg 360 acggcaatga acccaatgct catgatgagg actgagttcg gggacatctt gcgcccagca 420 gcctcatcgg tgtagaactg gagcattgtg ctggcaccgc ctccaccagt gccactgctg 480 gtggttctac gcctgcgcaa gcttgcagca gctgctgcac tccctctagc cggggcatct 540 ccattggcca ccatcttgct ttatccctct gcatgataat atgagtttca aatgtaaggt 600 ttgcagcact aatattacag aaaaccaaca gaacaacaga gtttcatcca aagtcgtatt 660 gcatatacat aggaagtgtt aaaatatgtc tatcattttg gaagatacgg tttatgctgt 720 cacacagcat tttggaagtg actattttat aagcacagaa gtttcttcaa tgtggaatat 780 gtcaaaaggc aaaataagaa gcacagaagt ttcttcaatg tggaatatgt cagaaggcag 840 aaaggtac acatcttgga agtgtatgat agtactac caataccagt gaagttttag 900 ttgtcacatt tgagtgctaa taaaaatata aaaaagaaat ggttgctgtt gctcatgcct 960 atacattc ataatctatc aaactactg ctcctggatg ctgcatact atactaact 1020 aagcttaagt taaatttacc acagaaaag aaaaaatgac aacttagccc agaattctgc 1080 tgaaaaattt tgggctgtc ctgggcttgg ccaacaccc attgacatga tgctgccca 1140 gtgtaagaac tgtaaaaca gtatagtgtc tgtgtagta cagggatggc agcatattca 1200 ttgctgcaac acagctacg ctacatgaaa ccaatttctt acgctggaat atgacaac 1260 aacatggagg agagatttcg taatagaatt ttgagcaat atgttggtac ggacaaatg 1320 atcccccaca aaaatccgca gagaagagatca tgagtgacac gcgatatatg aggtacaca 1380 cgaacatctt atcaagaatt cagatccatt cccagatcct haaagcac tagataca 1440 acagaaatac ttcgataaaa caatcgatt tcctcatg acacatccta acatcacacatc 1500 aaaccccccg 1560 1560 tcccagaatt ctaaatcggc caaaccaaac aagcccgatc taagacatcg attcaacatg 1620 aacgcgtacg gaatcaaagc aggctaatcg gagagatggc gaaaagagga tgattttcgc 1680 gcgcacctga tgaatctgcc ctgcgccaat cgctcgtgct cccgtcccaa cttggtcact 1740 cgtcttctcg cccgaaaatc tgagtgcgga attcagaatt ctctccgcgt ctgaacccgc 1800 gcgctgatat ctacccaact ggctggatta acgggttccg ttcaagatcc gatatcaagt 1860 gacgtggtcg gcgcgatctg attggccgga gcgcgtctcc gcgcgtcgat ctgagccgtc 1920 cgattcgttg ccgggtcccg atcgcgcggc ctggtgtgaa acgggtggcg tcaccgcgtg 1980 cggcgtggca ctgtgacgtg gcaacggtta tgcggttatg cacagtcatg ggctggacct 2040 tttggcccaa catctgtgga ctcgtggacc gggtttcggc ccttttatcc gctctacgga 2100 cgcagtccac gtcagccgac gtgggtccca ccacgaaggg cgtgcctccc tctaaaaatt 2160 gccaatgacg ataagagcaa agacggacgg gaggggaggg gtccaaatta aaactccaaa 2220 atccattcga acagcgaagg aaatttgttg gaaaattttg agatttggat ttttgttcta 2280 ggagagggga aggttagaag aagttgagat cggtggaga ctggagatcg aggggagatg ctgtgtctca cctcctcttc ctcctccgcg cccgctccgc tccttccctc tctcgctgat 2400 cgaccgagcc caggaatcgc gggcgggggt ggcaatgttc gcctgagcgt ggtttcttcg 2460. ccgcgccggt cgtggcctgg aaaggtcaag accaatttct cagttcctgc gactgcgcga aaaaacaaaa ccatggtgac tgttgtggag ggatcgcgt ccggccacca agtcctcttt 2580 caggggttca actgggagtc gtggaagcag agcggcgggt ggtacaacat gatgatgggc aaggtcgacg acatcgccgc tgccggagtc acccacgtct ggctgccacc gccgtcgcac tccgtctcca acgaaggtta catgcctggt cggctgtacg acatcgacgc gtccaagtac ggcaacgcgg cggagctcaa gtcgctcatc ggcgcgctcc acggcaaggg cgtgcaggcc atcgccgaca tcgtcatcaa ccaccgctgc gccgactaca aggatagccg cggcatctac tgcatcttcg agggcggcac ctccgacggc cgcctcgact ggggccccca catgatctgt 2940. cgcgacgaca ccaaatactc cgatggcacc gcaaacctcg acaccggagc cgacttcgcc gccgcgcccg acatcgacca cctcaacgac cgggtccagc gcgagctcaa ggagtggctc 3060 ctctggctca agagcgacct cggcttcgac gcgtggcgcc ttgacttgc taggggctac 3120 tcgccggaga tggccaaggt gtacatcgac ggcacatccc cgagcctcgc cgtggccgag 3180 gtgtgggaca atatggccac cggcggcgac ggcaagccca actacgacca ggacgcgcac 3240 cggcagaatc tggtgaactg ggtggacaag gtgggcggcg cggcctcggc aggcatggtg 3300 ttcgacttca cgaccaaagg gatactgaac gctgccgtgg agggcgagct gtggaggctg 3360 atcgacccgc aggggaaggc ccccggcgtg atgggatggt ggccggccaa ggccgccacc 3420 ttcgtcgaca accacgatac aggctccacg caggccatgt ggccattccc ctccgacaag 3480 gtcatgcagg gctacgcgta catcctcacc caccccggca tcccatgcat cttctacgac 3540 catttcttca actgggggtt taggaccag atcgcggcgc tggtggcgat caggaagcgc 3600 aacggcatca cggcgacgag cgccctgaag atcctcatgc agaagga tgcctacgtc 3660 gccgagatag acggcaaggt ggtggtgaag atcgggtcca ggtacgacgt ggggggcggtg 3720 atcccggccg ggttcgtgac ctcggcacac ggcaacgact acgccgtctg ggagaagaac 3780 ggtgccgcgg caacactaca acggagctga agtctgcact gatccgtcat tcgatcggac 3840 aaagcagcat tagtccgttg atcggtggaa gaccactcgt cagtgttgag ttgaatgttt 3900 gatcaataaa atacggcaat gctgtaaggg ttgtttttta tgccattgat aatacactgt 3960 actgttcagt tgttgaactc tatttcttag ccatgccaag tgcttttctt attttgaata 4020 acattacagc aaaaagttga aagacaaaaa aaaaaacccc cgaacagagt gctttgcagt 4080 ctttcaccag gacggttgta tcggttcagc agtcagcgct gcgatcgcga caaatttgtt 4140 tgtcagatca aatttttaag caaaacataa gaaacagcac aaaagggtat agcagaagca 4200 aaatttggac acaatgatta gggatcactt attcattata gttcttccat gctgctctac 4260 cacagcaaaa cgtttcagac accatcaaac cagacttaag gatacacatt acaggtaaat 4320 agtacacaat gaaacgggac acgaccaagg accagaccag acaaccatag ctccattggg 4380 gaagacaaat aggcagactt gtgaacccta gaacagcagc agctctatgg ctgagcacgg 4440 tacctctaga ggcgcgccca ctttgtgtta attackcagtc ctgccatcac catccaggat catgtccttg aatgcgcccc caattgggat cataggcagc acatgctcct ggtgcgggac 4560. gatgatatcc aacaagtatg gccctggagt ctcgagcatc ttcttgatgg cggcacggac 4620 ttcactcttc tttgttacac ggactgccgg aatattgaac cccttagcaa tagtcacaaa atctggatat atctcgctct cacattccgg gttgcccaag tatgtatgcg ccctattcgc cttgtaaaac ctatcctcca attgcaccac catacccaaa tgttggttgt tcaacaccat caccttcaca gggaggttct caatgcggat caatgccagc tcctgaatgt tcatgaggaa gctaccatcc ccatcaatat caacaactgt gacacctggg ttagccacag aagcaccagc tgcggcaggc agcccaaatc ccattgcgcc cagaccagcc actgccgtgg ccgcttgtag gtgtaatatt gtgccgccca catctggtgc tgcccaacac cagtagcgat gattgcctca cctttcgtca gctcatccag cacctgaatg gcatattgcg gtgggatctc ttcaccaaaa gttttgtacc ccagaggaa ctccctcttc tgctggtcca actcattgtg ccatgcacta aaatcagaac ttgtctttgt tgtgctctgt tgtagcagag cattcaagcc 5220 ctgtaaagcg agcttaacat ctgcgcaaat tgacacatgt ggttgcttgt tctttccaat 5280 ctctgctgga tcaatgtcaa tgtgcacaat cttggccctg cttgcaaaag cctcaatttt 5340 ccctgtcaca cgatcatcaa accgcacacc aaacgcaagc aacaggtcag ccttatccac 5400 ggcataattt gcgtacaccg tgccatgcat cccaagcatc cgcagggaca acgggtcgtc 5460 actggggaaa ttgccgaggc ccatcagagt ggttgtaact gggataccag tcagctcaac 5520 aaaccagcgc aattcgtcac cagatgcaga gcagccacca ccgacataga gaatcgggcg 5580 ccgtgactcg ccaaccagac gcaagacctg ctcaagcaat tctgtcgcgg gtggcttggg 5640 caggcgtgcg atgtaccctg gtagattcat cgaggtgtcc cagaccggca cggccatctg 5700 ctgctggatg tccttggga tgtccaccag caccgggcca ggacggcccg aggacgcgag 5760 gaagaggct tcctgtatga cgcgggggat gtcctccaca tcaaggacaa ggtaattgtg 5820 cttggtgatg gagcgggtga cctcgactat gggcgtctcc tggaaggcgt cggtgccgat 5880 catgcggcgg gggacctggc ccgtgatggc gaccatcggg acggagtcga gcagcgcgtc 5940 ggcgagcgcg gacacgaggt tggttgcgcc ggggccggag gtggcgacgc agaccccgac 6000 gcggccggac gcgcgcgcgt acccggacgc cgcgaacgcc tcgccctgct cgtggcggaa 6060 gaggtggttg gtgatgaccg gggagcgcgt cagcgcctgg tggatctcca tcgacgcgcc 6120 gcctgggtag gcgaacacgt cgctgacgcc gcaccgctcc agcgcctcca cgaggatgtc 6180 cgcgcccttg cggggctcgg ccggccccca cggccggagc ggcgtggccg gcggcgccgg 6240 ggacggcggg gtgaccgggg acaccgccga gcacctgacc gccgccgccc ccacccggcc 6300 tcgagcggga aggacgtggt gtcgctggtg gttcttacgg ccggtcttgg ccgtcgcggc 6360 ggcggacagg gcggcggccg cggccgcggc ggtcgtagcc atggtgggtg gtggcggcgg 6420 cggcggcggc gagggtttct gggtttgggc gagagggaga gaggggtgga gagtgtgggg 6480 gtgtgggtgt tttgtccgcg cgcggtgacg cagcgtgagg cgatgtgtgg ctcggatggg 6540 atcgtgtggg gccacgtcac agtgggcccc atatgtcggt gggataggat gacacacagc 6600 cacgtcgggg tcgatctggg cccgcgtgtc agtcgattgg atgaggatga caggtgggtc 6660 agtcccaata acgggtggag ggtacagaac ccgataaaaa atcgatctca aagtcggatg 6720 cggatgcaac cgcgagacct agcagtctag cacccgcacc cgcacccgca caaacgcagc 6780 gcaagatgag cagtggcggc gagaagtccg gctcgggcgg cggcggcggt ggcggcggcg 6840 gcggggcggt gaagacgcc tccgacttcc tcaagtccat caggggcgc cccgtcgtcg 6900 tcaagctcaa ctccggcgtc gactaccgcg gtaaccccct gctcaattcc ctcccccttt 6960 ttgcctcaac cctagacccg cctcccgaaa accctagcac gagacgaatg cgatgtttgt 7020 tgtaccccgt atctctttct ccttaattgg aactctgcgt ttctttcgt taattagtgg 7080 ggggaaggaa aggcgtggac tctgtaggat tttcttttcg atttgatgac caagggagat 7140 acttatttta gtgctgttta agatcctgct agtgccccggt gtagctaggc catttgagaa 7200 gcagataacc gtgtttttct gtaggacctt ctctaatctt gagctatttt gatatcttaa 7260 ttacttatgg ttaaacccta gaacctcagt atgttttaac ttagtaagag attgctacag 7320 tattttatt tgtaggaaca acattgtagg tggttatcat gctactgact gtcttgtgta 7380 gagccctcct atcattaagg ggcttttg tttactaata gttagtttta gtacccattt 7440 ttctgtgagc tactaaaag atatttcca attcaaccta tggtaattta aagtacttta 7500 tgctgtatgt ccatttactg aggattga ttaatatta agaggagga catctgtgct 7560 taaggtttgc attgcaat ttgatagatt tatgctaaac aaaggtaatt gtgcatgctt 7620 gagatagaaa gggatttccc ttctttggtt tgatataa ggggttggca ttccatgatc 7680 aggagcatag tgcatttata ttttaatg tggctatgtg tatgcagttc tcaatttcac 7740 attggcggta cacccatgat atatttaatt gttacccaga accatataat agcctataa 7800 gagcatatgg tattccattg attggggcct tcggagtgt acctgtgtat gtaactatgc 7860 atataggtt tactttctgg tagttcttc ttctctcat cacttaagac atctggatcg 7920 ctgttatcaa gtcgtagact agtcataacg tcagtcaagt cagacgacta gagggtacg 7980 actcgaccaa atagcaagtc gcacaattag tcgtagatta gtcatagcaa atcatcattt 8040 caccatgcta attggcttat tgtgtttagt actttaaatt tatttcttgt taacttattg 8100 tcttgctggc tactccataa accgtagttt ataatactat atatagtgct tagtacaata 8160 gaatagtact agagactata tagtgcatcc attgttttca cacgaccaaa tcatggacta 8220 gtcgtggact agattttgaa tggaacagtt ttaccagaaa tacacttgtt cttttttttt 8280 ctgaatagtg ttgaatcagt agctgcaatg catagcttgt gcaataaaat cattatatac 8340 tatcaccaat ttcatggaat cttacttatt ggaaatttgt aacaaatcta ttttatcccc 8400 tgagttaccg tgttggtcta aaatcaactc gcatgtgaga caagatgaag aggaccatga 8460 agattgcctc tttcatttat tcatttgctg actgcttgca atgccactat aaacctaatc 8520 ggatgactgg ttgtcatgtc tccgctaact agagagaaag ggggaggagt gaagacttta 8580 cgatttaaat cctaggtttt ttaccaggtg aactccaagt cctggaccct tttttcccga 8640 tctagtaaca tagatgacac cgcgcgcgat aatttatcct agtttgcgcg ctatattttg 8700 ttttctatcg cgtattaaat gtataattgc gggactctaa tcataaaaac ccatctcata 8760 aataacgtca tgcattacat gttaattatt acatgcttaa cgtaattcaa cagaaattat 8820 atgataatca tcgcaagacc ggcaacagga ttcaatctta agaaacttta ttgccaaatg 8880 tttgaacgat cggggaaatt ccagtgcacc agagtcacag aaacacatca cacattcgtg 8940 agctcagctt agccatggat aacgcctaca ttattgccat tctctctgta gctatcctct 9000 tcttgctcca ctactacctc ctcggccgcg gcaatggcgg ggcggcgcgg ctgccgccgg 9060 gtccaccggc cgtcccgatc ctgggacacc tccacctcgt caagaagccg atgcacgcca 9120 ccatgtcccg cctcgccgag cggtacgggc cggtgttctc gctgcgcctc gggtcgcggc 9180 gcgccgtggt ggtgtcgtcg ccggggtgcg ccagggagtg cttcaccgag cacgacgtga 9240 ccttcgcgaa ccggcccagg ttcgagtcgc agctgctggt ctcgttcaac ggcgccgcgc 9300 tcgccacggc gagctacggc gcgcactggc gcaacctccg ccggatcgtc gccgtgcagc 9360 tgctctccgc gcaccgcgtc ggcctcatgt ctgaaaatct cgaaacagcc gtgtcatagt 9420 caatcattag gtgttatagg aacaatcaaa ggttttttca agtgttaatc ttcatactaa 9480 tatatacagt gggtactctt tatctactgc cgtggaactg tcatatttga ttatgaaatt 9540 ttagctctag aaataatttg atcatcaatg tcagactt atgaccttgc aaatacatt 9600 tcctaattga gaacagggta aaattatgaa ctagcctct gaaccttcat accaggcag 9660 cacattttt gttgtaaaat cacatcttaat atcagcggaa agactggacc agaagaa 9720 aaagttaaga caggcatata ctcttgatcc tctaaaagag atgaggcggt acatgatca 9780 accatgaaca ttaaagtgat acgtggaaca tgagacaca ataattgtc actggaacat 9840 aaatacaaaaggtttgtag taacttaccg acatgaggcc gacgcggtgc gcggagagca 9900 gctgcacggc gacgatccgg cggaggttgc gccagtgcgc gccgtagctc gccgtggcga 9960 gcgcggcgcc gttgaacgag accagcagct gcgactcga cctgggccgg tcgcgaagg 10020 tcacgtcgtg ctcggtgaag cactccctgg cgcaccccgg cgacgacacc accacggcgc 10080 gccgcgaccc gaggcgcagc gagacaccg gcccgtaccg ctcggcgagg cgggacatgg 10140 tggcgtgcat cggctcttg acgaggtgga ggtgtcccag gatcgggacg gccggtggac 10200 ccggcggcag ccgcgccgcc ccgccattgc cgcggccgag gaggtagtag tggagcaga 10260 agaggatagc tacagagaga atggcaataa tgtaggcgtt atccatggct aagctgagct 10320 cacgaatgtg tgatgtgtt ctgtgactct ggtgcactga agtaacacca aacaacaggg 10380 tgagcatcga caaagaac agtaccaagc aaataatag cgtatgaagg caggggctaaa 10440 aaaatccaca tatagctgct gcatatgcca tcatccaagt atcagat caaatatt 10500 aaaaacata cttgttttatt atatagata ggtactcaag gttagagcat atgaatagat 10560 gctgcatatg ccatcatgta tatgcatcag taaaacccac atcacatgt atacctatcc 10620 tagatcgata tttccatcca tcttaaactc gtaactatga agatgtatga cacacacata 10680 cagttccaaa attaataaat acaccaggta gtttgaaca gtattctact ccgatctaga 10740 acgaatgaac gaccgcccacacacacacacacacaac caagcgaac aaagcatct 10800 ctgtatatgc atcagtaaaa cccgcatcaa catgtatacc tatcctagat cgatatttcc 10860 atccatcatc ttcaatcgt aactatgaat atgtatggca cacacataca gatccaaaat 10920 taataaatcc accaggtagt ttgaaacaga attctactcc gatctagaac gaccgcccaa 10980 ccagaccaca tcatcacaac caagacaaaa aaaagcatga aaagatgacc cgacaaacaa 11040 gtgcacggca tatattgaaa taaggaaaaa gggcaaacca aaccctatgc aacgaaaaa 11100 aaaaaatcat gaaatcgatc ccgtctgcgg aacggctaga gccatcccag gattccccaa 11160 agaaacac tggcaagtta gcaatcagaa cgtgtctgac gtacaggtcg catccgtgta 11220 cgaacgctag cagcacggat ctaacacaaa cacggatcta acacaaacat gaacagaagt 11280 agaactaccg ggccctaacc atggaccgga acgccgatct agaaggta gagaggggg 11340 gggggggagg acgagcggcg taccttgaag cggaggtgcc gacgggtgga tttgggggag 11400 atctggttgt gtgtgtgtgc gctccgaaca acacgaggtt ggggaaagag ggtgtggagg 11460 gggtgtctat ttattacggc gggcgaggaa gggaaagcga aggagcggtg ggaaaggaat 11520 cccccgtagc tgccggtgcc gtgagaggag gaggaggccg cctgccgtgc cggctcacgt 11580 ctgccgctcc gccacgcaat ttctggatgc cgacagcgga gcaagtccaa cggtggagcg 11640 gaactctcga gaggggtcca gaggcagcga cagagatgcc gtgccgtctg cttcgcttgg 11700 cccgacgcga cgctgctggt tcgctgttg gtgtccgtta gactcgtcga cggcgtttaa 11760 caggctggca ttactactc gaacaagaa aaatgttttcc ttagttttt taatttctta 11820 aagggtattt gtttaattt tagtcacttt atttttattct taaattatta 11880 aaaaaaaa ctaaaataga gttttagtttt tcttaattta gaggctaaa tagaaaa 11940 tagatgtact aaaaaaatta gtcttaaaa accattaacc ctaaacccta aatgatgta 12000 ctaataaat ggatgaagta ttatataggt gaagctattt gcaaaaaaa aggagacac 12060 atgcacacta aaagataa actgtagagt cctgttgtca aaatactcaa ttgtccttta 12120 gaccatgtct aactgttcat ttatatgatt ctctaaaaca ctgatattat tgtagtacta 12180 taacttat tattcgtaga gtaagtttta tattatagta aaataga taactgcac 12240 ttcaacaag tgtgacaaaa aaatatgtg gtaattttt ataacttaga catgcaatgc 12300 tcattatctc tagagagggg cacgaccgggg tcacgctgca catgcgcatc ggaccgttaa 12360 ttaaacaaca tggtgcaaca gtgccagctg tagttagggg attactgagg ggagactggt 12420 gttgaatcta gatgtgcaa cgcacta ctacctaccg tgtcgctgtg aaatggaatt 12480 gcagatagtt ttttttcta ataacgagtt gcagaatgca gataactagt gggcaaccaa 12540 gaaaaaacag aaagccccaa tgcaagtag gaaccaaaaaaggcaaac aaggcataac 12600 aatcacaga acaatccaa gagaaaaaaacatggtt ccgagctcta acaaatagg 12660 catcacaatc accgttctcc acctgaggat ccaatcattc aaatcctatc taactaccga 12720 gtactaccaa ccaggaag aagaacacaa cttcaggatg agatttacca tggagcccac 12780 gagctcagaa gcgaacaccg gactgcatca caccatgcat gcccagggggg gaacaacgag 12840 agctcaacgt cgaacaccctg acgctcacaa gaacgacgcg gcgagcagag cggcggcgga 12900 ggccacagtg gccgcaacgc tcgtggccgc cgcggtggcg ccgttctct tctcggcttt 12960 gtcggcagcc tcttctcccg cgggcgcgtc ggcgggcgac atgtcaggcg tgtcggccgg 13020 aggcgcgggt ggggaatggg aaggcgactt gcccttcttt ttcttcttgc ccgccgcctt 13080 gggggagggc gccggcgagg agccttctgg cgcgggagaa gcggctggca catcgcttgc 13140 cggtcccggc gccggcgcgg gggaaggtgc gccaccgaag agctctggcg gcagcagcac 13200 gctgtccacc gtgtggataa ccgtcggggt gtcgtccagc acggtggacg cgacgcggga 13260 cttgtccatg ccggtgtcca tggacacgtc gtcgccctta gtgacgacgg agaggtcgta 13320 cttacccgct ccggtggagg ccagggtctg gatgtggccc ttgatggtct tgagcgacgc 13380 cttgggcgcg tactgcggca aggcgtggta ctggagaagc gtcaccagct cggcgctggt 13440 cagcttgctc agatccggca ggcccttggc ctggaacgcg tcgtcgttgg gcgcgaacag 13500 cgtcagcgcc ttgtccatgg ccgcctggta catcttcatc accccggacg acacgatgag 13560 ccgcgcgaac tgcttgcacc cggccttctc aagaagcgcg gtgaggttgg tcgacgcggc 13620 cgacggggag tcgaagaggc cggggaaggt gatggggtcg gagacctcaa gaacggagag 13680 gttgtacggc tcctgcttga cggacttggt gtaggtggcc tggaacttgg agccgggcgc 13740 ggcggaggcg aacccaacct tgccgccgcg caggttggtg atgttgacgt ggcccatgtt 13800 accggaggcg tcgccggtgg tctggtacag cgtggtggtg agctcggagc cgtcggagag 13860 ggagtgcagc ttcttggtgt cgtagtagtc gaggagggtg aggaggcgga gcgcgttctt 13920 gatgtcggcg agggagaggt tggagacgag ggaggacatg gcgccgttgg tgagcacgag 13980 gcaggtcacc gtgctccggc tgttgatctc gtcgcacacc ttggtctggg agaggtagct 14040 gttgtacagc gagtactccg ggtagccgtc gaggatgtcc gtgatgttgt gggagctcac 14100 cgccgcgacg gcgagggagg cggccaggag gaagagcagg cggcggtcgg tggcggccat 14160 ggcggcggtg gtggtgttgt gtggtgtggt gtgacacggt ggggagagga aggagagtag 14220 tgtgcgccgt gttggggttt tagctttttc tgggcgtggg tttttggcct gttggacttt 14280 ggtcttggag gggttcaggt gttgggttga gtcttcaaag aaaaagagaa gttgagtttg 14340 tgccgtgacc atggttaggt gctggatgga gtactggagt gtgcagcact aaagcctgga 14400 catgtgctgc accctcgatg gttgtgatga tttctgtgc ggcggtgggg tgctcttgtt 14460 ggctcgcgtg ctcagtgctg tggactatgg agtgctgtg tttcatgcc taacacgttt 14520 gtgttaacca cacatgattg agagttttaa tcgaatactc gatatgctaa aaatccagta 14580 gtatggtcta agagtatcta tgagaatggc cacatatatt taggttatgt tggtacgaca 14640 ttaactcccc gttttgttg gtaagctata attattaat tgaggcacag cgttttattt 14700 tgcactaa ttagaggatt gaactagtca taccataat aaggatggtg aaagttttaa 14760 caggtttgtt ttcgttgtag tattgtttta tgatgttagt cgaaaatacc tggtactctc 14820 tactaatatt attacktacta taagaaaaat atccgaacc atttattatt aagggttaat 14880 tagtaattta ctggggtaac tttatcattt atgttttatt tctgtctga atcgatctag 14940 gtcatcgcgg tggtattgct tatattctat agataaagcc CAAAAAAAAAAA agaagaaat 15000 gggtttagtc acttctaaat gatgattata ccaccgcacc atttttttaa cataatatt 15060 tatccacatt tctactacca ttaacttata gagcggtatt acaaatagat ctacagtagt 15120 aaaatagat ccgaaatcct ttgattaaat aagattaatg gttaaagtta cttagagaat 15180 gacctaaacc catccaaggg aatcttacaa tttatgatta tgttatgcgt agaacacagt 15240 ttgagctaca aatgtttatg gctcctttca aaaggggaat gaaaaatcac acaatagaa 15300 aaaaaaacat agtaaccaac atagaatgt acatgttaat aaaatagatga ttgaaaaaaca 15360 catgaaatag aaggtgcgta gtttggaccg taggaattta gttatcacga gattattaca 15420 aaacgacgat aaaaatttcg ttggtcaaaa tatcctcaac tttggttaat gtacagtttc 15480 attaatctta gcaaagaaaa ggggaaaaaa gatagtagat gttcctatcg caatggaatc 15540 aatggcaaag gaaaattttc ctctattatt atactagaga tctcctttta ctatgttcca 15600 atccatcatt tcaaatggat gaataatagt gccaaatcca atagaaattg aatcccccaaa 15660 15720 taaggtatct taatagataa tttgtagaat ttaaaactat gaacagaaa ttttccatag 15780 gaaccatttt ttccttcact ttttttgga ggatctaaaa catgagctca aatctcatgg 15840 ccttcgaaat agactattc aacatttatt cgtggagtgt tactgtacaa aatttctttg 15900 gagagttcta cagtttacta ctggtttata tactcattat agtatatctc atatttttga 15960 gattggctt gtggggttg aaaaaatc taccaaattt attcttgttg gagcatccgc 16020 tatatgttgg gctatatggt tgtgtagaaa tgatatggtt tttgataaat caccatctat 16080 gtcctatatg ctggttcttt tcagagcaac atactggctc cagtcctgag cttaactact 16140 aaagtgcgat gaagaatca gcccggggcag gcctccctcag cgatctagta acatagatga 16200 caccgcgcgc gataatttat cctagtttgc gcgctatatt ttgtttcta tcgcgtatta 16260 aatgtataat tgcgggactc taatcataa aacccatctc ataataacg tcatgcatta 16320 catgttaatt attacatgct taacgtatt spacagaat tatatgata tcatcgcaag 16380 accggcaaca ggattcaatc ttagaact ttattgccaa atgtttgaac gatctcagct 16440 gtgccccagt ttgctaggca ggtcgcagta cctggccaca gccatctcgt gctgctccac 16500 gtaggtctct ttgtcggcct ccttgattct ttccagtctc ctgtccacga agtagcc 16560 gggcatcttg aggttcttag cgggtttctt ggatctgtat gtggtcttga gggagcagtg caggtagccc ccgcccacga gcttcagggc catctggcta tggcctctca ggccgctgtc 16680. agcggggtac agcatctcgg tgctggcctc ccagccgagt gttttcttct gcatcacagg 16740 gccgttggat gggaagttga ccccgttgat cttgacgttg taggaggc agccgttctg gaggctggtg tcctgggtag cggtcagcac gcccccgtct tcgtatgtgg tgatcctctc 16860 cctgtgaag ccctcaggga aggactgctt aaagaagtcg gggatgccct gggtgtggtt gataaaggtt ttgctgccgt acatgaagct ggtagccagg atgtcgaagg cgaaggggag agggccgccc tcgaccacct tgatcttcat ggtctgggtg ccctcgtagg gcttgccttc 17040 gccctcggat gtgcacttga agtggtggtc gttcacggtg ccctccatgt aggtttcat 17100 gtgcatgttc tcggtgatca gcacgctatc ctcacccact gcggaagcgt tgcatgcaac 17160 aatagcaagg agagcaaata cgaaaatgat cttcattttt gtaggattct actactatgc 17220 ttcaactata atgtttgaat tgtgtgaagg atgaggaggg ttttcattat gcttgtctat 17280 ttagatgtgt ttccctatcg gttgctttag agtgttagtt ttgcttgatg ctatattagg 17340 atctaagtga gtcatattat ttggatattc tgttaggtgc acctaaaaat gttctttgat 17400 atcatcatca aagtaacttt tatgcccatc atatatacat gatggtgagc aaaaaaataa 17460 tgacatgact catcgctcac tttatgtgtc aatgtgataa ggattgcaac ttttgaaact 17520 aagtttgtta tgttttgtaa gctattattt tgataatgca ctacacgtgg aactttacga 17580 ctgtgtgggt tttgctctt tgaattatat aatttcagta agaaaaaaaa ttatagtatg 17640 ttcaatggtt ttcattgttc cattaatact cttgtgaaaa cttgtttgtg atacgaaata 17700 agttaatgca ataactttta aattaacttt gcagagcttt acaataactc accaacttac 17760 tctaattgtg gttggggatt gatttaattc atacttttat agaccaaatt gatattgtgt 17820 tgctaaataa aaattatagt ggtgttgcta cacctacaca gacacagaag gaatcctgat 17880 atcatcagct atctactgct tcctccacat ggactcaaga agcagaagca aaaaaagaaga 17940 aggcatttgc tccaacaaag ttttccggtg aaaggcaaca cattgttctg aacttcctgg 18000 catgtattat gtgaatctag caaattaacc aaacattgac acaatgcgac accttgtaat 18060 gtagccgtgc cgagaattgt atatctcact taccattgta tatcacacgt gccgagaata 18120 ggagattgat ttttgccaac caaaacgctc taggcagacc aattgggcga cgtccacctg 18180 cttcactgga gcaccggaca ctgtctggtg gcataccaga cagtccggtg tgccagatca 18240 gggcaccctt cggttccttt gctcctttgc ttttgaaccc taactttgat cgtttattgg 18300 tttgtgttga acctttatgc acctgtggaa tatataatct agaacaaact agttagtcca 18360 atcatttgtg ttgggcattc aaccaccaaa attattata ggaaaaggtt aaaccttatt 18420 tccctttcaa tctccccctt tttggtgatt gatgccaaca caaaccaaag aaaatatata 18480 18540 tttatacttt tacttgatat gcatggttgc tttcttttat tttaacattt tggaccacat 18600 ttgcaccact tgttttgttt tttgcaaatc tttttggaaa ttctttttca aagtcttttg 18660 caaatagtca aaggtatatg aataagattg taagaagcat tttcaagatt tgaaatttct 18720 ccccctgttt caaatgcttt tcctttgact aaacaaaact ccccctgaat aaaattctcc 18780 tcttagcttt caagagggtt ttaaatagat atcaattgga aatatattta gatgctaatt 18840 ttgaaaatat accaattgaa aatcaacata ccaatttgaa attaaacata ccaatttaaa 18900 aaatttcaaa aagtggtggt gcggtccttt tgctttgggc ttaatatttc tccccctttg 18960 gcattaatcg ccaaaaaacgg agactttgtg agccatttat actttctccc cattggtaaa 19020 19080 taacgatac cgttagagtg gagtggaagc cttgtcttcg ccgaagactc catttccctt 19140 tcaatctacg acttagcata gaatacact tgaaaacaca ttagtcgtag ccacgaaaga 19200 gatatgatca aaggtataca aatgagctat gtgtgtaatg tttcaatcaa agtttcgaga atcaagaata tttagctcat tcctaagttt gctaaaggtt ttatcatcta atggtttggt aaagatatcg actaattgtt ctttggtgct aaagataagca atctcgatat cacccctttg ttggtgatcc ctcaaaaagt gataccgaat gtctatgtgc ttagtgcggc tgtgttcaac gggattatcc gccatgcaga tagcactctc attgtcacat aggagaggga ctttgctcaa tttgtagcca tagtccctaa ggttttgcct catccaaagt aattgcacac aacaatgtcc tgcggcaata tacttggctt cggcggtaga aagagctatt gagttttgtt tctttgaagt ccaagacacc agggatctcc ctagaaactg acaagtccct gatgtgctct tcctatcaat tttacaccct gcccaatcgg catctgata tcctattaaa tcaaaggtgg atcccttggg gtaccaaaga ccaaatttag gagtgtaaac atgattcttt tcacggccct aaggtgaact tccttaggat cggcttggaa tcttgcacac atgcatatag aaagcatact atctggtcga gatgcacata atagagtaa agatcctatc atcgaccggt ataccttttg 19920 gtctacggat ttacctcccg tgtcgaggtc gagatgccca ttagttccca tgggtgtcct 19980 gatgggcttg gcatccttca ttccaaactt gttgagtatg tcttgaatgt actttgtttg 20040 gctgatgaag gtgccatctt ggagttgctt gacttgaaat cctagaaaat atttcaactt 20100 ccccatcata gacatctcga attcggaat catgatccta ctaaactctt cacaagtaga 20160 tttgttagta gacccaaata tatatcatc aacataaatt tggcatacaa acaaaacttt 20220 tgaaatggtt ttagtaaaga gagtaggatc ggctttactg actctgaagc cattagtgat 20280 aagaaaatct cttaggcatt cataccatgc tgttggggct tgcttgagcc cataaagcgc 20340 ctttgagagt ttataaacat ggttagggta ctcactatct tcaaagccga gaggttgctc 20400 aacatagacc tattcacccc atttgatcac ttttttggtc cttcaggatc tatagttat 20460 gtataattta gagtctcttg tttaatggcc agatatttct aattaatcta agaatttatg 20520 atatttttta attttttatc atgtctgatg agaattaaca taaaggctca attgggtcct 20580 gaattaataa tagagtgaaa attaatccag aggctctatt agaaccttca attagtaata 20640 ccaagatata tataagatag tagagtatag tttaaatgtt ggcattgttc attctttctt 20700 ttgttattta attatgctt tccacggtgg tgtggtta cttctgaagg gtccaaataa 20760 tgcatgaaga gtttgaggac aagaagtctg ccctaaaaat agcgatgcaa aggcatggtg 20820 tccaagccat acatatagcg cactaattttt atcagcagaa caatggtatt tataggtcct 20880 agtgcccagg caacaagaga cacgaataaa gcatcgatca cgacaagatg ctgtgtctca 20940 cctcctcttc ctcctcgcg cccgctcgc tccttccctc tctcgctgat cgaccgagcc 21000 caggaatcgc gggcgggggt ggcaatgttc gcctgagcgt ggtttcttcg ccgcggcggt 21060 cgtggcctgg aaaggtcaag accaatttct cagttcctgc gactgcgcga aaaaaaaa 21120 ccatggtgac tgttgtggag gagatcgctt gttctggtac tggatctgga tttgaaatat 21180 tgtgtcaagg atttaactgg gaatctcata agtcaggaaa atggtatgtg gaacttggct 21240 caaaggccaa ggagttgtca tccatgggtt tcaccattgt ctggtcacca ccacctactg 21300 attctgtgtc gcctgaagga tacatgccaa gggatttgta taatctaaat tccagatatg 21360 ggaccatgga agagttgaag gaggctgtga aacgttttca tgaagccggt atgaaggttc 21420 ttggtgatgc cgtcctgaat cacaggtgtg ctcaatttca gaaccaaaat ggcgtctgga 21480 atatttttgg tggacgcctt aactgggatg atcgagcagt tgttgcagat gatccacatt 21540 tccagggaag aggaaacaag agcagtggag ataacttcca tgcagcccca aacattgatc 21600 actcgcaaga gtttgtgagg agtgatctta aagaatggct ttgttggatg agaaaggaag 21660 ttggatacga tggatggcga cttgattttg ttcgcggatt ttggggtgga tatgtccacg 21720 attacttgga agcaagcgaa ccatattttg footggaga gtactgggat tctctcagtt 21780 acacctatgg tgaaatggat tataatcaag atgcccacag gcagagaata gttgattgga 21840 taaatgctac aaatggaact gctggtgcat ttgatgttac cacgaaagga atacttcact 21900 ctgcactgga aagatctgag tactggcgtc tgtctgatga aaaaggaaaa ccccctggag 21960 tgttaggttg gtggccttcg cgtgctgtca catttataga aaatcatgac actggttcta 22020 ctcagggtca ttggagattc ccctttggta tggagttgca aggctatgtc tacatcttaa 22080 ctcacccagg cactcctgca atcttctatg attemanatt ttcgcattta cagccagaga 22140 ttgctaaatt aatttctatt agaaatcgcc aaaagatcca ttgccgtagc aagatcaaga 22200 tactgaaagc agagggaaat ttatatgcgg cagagattga tgagagggta acaatgaaga 22260 ttggcgcagg acattttgag ccaagcggcc ccacaaactg ggtagttgct gccgagggac 22320 aggattacaa ggtctgggaa gtgtcatcgt agacttgccg cgctggtact tgcagaactt 22380 ctattgtaga cagtatacaa ccattcggta tagctcacaa aagggatcgt tcaaacattt 22440 ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atkatataat 22500 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 22560 gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 22620 fathercgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatctac 22680 gtaaagctta gattgtcgtt tcccgccttc agtttaaact atcagtgttt gacaggatat attggcgggt aaacctaaga gaaagagcg tttattagaa taacggatat ttaaaaagggc gtgaaaaggt ttatccgttc gtccatttgt atgtgcatgc caaccacagg gttcccctcg ggatcaaagt actttgatcc aacccctccg ctgctatagt gcagtcggct tctgacgttc 22920. agtgcagccg tcttctgaaa acgacatgtc gcacaagtcc taagttacgc gacaggctgc cgccctgccc ttttcctggc gttttcttgt cgcgtgtttt agtcgcataa agtagac 23040 ttgcgactag aaccggagac attacgccat gaacaagagc gccgccgctg gcctgctggg 23100 ctatgcccgc gtcagcaccg acgaccagga cttgaccaac caacgggccg aactgcacgc ggccggctgc accaagctgt tttccgagaa gatcaccggc accaggcgcg accgcccgga 23220 gctggccagg atgcttgacc acctacgccc tggcgacgtt gtgacagtga ccaggctaga 23280 ccgcctggcc cgcagcaccc gcgacctact ggacattgcc gagcgcatcc aggaggccgg 23340 cgcgggcctg cgtagcctgg cagagccgtg ggccgacacc accacgccgg ccggccgcat 23400 ggtgttgacc gtgttcgccg gcattgccga gttcgagcgt tccctaatca tcgaccgcac 23460 ccggagcggg cgcgaggccg ccaaggcccg aggcgtgaag tttggccccc gccctaccct 23520 caccccggca cagatcgcgc acgcccgcga gctgatcgac caggaaggcc gcaccgtgaa 23580 agaggcggct gcactgcttg gcgtgcatcg ctcgaccctg taccgcgcac ttgagcgcag 23640 cgaggaagtg acgcccaccg aggccaggcg gcgcggtgcc ttccgtgagg acgcattgac 23700 cgaggccgac gccctggcgg ccgccgagaa tgaacgccaa gaggaacaag catgaaaccg 23760 caccaggacg gccaggacga accgtttttc attaccgaag agatcgaggc ggagatgatc 23820 gcggccgggt acgtgttcga gccgcccgcg cacgtctcaa ccgtgcggct gcatgaaatc 23880 ctggccggtt tgtctgatgc caagctggcg gcctggccgg ccagcttggc cgctgaagaa 23940 accgagcgcc gccgtctaaa aaggtgatgt gtatttgagt aaaacagctt gcgtcatgcg 24000 gtcgctgcgt atatgatgcg atgagtaaat aaacaaatac gcaaggggaa cgcatgaagg 24060 ttatcgctgt acttaaccag aaaggcgggt caggcaagac gaccatcgca acccatctag 24120 cccgcgccct gcaactcgcc ggggccgatg ttctgttagt cgattccgat ccccagggca 24180 gtgcccgcga ttgggcggcc gtgcgggaag atcaaccgct aaccgttgtc ggcatcgacc 24240 gcccgacgat tgaccgcgac gtgaaggcca tcggccggcg cgacttcgta gtgatcgacg 24300 gagcgcccca ggcggcggac ttggctgtgt ccgcgatcaa ggcagccgac ttcgtgctga 24360 ttccggtgca gccaagccct tacgacatat gggccaccgc cgacctggtg gagctggtta 24420 agcagcgcat tgaggtcacg gatggaaggc tacaagcggc ctttgtcgtg tcgcgggcga 24480 tcaaaggcac gcgcatcggc ggtgaggttg ccgaggcgct ggccgggtac gagctgccca 24540 ttcttgagtc ccgtatcacg cagcgcgtga gctacccagg cactgccgcc gccggcacaa 24600 ccgttcttga atcagaaccc gagggcgacg ctgcccgcga ggtccaggcg ctggccgctg 24660 aaattaaatc aaaactcatt tgagttaatg aggtaaagag aaaatgagca aaagcacaaa 24720 cacgctaagt gccggccgtc cgagcgcacg cagcagcaag gctccaacgt tggccagcct 24780 ggcagacacg ccagccatga agcgggtcaa ctttcagttg ccggcggagg atcacaccaa 24840 gctgaagatg tacgcggtac gccaaggcaa gaccattacc gagctgctat ctgaatacat 24900 cgcgcagcta ccagagtaaa tgagcaaatg ataaatgag tagatgaatt ttagcggcta 24960 aaagggcgg catggaaaat caagaacaac caggcaccga cgccgtggaa tgccccatgt 25020 gtgggaac gggcggttgg ccaggcgtaa gcggctgggt tgtctgccgg ccctgcaatg 25080 gcactggaac ccccaagccc ggagaatcgg cgtgacggtc gcaaaccatc cggcccggta 25140 caaatcggcg cggcgctggg tgatgacctg gtggagaagt tgaaggccgc gcaggccgcc 25200 cagcggcaac gcatcgaggc agaagcacgc cccggtgaat cgtggcaagc ggccgctgat 25260 cgaatccgca aagaatcccg gcaaccgccg gcagccggtg cgccgtcgat taggaagccg 25320 cccaagggcg acgagcaacc agattttttc gttccgatgc tctatgacgt gggcacccgc 25380 gatagtcgca gcatcatgga cgtggccgtt ttccgtctgt cgaagcgtga ccgacgagct 25440 ggcgaggtga tccgctacga gcttccagac gggcacgtag aggtttccgc agggccggcc 25500 ggcatggcca gtgtgtggga ttacgacctg gtactgatgg cggtttccca tctaaccgaa 25560 tccatgaacc gataccggga agggaagga gacaagcccg gccgcgtgtt ccgtccacac 25620 gttgcggacg tactcaagtt ctgccggcga gccgatggcg gaaagcagaa agacgacctg 25680 gtagaaacct gcattcggtt aaacaccacg cacgttgcca tgcagcgtac gaagaaggcc 25740 aagaacggcc gcctggtgac ggtatccgag ggtgaagcct tgattagccg ctacaagatc 25800 gtaaagagcg aaaccgggcg gccggagtac atcgagatcg agctagctga ttggatgtac 25860 cgcgagatca cagaaggcaa gaacccggac gtgctgacgg ttcaccccga ttactttttg 25920 atcgatcccg gcatcggccg ttttctctac cgcctggcac gccgcgccgc aggcaaggca 25980 gaagccagat ggttgttcaa gacgatctac gaacgcagtg gcagcgccgg agagttcaag 26040 aagttctgtt tcaccgtgcg caagctgatc gggtcaaatg acctgccgga gtacgatttg 26100 aaggaggagg cggggcaggc tggcccgatc ctagtcatgc gctaccgcaa cctgatcgag 26160 ggcgaagcat ccgccggttc ctaatgtacg gagcagatgc tagggcaaat tgccctagca 26220 ggggaaaaag gtcgaaaagg tctctttcct gtggatagca cgtacattgg gaacccaaag 26280 ccgtacattg ggaaccggaa cccgtacatt gggaacccaa agccgtacat tgggaaccgg 26340 tcacacatgt aagtgactga tataaagag aaaaaaggcg atttttccgc ctaaaactct 26400 ttaaaactta ttaaaactct taaaacccgc ctggcctgtg cataactgtc tggccagcgc 26460 acagccgaag agctgcaaaa agcgcctacc cttcggtcgc tgcgctccct acgccccgcc 26520 gcttcgcgtc ggcctatcgc ggccgctggc cgctcaaaaa tggctggcct acggccaggc 26580 aatctaccag ggcgcggaca agccgcgccg tcgccactcg accgccggcg cccacatcaa 26640 ggcaccctgc ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 26700 ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agaaagccc gtcagggcgc 26760 gtcagcgggt gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg 26820 agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 26880 cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct 26940 tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 27000 tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 27060 gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 27120 aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 27180 ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 27240 gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 27300 ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 27360 ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 27420 cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 27480 attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 27540 ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 27600 aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggtttttt 27660 gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 27720 tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgcat 27780 tctaggtact aaaacaattc atccagtaaa atataatatt ttattttctc ccaatcaggc 27840 ttgatcccca gtaagtcaaa aatagctcg acatactgtt cttccccgat atcctccctg 27900 atcgaccgga cgcagaaggc aatgtcatac cacttgtccg ccctgccgct tctcccaaga 27960 tcaataaagc cacttacttt gccatctttc acaaagatgt tgctgtctcc caggtcgccg 28020 tgggaaaaga caagttcctc ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc 28080 ggatctttaa atggagtgtc ttcttcccag tttcgcaat ccacatcggc cagatcgtta 28140 ttcagtaagt aatccaattc ggctaagcgg ctgtctaagc tattcgtata gggacaatcc 28200 gatatgtcga tggagtgaaa gagcctgatg cactccgcat acagctcgat aatcttttca 28260 gggctttgtt catcttcata ctcttccgag caaaggacgc catcggcctc actcatgagc 28320 agattgctcc agccatcatg ccgttcaaag tgcaggacct ttggaacagg cagctttcct 28380 tccagccata gcatcatgtc cttttcccgt tccacatcat aggtggtccc tttataccgg 28440 ctgtccgtca tttttaaata taggttttca ttttctccca ccagcttata taccttagca 28500 ggagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt tttcaattcc 28560 ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag tatttaaaga 28620 taccccaaga agctaattat aacaagacga actccaattc actgttcctt gcattctaaa 28680 accttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg tataacatag 28740 tatcgacgga gccgattttg aaaccgcggt gatcacaggc agcaacgctc tgtcatcgtt 28800 acaatcaaca tgctaccctc cgcgagatca tccgtgtttc aaacccggca gcttagttgc 28860 cgttcttccg aatagcatcg gtaacatgag caaagtctgc cgccttacaa cggctctccc 28920 gctgacgccg tcccggactg atgggctgcc tgtatcgagt ggtgattttg tgccgagctg 28980 ccggtcgggg agctgttggc tggctggtgg caggatatat tgtggtgtaa aca 29033 <210> 2 <211> 4487 <212> DNA <213> Artificial Sequence <400> 2 gcaccggaca ctgtctggtg gcataccaga cagtccggtg tgccagatca gggcaccctt 60 cggttccttt gctcctttgc ttttgaaccc taactttgat cgtttattgg tttgtgttga 120 acctttatgc acctgtggaa tatataatct agaacaaact agttagtcca atcatttgtg 180 ttgggcattc aaccaccaaa attatttata ggaaaaggtt aaaccttatt tccctttcaa 240 tctccccctt tttggtgatt gatgccaaca caaaccaaag aaaatatata agtgcagaat 300 tgaactagtt tgcataaggt aagtgcatag gttacttaga attaaatcaa tttatacttt 360 tacttgatat gcatggttgc tttcttttat tttaacattt tggaccacat ttgcaccact 420 tgttttgttt tttgcaaatc tttttggaaa ttctttttca aagtcttttg caaatagtca 480 aaggtatatg aataagattg taagaagcat tttcaagatt tgaaatttct ccccctgttt 540 caaatgcttt tcctttgact aaacaaaact ccccctgaat aaaattctcc tcttagcttt 600 caagagggtt ttaaatagat atcaattgga aatatattta gatgctaatt ttgaaaatat 660 accaattgaa aatcaacata ccaatttgaa attaaacata ccaatttaaa aaatttcaaa 720 aagtggtggt gcggtccttt tgctttgggc ttaatatttc tccccctttg gcattaatcg 780 ccaaaaaacgg agactttgtg agccatttat actttctccc cattggtaaa tgaaatatga 840 900 cgttagagtg gagtggaagc cttgtcttcg ccgaagactc catttccctt tcaatctacg 960 acttagcata gaatacact tgaaaacaca ttagtcgtag ccacgaaaga gatatgatca 1020 aaggtataca aatgagctat gtgtgtaatg tttcaatcaa agtttcgaga atcaagaata 1080 tttagctcat tcctaagttt gctaaaggtt ttatcatcta atggtttggt aaagatatcg 1140 actaattgtt ctttggtgct aacataagca atctcgatat cacccctttg ttggtgatcc ctcaaaaagt gataccgaat gtctatgtgc ttagtgcggc tgtgttcaac gggattatcc gccatgcaga tagcactctc attgtcacat agggaggga ctttgctcaa tttgtagcca tagtccctaa ggttttgcct catccaaagt aattgcacac aacaatgtcc tgcggcaata tacttggctt cggcggtaga aagagctatt gagttttgtt tctttgaagt ccaagacacc agggatctcc ctagaaactg acaagtccct gatgtgctct tcctatcaat tttacaccct gcccaatcgg catctgaata tcctattaaa tcaaaggtgg atcccttggg gtaccaaaga ccaaatttag gagtgtaaac taaatatctc atgattcttt tcacggccct aaggtgaact tccttaggat cggcttggaa tcttgcacac atgcatatag aaagcatact atctggtcga gatgcacata aatagagtaa agatcctatc atcgaccggt ataccttttg gtctacggat 1740 ttacctcccg tgtcgaggtc gagatgccca ttagttccca tgggtgtcct gatgggcttg 1800. gcatccttca ttccaaactt gttgagtatg tcttgaatgt actttgtttg gctgatgaag gtgccatctt ggagttgctt gacttgaaat cctagaaaat atttcaactt ccccatcata 1920 gacatctcga atttcggaat catgatccta ctaaactctt cacaagtaga tttgttagta 1980 gacccaaata tatatcatc aacataaatt tggcatacaa acaaaacttt tgaaatggtt 2040 ttagtaaaga gagtaggatc ggctttactg actctgaagc cattagtgat aagaaaatct 2100 cttaggcatt cataccatgc tgttggggct tgcttgagcc cataaagcgc ctttgagagt 2160 ttataaacat ggttagggta ctcactatct tcaaagccga gaggttgctc aacatagacc 2220 tattcacccc atttgatcac ttttttggtc cttcaggatc tatagttat gtataattta 2280 gagtctcttg tttaatggcc agatatttct aattaatcta agaatttatg atatttttta 2340 attttttatc atgtctgatg agaattaaca taaaggctca attgggtcct gaattaataa 2400 tagagtgaaa attaatccag aggctctatt agaaccttca attaattaata ccaagatata 2460 tataagatag tagagtatag tttaaatgtt ggcattgttc attctttctt ttgttattta 2520 attatgctt tccacggtgg ttagtggtta cttctgaagg gtccaaataa tgcatgaaga 2580 gttgaggac aagaagtctg ccctaaaaat agcgatgcaa aggcatggtg tccaagccat 2640 acatatagcg cactaattttt atcagcagaa caatggtatt tataggtcct agtgcccagg 2700 caacaagaga cacgaataaa gcatcgatca cgacaagatg ctgtgtctca cctcctcttc 2760 ctcctccgg cccgctccgc tcttccctc tctcgctgat cgaccgagcc caggaatcgc 2820 gggcgggggt ggcaatgttc gcctgagcgt ggtttcttcg ccgcggcggt cgtggcctgg 2880 aaaggtcaag accaatttct cagttcctgc gactgcgcga aaaaacaaaa ccatggtgac 2940 tgttgtggag gagatcgctt gttctggtac tggatctgga tttgaaatat tgtgtcaagg 3000 atttaactgg gaatctcata agtcaggaaa atggtatgtg gaacttggct caaaggccaa 3060 ggagttgtca tccatgggtt tcaccattgt ctggtcacca ccacctactg attctgtgtc 3120 gcctgaagga tacatgccaa gggatttgta taatctaaat tccagatatg ggaccatgga 3180 agagttgaag gaggctgtga aacgttttca tgaagccggt atgaaggttc ttggtgatgc 3240 cgtcctgaat cacaggtgtg ctcaatttca gaaccaaaat ggcgtctgga atatttttgg 3300 tggacgcctt aactgggatg atcgagcagt tgttgcagat gatccacatt tccagggaag 3360 aggaaacaag agcagtggag ataacttcca tgcagcccca aacattgatc actcgcaaga 3420 gtttgtgagg agtgatctta aagaatggct ttgttggatg agaaaggaag ttggatacga 3480 tggatggcga cttgattttg ttcgcggatt ttggggtgga tatgtccacg attacttgga 3540 agcaagcgaa ccatattttg footggaga gtactgggat tctctcagtt acacctatgg 3600 tgaaatggat tataatcaag atgcccacag gcagagaata gttgattgga taaatgctac 3660 aaatggaact gctggtgcat ttgatgttac cacgaaagga atacttcact ctgcactgga 3720 aagatctgag tactggcgtc tgtctgatga aaaaggaaaa ccccctggag tgttaggttg 3780 gtggccttcg cgtgctgtca catttataga aaatcatgac actggttcta ctcagggtca 3840 ttggagattc ccctttggta tggagttgca aggctatgtc tacatcttaa ctcacccagg 3900 cactcctgca atcttctatg atcatatatt ttcgcattta cagccagaga ttgctaaatt 3960 aatttctatt agaaatcgcc aaaagatcca ttgccgtagc aagatcaaga tactgaaagc 4020 agagggaaat ttatatgcgg cagagattga tgagagggta acaatgaaga ttggcgcagg 4080 acattttgag ccaagcggcc ccacaaactg ggtagttgct gccgagggac aggattacaa 4140 ggtctgggaa gtgtcatcgt agacttgccg cgctggtact tgcagaactt ctattgtaga 4200 cagtatacaa ccattcggta tagctcacaa aagggatcgt tcaaacattt ggcaataaag 4260 tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat ttctgttgaa 4320 ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga gatgggtttt 4380 tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa tatagcgcgc 4440 aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatc 4487 <210> 3 <211> 3777 <212> DNA <213> Artificial Sequence <400> 3 gataatgaca gcctaggcgg aggtgcggta aagcttgccg aaaacatgca gaagagcaac 60 gacggcaatg aacccaatgc tcatgatgag gactgagttc ggggacatct tgcgcccagc 120 agcctcatcg gtgtagaact ggagcattgt gctggcaccg cctccaccag tgccactgct 180 ggtggttcta cgcctgcgca agcttgcagc agctgctgca ctccttag ccggggcatc 240 tccattggcc accatcttgc tttatccctc tgcatgataa tatgagtttc aaatgtaagg 300 tttgcagcac taatattaca gaaaaccac agaacacag agtttcatcc aaagtcgtat 360 tgcatataca taggagtgt taaaatatgt ctatcatttt ggaagatacg gtttatgctg 420 tcacacagca tttggaagt gactatttta taagcacaga agttcttca atgtggaata 480 tgtcaaagg caaataga agcacagaag ttctcaat gtggaatg tcagaaggca 540 gaataggta cacatcttgg aagtgtatga tagtactaca ccaataccag tgaagtttta 600 gttgtcacat tgagtgcta aaaaatat aaaaaagaaa tgttgctgt tgctcatgcc 660 tatatacatt cataatctat storm gctcctggat gctgcatac tatacataa 720 caagcttaag tttaatttac cacagaaaaaaaaaatga caactagtcc cagaattctg 780 ctgaaaaatt tgggctgt cctgggctg gccaaacacc cattgacatg atgctgccca 840 agtgtaagaa ctgtaaaaa agtatagtgt ctgtgtatgt acagggatgg cagcatattc 900 attgctgcaa cacaacctac gctacatgaa accaatttct tacgctggaa tatgacaaa 960 cacaatggag gagagatttc gtatagaat ttgagcaa tatgttggta cggacaaat 1020 gatcccccac aaaatccgc aggaagagatc atgagtgaca cgcgatatat gaggtacac 1080 acgaacatct tatcagaat tcagatccat tcccagatcc tgacaagca ctagaactac 1140 aacagaaata cttcgataaa acatcgat ttcctcat vakacatcct aacatcacat 1200 haaacccccc gcagccaatc tgaattctga acagcagat ctggaacaga agcggtaccc 1260 atcccagaat tctaaatcgg ccaaccaa caagcccgat ctaagacatc gattcacat 1320 gaacgcgtac ggaatcaag caggctaatc ggagagatgg cgaaagagg atgatttcg 1380 cgcgcacctg atgaatctgc cctgcgccaa tcgctcgtgc tcccgtccca acttggtcac 1440 tcgtctctc gcccgaaat ctgagtgcgg aattcagaat tctctccgcg tctgaacccg 1500 cgcgctgata tcaccac tggctggatt aacggggttcc gttcagatc cgaatcaag 1560 tgacgtggtc ggcgcgatct gattggccgg agcgcgtctc cgcgcgtcga tctgagccgt 1620 ccgattcgtt gccgggtccc gatcgcgcgg cctggtgtga aacgggtggc gtcaccgcgt 1680 gcggcgtggc actgtgacgt ggcaacggtt atgcggttat gcacagtcat gggctggacc 1740 ttttggccca acatctgtgg actcgtggac cgggtttcgg cccttttatc cgctctacgg 1800 acgcagtcca cgtcagccga cgtgggtccc accacgaagg gcgtgcctcc ctctaaaaat 1860 tgccaatgac gataagagca aagacggacg ggaggggagg ggtccaaatt aaaactccaa 1920 aatccattcg aacagcgaag gaaatttgtt ggaaaattttt gagatttgga tttttgttct 1980 aggagagggg aaggttagaa gaagttgaga tcggtggaga actggagatc gaggggagat 2040 gctgtgtctc acctcctct cctcctcgc gcccgctccg ctccttccct ctctcgctga 2100 tcgaccgagc ccaggaatcg cgggcggggg tggcaatgtt cgcctgagcg tggttctttc 2160 gccgcgccgg tcgtggcctg gaaaggtcaa gaccaatttc tcagttcctg cgactgcgcg 2220 aaaaaaaaa accatggtga ctgttgtgga ggagatcgcg tccggccacc aagtcctctt 2280 tcaggggttc aactgggagt cgtggaagca gagcggcggg tggtacaaca tgatgatggg 2340 caaggtcgac gacatcgccg ctgccggagt cacccacgtc tggctgccac cgccgtcgca 2400 ctccgtctcc aacgaaggtt acatgcctgg tcggctgtac gacatcgacg cgtccaagta 2460 cggcaacgcg gcggagctca agtcgctcat cggcgcgctc cacggcaagg gcgtgcaggc 2520 catcgccgac atcgtcatca accaccgctg cgccgactac aaggatagcc gcggcatcta 2580 ctgcatcttc gagggcggca cctccgacgg ccgcctcgac tggggccccc acatgatctg 2640 tcgcgacgac accaaatact ccgatggcac cgcaaacctc gacaccggag ccgacttcgc 2700 cgccgcgccc gacatcgacc acctcaacga ccgggtccag cgcgagctca aggagtggct 2760 cctctggctc aagagcgacc tcggcttcga cgcgtggcgc cttgacttcg ctaggggcta 2820 ctcgccggag atggccaagg tgtacatcga cggcacatcc ccgagcctcg ccgtggccga 2880 ggtgtgggac aatatggcca ccggcggcga cggcaagccc aactacgacc aggacgcgca 2940 ccggcagaat ctggtgaact gggtggacaa ggtgggcggc gcggcctcgg caggcatggt 3000 gttcgacttc acgaccaaag ggatactgaa cgctgccgtg gagggcgagc tgtggaggct 3060 gatcgacccg caggggaagg cccccggcgt gatgggatgg tggccggcca aggccgccac 3120 cttcgtcgac aaccacgata caggctccac gcaggccatg tggccattcc cctccgacaa 3180 ggtcatgcag ggctacgcgt acatcctcac ccaccccggc atcccatgca tcttctacga 3240 ccatttcttc aactgggggt ttaaggacca gatcgcggcg ctggtggcga tcaggaagcg 3300 caacggcatc acggcgacga gcgccctgaa gatcctcatg cacgaaggag atgcctacgt 3360 cgccgagata gacggcaagg tggtggtgaa gatcgggtcc aggtacgacg tcggggcggt 3420 gatcccggcc gggttcgtga cctcggcaca cggcaacgac tacgccgtct gggagaagaa 3480 cggtgccgcg gcaacactac aacggagctg aagtctgcac tgatccgtca ttcgatcgga 3540 caaagcagca ttagtccgtt gatcggtgga agaccactcg tcagtgttga gttgaatgtt 3600 tgatcaataa aatacggcaa tgctgtaagg gttgtttttt atgccattga taatacactg 3660 tactgttcag ttgttgaact ctatttctta gccatgccaa gtgcttttct tattttgaat 3720 3777. aacattacag caaaagttg aaagacaaaa aaaaaaccc ccgaacagag tgctttg <210> 4 <211> 4460 <212> DNA <213> Artificial Sequence <400> 4 gacaaatttg tttgtcagat caaattttta agcaaaacat aagaaacagc acaaaagggt 120. atagcagaag caaaatttgg acacaatgat tagggatcac ttattcatta tagttcttcc atgctgctct accacagcaa aacgtttcag accacaccc accagactta aggatacaca ttacaggtaa atagtacaca atgaaacggg acacgacca ggaccagacc agacaaccat agctccattg gggaagacaa ataggcagac ttgtgaaccc tagaacagca gcagctctat ggctgaggac ggtacctcta gaggcgcgcc cactttgtga ggcctttaat acacagtcct 360 gccatcacca tccaggatca tgtccttga tgcgccccca attgggatca taggcagcac 420 atgctcctgg tgcgggacga tgatatccaa caagtatggc cctggagtct cgagcatctt 480 cttgatggcg gcacggactt cactcttctt tgttacacgg actgccgga tattgaaccc 540 cttagcaata gtcacaaaat ctggatatat ctcgctctca cattccgggt tgcccaagta 600 tgtatgcgcc ctattcgcct tgtaaaacct atcctccaat tgcaccacca tacccaaatg 660 ttggttgttc aacaccatca ccttcacagg gaggttctca atgcggatca atgccagctc 720 ctgaatgttc atgaggaagc taccatcccc atcaatatca acaactgtga cacctgggtt 780 agccacagaa gcaccagctg cggcaggcag cccaaatccc attgcgccca gaccagccga 840 agacagccac tgccgtggcc gcttgtaggt gtaatattgt gccgcccaca tctggtgctg 900 cccaacacca gtagcgatga ttgcctcacc tttcgtcagc tcatccagca cctgaatggc 960 atattgcggt gggatctctt caccaaaagt tttgtacccc agaggaaact ccctcttctg 1020 ctggtccaac tcattgtgcc atgcactaaa atcagaactt gtctttgttg tgctctgttg 1080 tagcagagca ttcaagccct gtaaagcgag cttaacatct gcgcaaattg acacatgtgg 1140 ttgcttgttc tttccaatct ctgctggatc aatgtcaatg tgcacaatct tggccctgct 1200 tgcaaaagcc tcaattttcc ctgtcacacg atcatcaaac cgcacaccaa acgcaagcaa 1260 caggtcagcc ttatccacgg cataatttgc gtacaccgtg ccatgcatcc caagcatccg 1320 cagggacaac gggtcgtcac tggggaaatt gccgaggccc atcagagtgg ttgtaactgg 1380 gataccagtc agctcaacaa accagcgcaa ttcgtcacca gatgcagagc agccaccacc 1440 gacatagaga atcgggcgcc gtgactcgcc aaccagacgc aagacctgct caagcaattc 1500 tgtcgcgggt ggcttgggca ggcgtgcgat gtaccctggt agattcatcg aggtgtccca 1560 gaccggcacg gccatctgct gctggatgtc cttggggatg tccaccagca ccgggccagg 1620 acggcccgag gacgcgagga agaaggcttc ctgtatgacg cgggggatgt cctccacatc 1680 aaggacaagg taattgtgct tggtgatgga gcgggtgacc tcgactatgg gcgtctcctg 1740 gaaggcgtcg gtgccgatca tgcggcgggg gacctggccc gtgatggcga ccatcgggac 1800 ggagtcgagc agcgcgtcgg cgagcgcgga cacgaggttg gttgcgccgg ggccggaggt 1860 ggcgacgcag accccgacgc ggccggacgc gcgcgcgtac ccggacgccg cgaacgcctc 1920 gccctgctcg tggcggaaga ggtggttggt gatgaccggg gagcgcgtca gcgcctggtg 1980 gatctccatc gacgcgccgc ctgggtaggc gaacacgtcg ctgacgccgc accgctccag cgcctccacg aggatgtccg cgcccttgcg gggctcggcc ggcccccacg gccggagcgg 2100 cgtggccggc ggcgccgggg acggcggggt gaccggggac accgccgagc acctgaccgc 2160 cgccgccccc acccggcctc gagcgggag gacgtggtgt cgctggtggt tcttacggcc 2220. ggtcttggcc gtcgcggcgg cggacagggc ggcggccgcg gccgcggcgg tcgtagccat 2280 ggtgggtggt ggcggcggcg gcggcggcga gggtttctgg gtttgggcga gagggaga 2340 ggggtggaga gtgtgggggt gtgggtgttt tgtccgcgcg cggtgacgca gcgtgaggcg 2400. atgtgtggct cggatgggat cgtgtggggc cacgtcacag tgggccccat atgtcggtgg 2460 gataggatga cacacagcca cgtcggggtc gatctgggcc cgcgtgtcag tcgattggat 2580. gaggatgaca ggtgggtcag tcccaatac gggtggaggg tacagaaccc gataaaaaat cgatctcaaa gtcggatgcg gatgcaaccg cgagacctag cagtctagca cccgcacccg cacccgcaca aacgcagcgc aagatgagca gtggcggcga gagtccggc tcgggcggcg gcggcggtgg cggcggcggc ggggcggtga agacgccctc cgacttctc aagtccatca 2760 ggggggcgcc cgtcgtcgtc aagctcaact ccggcgtcga ctaccgcggt aaccccctgc 2820 tcaattccct cccccttttt gcctcaaccc tagacccgcc tcccgaaaac cctagcacga 2880 gacgaatgcg atgtttgttg taccccgtat ctctttctcc ttaattggaa ctctgcgttt 2940 cttttcgtta attagtgggg ggaaggaag gcgtggactc tgtaggattt tcttttcgat 3000 ttgatgacca agggagatac ttatttagt gctgtttaag atcctgctag tgcccggtgt 3060 agctaggcca tttgagaagc agataaccgt gtttttctgt aggaccttct ctaatcttga 3120 gctattttga tattctaatt acttatggtt aaaccctaga acctcagtat gttttaactt 3180 agtaagagat tgctacagta ttttttg taggaacaac attgtaggtg gttatcatgc 3240 tactgactgt cttgtgtaga gccctcctat cattaagggg cttttatgtt tactaatagt 3300 tagttttagt acccattttt ctgtgagcta ctaaaaaagaa tatttccaat tcaacctatg 3360 gtaatttaaa gtactttatg ctgtatgtcc atttactgag gattatgatt aatatttaag 3420 agggaggaca tctgtgctta agttttgcat tgcaatatttt gatagattta tgctaaacaa 3480 aggtaattgt gcatgcttga gatagaagg gatttccctt ctttggtttt gataatagg 3540 ggttggcatt ccatgatcag gagcatagtg catttatatt ttataatgtg gctatgtgta 3600 tgcagttctc aatttcacat tggcggtaca cccatgatat atttaattgt tacccagaac 3660 catataatag cctaataaga gcatatgta ttccattgat tggggccttc ggaagtgtac 3720 ctgtgtatgt aactatgcat ataaggttta ctttctgta gttctttctt ctcctcatca 3780 cttaagacat ctggatcgct gttatcaagt cgtagactag tcataacgtc agtcaagtca 3840 gacgactga gggtacgac tcgaccaat agcaagtcgc acaattagtc gtagattagt 3900 catagcaaat catcatttca ccatgctaat tggcttattg tgtttagtac tttaaattta 3960 tttcttgtta acttattgtc ttgctggcta ctccataaac cgtagtttat atactatat 4020 atagtgctta gtacaataga atagtactag agactatata gtgcatccat tgttttcaca 4080 cgaccaaatc atggactagt cgtggactag attttgaatg gaacagtttt accagaaata 4140 cacttgttct ttttttttct gaatagtgtt gaatcagtag ctgcaatgca tagcttgtgc 4200 aataaaatca ttatatacta tcaccaattt catggaatct tacttattgg aaatttgtaa 4260 caaatctatt ttatcccctg agttaccgtg ttggtctaaa atcaactcgc atgtgagaca 4320 agatgaagag gaccatgaag attgcctctt tcatttattc atttgctgac tgcttgcaat 4380 gccactataa acctaatcgg atgactggtt gtcatgtctc cgctaactag agagaaaggg 4440 ggaggagtga agactttacg 4460 <210> 5 <211> 3772 <212> DNA <213> Artificial Sequence <400> 5 cccgatctag taacatagat gacaccgcgc gcgataattt atcctagttt gcgcgctata 60 ttttgttttc tatcgcgtat taaatgtata attgcgggac tctaatcata aaaacccatc 120 tcataaataa cgtcatgcat tacatgttaa ttattacatg cttaacgtaa ttcaacagaa 180 attatatgat aatcatcgca agaccggcaa caggattcaa tcttaagaaa ccacctgcaa 240 gtgacttcct cagcaggcct actagtttta ttgccaaatg tttgaacgat cggggaaatt 300 ccagtgcacc agagtcacag aaacacatca cacattcgtg agctcagctt agccatggat 360 aacgcctaca ttattgccat tctctctgta gctatcctct tcttgctcca ctactacctc 420 ctcggccgcg gcaatggcgg ggcggcgcgg ctgccgccgg gtccaccggc cgtcccgatc 480 ctgggacacc tccacctcgt caagaagccg atgcacgcca ccatgtcccg cctcgccgag 540 cggtacgggc cggtgttctc gctgcgcctc gggtcgcggc gcgccgtggt ggtgtcgtcg 600 ccggggtgcg ccagggagtg cttcaccgag cacgacgtga ccttcgcgaa ccggcccagg 660 ttcgagtcgc agctgctggt ctcgttcaac ggcgccgcgc tcgccacggc gagctacggc 720 gcgcactggc gcaacctccg ccggatcgtc gccgtgcagc tgctctccgc gcaccgcgtc 780 ggcctcatgt ctgaaaatct cgaaacagcc gtgtcatagt caatcattag gtgttatagg 840 aacaatcaaa ggttttttca agtgttaatc ttcatactaa tatatacagt gggtactctt 900 tatctactgc cgtggaactg tcatatttga ttatgaaatt ttagctctag aaaatatttg 960 atcatcaatg tcaagacttt atgaccttgc aaaatacatt tcctaattga gaacagggta 1020 aaattatgaa ctatgcctct gaaccttcat acacaggcag cacatttt gttgtaaaat 1080 tcatcttaat acagcggaa agactgacc agagaaa aagttaaga caggcatata 1140 ctcttgatcc tctaaaagg atgaggcggt acatgatca accatgaca ttaagtgat 1200 acgtggaaca tgagacaca aaatttgtc actggaacat aaatacaaaa agttttgtag 1260 taacttaccg acatgaggcc gacgcggtgc gcggagagca gctgcacggc gacgatccgg 1320 cggaggttgc gccagtgcgc gccgtagctc gccgtggcga gcgcggcgcc gttgaacgag 1380 accagcagct gcgactcgaa cctgggccgg tcgcgagg tcacgtcgtg ctcggtgaag 1440 cactccctgg cgcaccccgg cgacgaccc accacggcgc gccgcgaccc gaggcgcagc 1500 gagacaccg gcccgtaccg ctcggcgagg cgggacatgg tggcgtgcat cggctcttg 1560 acgaggtgga gtgtcccag gatcgggacg gccggtggac ccggcggcag ccgcgccgcc 1620 ccgccattgc cgcggccgag gaggtagtag tggagcaga agaggatagc tacagagaga 1680 atggcaataa tgtaggcgtt atccatggct aagctgagct cacgaatgtg tgatgtgttt 1740 ctgtgactct ggtgcactgg gatccctga gggtcaccg acttcaggtc aagtaacacc 1800 aaaaaaaagg gtgagcatcg aaaaaaaaaaaata gcgtgag 1860 gcaggctaa aaaaatccac atagctgc tgcatatgcc atcatccaag tatatcaaga 1920 tcaaataat tataaaacat acttgtttat tataatagat aggtactca ggttagagca 1980 tatgaataga tgctgcatat gccatcatgt attgcatca gtaaaaccca catcacatg 2040 tatacctatc ctagatcgat atttccatcc atcttaaact cgtaactatg aagatgtatg 2100 acacacacat acagttcca aattataaa tacaccaggt agtttgaac agtattctac 2160 tccgatctag aacgaatgaa cgaccgccca accaccac atcatcaca ccaagcgaac 2220 aaaaagcatc tctgtatatg catcagtaaa acccgcatca acatgtatac ctatcctaga 2280 tcgatatttc catcatcat cttcaatcg taactatgaa tatgtatggc acacatac 2340 agatccaaaa ttaataaatc caccaggtag tttgaacag attctactc cgatctagaa 2400 cgaccgccca accagaccac atcatcacaa ccagacaa aaaaagcatg aaagatgac 2460 ccgacaaaca agtgcacggc atatattgaa ataaaggaaa agggcaaacc aaaccctatg 2520 caaaaaca aaaaaaatca tgaaatcgat cccgtctgcg gaacggctag agccatccca 2580 ggattcccca aagagaaaca ctggcaagtt agcaatcaga acgtgtctga cgtacaggtc 2640 gcatccgtgt acgaacgcta gcagcacgga tctaacaacaa acacggatct aacacaaaca 2700 tgaagaag tagagaactacc gggcccctaac catggaccgg aacgccgatc tagagaaggt 2760 agagagggg ggggggggag gacgagcggc gtaccttgaa gcggaggtgc cgacgggtgg 2820 atttggggga gatctggttg tgtgtgtgtg cgctccgaac aacacgaggt tgggggaaaga 2880 gggtgtggag ggggtgtcta tttattacgg cgggcgagga agggaaagcg aaggagcggt 2940 gggaaggaa tcccccgtag ctgccggtgc cgtgagagga ggaggaggcc gcctgccgtg 3000 ccggctcacg tctgccgctc cgccacgcaa tttctggatg ccgacagcgg agcaagtcca 3060 acggtggagc ggaactctcg agaggggtcc agaggcagcg acagagatgc cgtgccgtct 3120 gcttcgcttg gcccgacgcg acgctgctgg ttcgctggtt ggtgtccgtt agactcgtcg 3180 acggcgttta acaggctggc attatctact cgaaacaaga aaaatgtttc cttagttttt 3240 ttaatttctt aaagggtatt tgtttaattt ttagtcactt tattttattc tattttatat 3300 ctaaattatt aaataaaaaa actaaaatag agttttagtt ttcttaattt agaggctaaa 3360 atagaataaa atagatgtac taaaaaaatt agtctataaa aaccattaac cctaaaccct 3420 aaatggatgt actaataaaa tggatgaagt attatatagg tgaagctatt tgcaaaaaaa 3480 aaggagaaca catgcacact aaaaagataa aactgtagag tcctgttgtc aaaatactca 3540 attgtccttt agaccatgtc taactgttca tttatatgat tctctaaaac actgatatta 3600 ttgtagtact atagattata ttattcgtag agtaaagttt aaatatatgt ataaagatag 3660 ataaactgca cttcaaacaa gtgtgacaaa aaaaatatgt ggtaattttt tataacttag 3720 acatgcaatg ctcattatct ctagagaggg gcacgaccgg gtcacgctgc ac 3772 <210> 6 <211> 1987 <212> DNA <213> Artificial Sequence <400> 6 gatctagtaa catagatgac accgcgcgcg ataatttatc ctagtttgcg cgctatatttt 60 tgttttctat cgcgtattaa atgtataatt gcgggactct aatcataaaa acccatctca 120 taaataacgt catgcattac atgttaatta ttacatgctt aacgtaattc aacagaaatt 180 atatgataat catcgcaaga ccggcaacag gattcaatct taagaaactt tattgccaaa 240 tgtttgaacg atctcagctg tgccccagtt tgctaggcag gtcgcagtac ctggccacag 300 ccatctcgtg ctgctccacg taggctctt tgtcggcctc cttgattctt tccagtctcc 360 tgtccacgaa gtagaagccg ggcatcttga ggttcttagc gggtttcttg gatctgtatg 420 tggtcttgag ggagcagtgc aggtagcccc cgcccacgag cttcagggcc atctggctat 480 ggcctctcag gccgctgtca gcggggtaca gcatctcggt gctggcctcc cagccgagtg 540 tttcttctg catcacaggg ccgttggatg ggaagttgac cccgttgatc ttgacgttgt 600 agatgaggca gccgttctgg aggctggtgt cctgggtagc ggtcagcacg cccccgtct 660 cgtatgtggt gatcctctcc catgtgaagc cctcagggaa ggactgctta aagaagtcgg 720 ggatgccctg ggtgtggttg ataaaggttt tgctgccgta catgaagctg gtagccagga 780 tgtcgaaggc gaaggggaga gggccgccct cgaccacctt gatcttcatg gtctgggtgc 840 cctcgtaggg cttgccttcg cctcggatg tgcacttgaa gtggtggtcg ttcacggtgc 900 cctccatgta gagtttcatg tgcatgttct cggtgatcag cacgctatcc tcacccactg 960 cggaagcgtt gcatgcaaca atagcaagga gagcaaatac gaaaatgatc ttcatttttg 1020 taggattcta ctactatgct tcaactataa tgtttgaatt gtgtgaagga tgaggagggt 1080 tttcattatg cttgtctatt tatagatgtt tccctatcgg ttgctttaga gtgttagttt 1140 tgcttgatgc tatattagga tctaagtgag tcatattatt tggatattct gttaggtgca 1200 cctaaaaatg ttctttgata tcatcatcaa agtaactttt atgcccatca tatatacatg 1260 atggtgagca aaaaaataat gacatgactc atcgctcact ttatgtgtca atgtgataag 1320 gattgcaact tttgaaacta agtttgttat gttttgtaag ctattatttt gataatgcac 1380 tacacgtgga actttacgac tgtgtgggtt tatgctcttt gaattatata atttcagtaa 1440 gaaaaaaaat tatagtatgt tcaatggttt tcattgttcc attaatactc ttgtgaaaac 1500 ttgtttgtga tacgaaataa gttaatgcaa taacttttaa attaactttg cagagcttta 1560 caataactca ccaacttact ctaattgtgg ttggggattg atttaattca tacttttata 1620 gaccaaattg atattgtgtt gctaaataaa aattatagtg gtgttgctac acctacacag 1680 acacagaagg aatcctgata tcatcagcta tctactgctt cctccacatg gactcaagaa 1740 gcagaagcaa aaaagaagaa ggcatttgct ccaacaaagt tttccggtga aaggcaacac 1800 attgttctga acttcctggc atgtattatg tgaatctagc aaattaacca aacattgaca 1860 caatgcgaca ccttgtaatg tagccgtgcc gagaattgta tatctcactt accattgtat 1920 atcacacgtg ccgagaatag gagattgatt tttgccaacc aaaacgctct aggcagacca 1980 attgggc 1987 <210> 7 <211> 6740 <212> DNA <213> Artificial Sequence <400> 7 ctgcaggccc gggcagcgct gaagaacttc cctaggcacg tgtacgtatt ttttaccagg 60 tgaactccaa gtcctggacc cttttttaag cttagattgt cgtttcccgc cttcagttta 120 aactatcagt gtttgacagg atatattggc gggtaaacct aagagaaaag agcgtttatt 180 agaataacgg atatttaaaa gggcgtgaaa aggtttatcc gttcgtccat ttgtatgtgc 240 atgccaacca cagggttccc ctcgggatca aagtactttg atccaacccc tccgctgcta 300 tagtgcagtc ggcttctgac gttcagtgca gccgtcttct gaaaacgaca tgtcgcacaa 360 gtcctaagtt acgcgacagg ctgccgccct gcccttttcc tggcgttttc ttgtcgcgtg 420 ttttagtcgc ataaagtaga atacttgcga ctagaaccgg agacattacg ccatgaacaa 480 gagcgccgcc gctggcctgc tgggctatgc ccgcgtcagc accgacgacc aggacttgac 540 caaccaacgg gccgaactgc acgcggccgg ctgcaccaag ctgttttccg agaagatcac 600 cggcaccagg cgcgaccgcc cggagctggc caggatgctt gaccacctac gccctggcga 660 cgttgtgaca gtgaccaggc tagaccgcct ggcccgcagc acccgcgacc tactggacat 720 tgccgagcgc atccaggagg ccggcgcggg cctgcgtagc ctggcagagc cgtgggccga 780 caccaccacg ccggccggcc gcatggtgtt gaccgtgttc gccggcattg ccgagttcga 840 gcgttcccta atcatcgacc gcaccgggag cgggcgcgag gccgccaagg cccgaggcgt 900 gaagtttggc ccccgcccta ccctcacccc ggcacagatc gcgcacgccc gcgagctgat 960 cgaccaggaa ggccgcaccg tgaaagaggc ggctgcactg cttggcgtgc atcgctcgac 1020 cctgtaccgc gcacttgagc gcagcgagga agtgacgccc accgaggcca ggcggcgcgg 1080 tgccttccgt gaggacgcat tgaccgaggc cgacgccctg gcggccgccg agaatgaacg 1140 ccaagaggaa caagcatgaa accgcaccag gacggccagg acgaaccgtt tttcattacc 1200 gaagagatcg aggcggagat gatcgcggcc gggtacgtgt tcgagccgcc cgcgcacgtc 1260 tcaaccgtgc ggctgcatga aatcctggcc ggtttgtctg atgccaagct ggcggcctgg 1320 ccggccagct tggccgctga agaaaccgag cgccgccgtc taaaaaggtg atgtgtattt 1380 gagtaaaaca gcttgcgtca tgcggtcgct gcgtatatga tgcgatgagt aaataaaacaa 1440 atacgcaagg ggaacgcatg aaggttatcg ctgtacttaa ccagaaaggc gggtcaggca 1500 agacgaccat cgcaacccat ctagcccgcg ccctgcaact cgccggggcc gatgttctgt 1560 tagtcgattc cgatccccag ggcagtgccc gcgattgggc ggccgtgcgg gaagatcaac 1620 cgctaaccgt tgtcggcatc gaccgcccga cgattgaccg cgacgtgaag gccatcggcc 1680 ggcgcgactt cgtagtgatc gacggagcgc cccaggcggc ggacttggct gtgtccgcga 1740 tcaaggcagc cgacttcgtg ctgattccgg tgcagccaag cccttacgac atatgggcca 1800 ccgccgacct ggtggagctg gttaagcagc gcattgaggt cacggatgga aggctacaag 1860 cggcctttgt cgtgtcgcgg gcgatcaaag gcacgcgcat cggcggtgag gttgccgagg 1920 cgctggccgg gtacgagctg cccattcttg agtcccgtat cacgcagcgc gtgagctacc 1980 caggcactgc cgccgccggc acaaccgttc ttgaatcaga acccgagggc gacgctgccc 2040 gcgaggtcca ggcgctggcc gctgaaatta aatcaaaact catttgagtt aatgaggtaa 2100 agaaaaatg agcaaaagca caaacacgct aagtgccggc cgtccgagcg cacgcagcag 2160 caaggctgca acgttggcca gcctggcaga cacgccagcc atgaagcggg tcaactttca 2220 gttgccggcg gaggatcaca ccaagctgaa gatgtacgcg gtacgccaag gcaagaccat 2280 taccgagctg ctatctgaat acatcgcgca gctaccagag taaatgagca aatgaataaa 2340 tgagtagatg aattttagcg gctaaaggag gcggcatgga aaatcaagaa caaccaggca 2400 ccgacgccgt ggaatgcccc atgtgtggag gaacgggcgg ttggccaggc gtaagcggct 2460 gggttgtctg ccggccctgc aatggcactg gaacccccaa gcccgaggaa tcggcgtgac 2520 ggtcgcaaac catccggccc ggtacaaatc ggcgcggcgc tgggtgatga cctggtggag 2580 aagttgaagg ccgcgcaggc cgcccagcgg caacgcatcg aggcagaagc acgccccggt 2640 gaatcgtggc aagcggccgc tgatcgaatc cgcaaagaat cccggcaacc gccggcagcc 2700 ggtgcgccgt cgattaggaa gccgcccaag ggcgacgagc aaccagattt tttcgttccg 2760 atgctctatg acgtgggcac ccgcgatagt cgcagcatca tggacgtggc cgttttccgt 2820 ctgtcgaagc gtgaccgacg agctggcgag gtgatccgct acgagcttcc agacgggcac 2880 gtagaggttt ccgcagggcc ggccggcatg gccagtgtgt gggattacga cctggtactg 2940 atggcggttt cccatctaac cgaatccatg aaccgatacc gggaagggaa gggagacaag 3000 cccggccgcg tgttccgtcc acacgttgcg gacgtactca agttctgccg gcgagccgat 3060 ggcggaaagc agaaagacga cctggtagaa acctgcattc ggttaaacac cacgcacgtt 3120 gccatgcagc gtacgaagaa ggccaagaac ggccgcctgg tgacggtatc cgagggtgaa 3180 gccttgatta gccgctacaa gatcgtaaag agcgaaaccg ggcggccgga gtacatcgag 3240 atcgagctag ctgattggat gtaccgcgag atcacagaag gcaagaaccc ggacgtgctg 3300 acggttcacc ccgattactt tttgatcgat cccggcatcg gccgttttct ctaccgcctg 3360 gcacgccgcg ccgcaggcaa ggcagaagcc agatggttgt tcaagacgat ctacgaacgc 3420 agtggcagcg ccggagagtt caagaagttc tgtttcaccg tgcgcaagct gatcgggtca 3480 aatgacctgc cggagtacga tttgaaggag gaggcggggc aggctggccc gatcctagtc 3540 atgcgctacc gcaacctgat cgagggcgaa gcatccgccg gttcctaatg tacggagcag 3600 atgctagggc aaattgccct agcaggggaa aaaggtcgaa aaggtctctt tcctgtggat 3660 agcacgtaca ttgggaaccc aaagccgtac attgggaacc ggaacccgta cattgggaac 3720 ccaaagccgt acattgggaa ccggtcacac atgtaagtga ctgatataaa agaaaaaa 3780 ggcgattttt ccgcctaaaa ctctttaaaa cttattaaaa ctcttaaaac ccgcctggcc 3840 tgtgcataac tgtctggcca gcgcacagcc gaagagctgc aaaaagcgcc tacccttcgg 3900 tcgctgcgct ccctacgccc cgccgcttcg cgtcggccta tcgcggccgc tggccgctca 3960 aaaatggctg gcctacggcc aggcaatcta ccagggcgcg gacaagccgc gccgtcgcca 4020 ctcgaccgcc ggcgcccaca tcaaggcacc ctgcctcgcg cgtttcggtg atgacggtga 4080 aaacctctga cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg 4140 gaccacaa gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat 4200 gacccagtca cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag 4260 attgtactga gagtgcacca tatgcggtgt gaataccgc acagatgcgt aagagaaaa 4320 taccgcatca ggcgctcttc cgcttctcg ctcactgact cgctgcgctc ggtcgttcgg 4380 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 4440 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 4500 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 4560 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 4620 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 4680 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 4740 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 4800 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 4860 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 4920 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 4980 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 5040 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 5100 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 5160 cgttaaggga ttttggtcat gcattctagg tactaaaaca attcatccag taaataataa 5220 tattttattt tctcccaatc aggcttgatc cccagtaagt caaaaatag ctcgacatac 5280 tgttcttccc cgatatcctc cctgatcgac cggacgcaga aggcaatgtc ataccacttg 5340 tccgccctgc cgcttccc aagatcaata aagccactta ctttgccatc tttcacaaag 5400 atgttgctgt ctcccaggtc gccgtgggaa aagacaagtt cctcttcggg cttttccgtc 5460 tttaaaaaat catacagctc gcgcggatct ttaaatggag tgtctttcttc ccagttttcg 5520 caatccacat cggccagatc gttattcagt aagtaatcca attcggctaa gcggctgtct 5580 aagctattcg tatagggaca atccgatatg tcgatggagt gaaagagcct gatgcactcc 5640 gcatacagct cgataatctt ttcagggctt tgttcatctt catactcttc cgagcaaagg 5700 acgccatcgg cctcactcat gagcagattg ctccagccat catgccgttc aaagtgcagg 5760 acctttggaa caggcagctt tccttccagc catagcatca tgtccttttc ccgttccaca 5820 tcataggtgg tccctttata ccggctgtcc gtcattttta aatatagggtt ttcattttct 5880 cccaccagct tatatacctt agcaggagac attccttccg tatcttttac gcagcggtat 5940 ttttcgatca gttttttcaa ttccggtgat attctcattt tagccattta ttattcctt 6000 cctcttttct acagtattta aagatacccc aagaagctaa ttataacaag acgaactcca 6060 attcactgtt ccttgcattc taaaacctta aataccagaa aacagctttt tcaaagttgt 6120 tttcaaagtt ggcgtataac atagtatcga cggagccgat tttgaaaccg cggtgatcac 6180 aggcagcaac gctctgtcat cgttacaatc aacatgctac cctccgcgag atcatccgtg 6240 tttcaaaccc ggcagcttag ttgccgttct tccgaatagc atcggtaaca tgagcaaagt 6300 ctgccgcctt acaacggctc tcccgctgac gccgtcccgg actgatgggc tgcctgtatc 6360 gagtggtgat tttgtgccga gctgccggtc ggggagctgt tggctggctg gtggcaggat 6420 atattgtggt gtaaacaaat tgacgcttag acaacttaat aacacattgc ggacgttttt 6480 aatgtatgct ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg cctctccccg 6540 cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca 6600 gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact 6660 ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa 6720 acagctatga ccatgattac 6740 <210> 8 <211> 8958 <212> DNA <213> Artificial Sequence <400> 8 aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc aagcttggca 60 ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 120 cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 180 ccttcccaac agttgcgcag cctgaatggc gaatgctaga gcagcttgag cttggatcag 240 attgtcgttt cccgccttca gtttaaacta tcagtgtttg acaggatata ttggcgggta 300 aacctaagag aaaagagcgt ttattagaat aacggatatt taaaagggcg tgaaaaggtt 360 tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg gatcaaagta 420 ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca gtgcagccgt 480 cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc gccctgccct 540 tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact tgcgactaga 600 accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc tatgcccgcg 660 tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg gccggctgca 720 ccaagctggtt ttccgagaag atcaccggca ccaggcgcga ccgccccggag ctggccagga 780 tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac cgcctggccc 840 gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc gcgggcctgc 900 gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg gtgttgaccg 960 tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc cggagcgggc 1020 gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc accccggcac 1080 agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa gaggcggctg 1140 cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc gaggaagtga 1200 cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc gaggccgacg 1260 ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc accaggacgg 1320 ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg cggccgggta 1380 cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc tggccggttt 1440 gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa ccgagcgccg 1500 ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg tcgctgcgta 1560 tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt tatcgctgta 1620 cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc ccgcgccctg 1680 caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag tgcccgcgat 1740 tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg cccgacgatt 1800 gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg agcgccccag 1860 gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat tccggtgcag 1920 ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa gcagcgcatt 1980 gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat caaaggcacg 2040 cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat tcttgagtcc 2100 cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac cgttcttgaa 2160 tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga aattaaatca 2220 aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac acgctaagtg 2280 ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg gcagacacgc 2340 cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag ctgaagatgt 2400 acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc gcgcagctac 2460 cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa aggaggcggc 2520 atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg tggaggaacg 2580 ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg cactggaacc 2640 cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac aaatcggcgc 2700 ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc agcggcaacg 2760 catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc gaatccgcaa 2820 agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc ccaagggcga 2880 cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg atagtcgcag 2940 catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg gcgaggtgat 3000 ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg gcatggccag 3060 tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat ccatgaaccg 3120 ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg ttgcggacgt 3180 actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg tagaaacctg 3240 cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca agaacggccg 3300 cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc gcgagatcac 3420. agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga tcgatcccgg 3480 catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag aagccagatg 3540 gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga aggaggaggc 3660. ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg gcgaagcatc 3720 cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag gggaaaaagg 3840. tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc cgtacattgg 3900. 3900. 3900. 3900. 3900. 3900. 3900. 3900. 3900. 3900. 3900 agtgactgat ataaagaga aaaaaggcga tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca about gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg cttcgcgtcg 4080 gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca atctaccagg 4140 gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag gcaccctgcc 4200 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 4260 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 4320 ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 4380 gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat 4440 accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 4500 tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 4560 aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 4620 gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 4680 ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 4740 ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 4800 gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 4860 ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 4920 cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4980 cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 5040 gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 5100 aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 5160 tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca 5220 gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc 5280 tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt ctaggtacta 5340 aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct tgatccccag 5400 taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga tcgaccggac 5460 gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat caataaagcc 5520 acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt gggaaaagac 5580 aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg gatctttaaa 5640 tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat tcagtaagta 5700 atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg atatgtcgat 5760 ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag ggctttgttc 5820 atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca gattgctcca 5880 gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt ccagccatag 5940 catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc tgtccgtcat 6000 ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag gagacattcc 6060 ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg gtgatattct 6120 cattttagcc atttattatt tccttcctct tttctacagt atttaaagat accccaagaa 6180 gctattata acaagacgaa ctccaattca ctgttccttg cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc gttcttccga 6420 atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc cggtcgggga 6540 gctgttggct ggctggtggc aggatatatt gtggtgtaaa caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt actgaattaa cgccgaatta attcggggga tctggatttt agtactggat tttggtttta ggaattaga attttattga tagtatt ttacaatac aaatacatac taaggttttc ttatatgctc aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact actcacacat tattatggag aaactcgagc ttgtcgatcg acagatccgg tcggcatcta ctctatttct ttgccctcgg acgagtgctg 6900 gggcgtcggt ttccactatc ggcgagtact tctacacagc catcggtcca gacggccgcg 6960 cttctgcggg cgatttgtgt acgcccgaca gtcccggctc cggatcggac gattgcgtcg 7020 catcgaccct gcgcccaagc tgcatcatcg aaattgccgt caaccaagct ctgatagagt 7080 tggtcaagac caatgcggag catatacgcc cggagtcgtg gcgatcctgc aagctccgga 7140 tgcctccgct cgaagtagcg cgtctgctgc tccatacaag ccaaccacgg cctccagaag 7200 aagatgttgg cgacctcgta ttgggaatcc ccgaacatcg cctcgctcca gtcaatgacc 7260 gctgttatgc ggccattgtc cgtcaggaca ttgtggagc cgaaatccgc gtgcacgagg 7320 tgccggactt cggggcagtc ctcggcccaa agcatcagct catcgagagc ctgcgcgacg 7380 gacgcactga cggtgtcgtc catcacagtt tgccagtgat acacatgggg atcagcaatc 7440 gcgdataga aatcacgcca tgtagtgtat tgaccgattc cttgcggtcc gaatgggccg 7500 aacccgctcg tctggctaag atcggccgca gcgatcgcat ccatagcctc cgcgaccggt 7560 tgtagaacag cgggcagttc ggtttcaggc aggtcttgca acgtgacacc ctgtgcacgg 7620 cgggagatgc aataggtcag gctctcgcta aactccccaa tgtcaagcac ttccggaatc 7680 gggagcgcgg ccgatgcaaa gtgccgataa acataacgat ctttgtagaa accatcggcg 7740 cagctattta cccgcaggac atatccacgc cctcctacat cgaagctgaa agcacgagat 7800 tcttcgccct ccgagagctg catcaggtcg gagacgctgt cgaacttttc gatcagaaac 7860 ttctcgacag acgtcgcggt gagttcaggc tttttcatat ctcattgccc ccccggatct 7920 gcgaaagctc gagagagata gatttgtaga gagagactgg tgatttcagc gtgtcctctc 7980 caaatgaaat gaacttcct atatagagga aggtcttgcg aaggatagtg ggattgtgcg 8040 tcatccctta cgtcagtgga gatatcacat caatccactt gctttgaaga cgtggttgga 8100 acgtcttctt tttccacgat gctcctcgtg ggtgggggtc catctttggg accactgtcg 8160 gcagaggcat cttgaacgat agcctttcct ttatcgcaat gatggcattt gtaggtgcca 8220 ccttccttt ctactgtcct tttgatgaag tgacagatag ctgggcaatg gaatccgagg 8280 aggtttcccg atattaccct ttgttgaaaa gtctcaatag ccctttggtc ttctgagact 8340 gtatctttga tattcttgga gtagacgaga gtgtcgtgct ccaccatgtt atcacatcaa 8400 tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct cctcgtgggt 8460 gggggtccat ctttgggacc actgtcggca gaggcatctt gaacgatagc ctttccttta 8520 tcgcaatgat ggcatttgta ggtgccacct tccttttcta ctgtcctttt gatgaagtga 8580 cagatagctg ggcaatggaa tccgaggagg tttcccgata ttaccctttg ttgaaaagtc 8640 tcaatagccc tttggtcttc tgagactgta tctttgatat tcttggagta gacgagagtg 8700 tcgtgctcca ccatgttggc aagctgctct agccaatacg caaaccgcct ctccccgcgc 8760 gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg 8820 agcgcaacgc aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta 8880 tgcttccggc tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca 8940 gctatgacca tgattacg 8958 <210> 9 <211> 29033 <212> DNA <213> Artificial Sequence <400> 9 aattgacgct tagacaactt aataacacat tgcggacgtt tttaatgtat gctccaccat 60 gttggcaagc tgctctagcc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 120 taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 180 aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 240 atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 300 tacctgcagg tccggacgga ggtgcggtaa agcttgccga aaacatgcag aagagcaacg 360 acggcaatga acccaatgct catgatgagg actgagttcg gggacatctt gcgcccagca 420 gcctcatcgg tgtagaactg gagcattgtg ctggcaccgc ctccaccagt gccactgctg 480 gtggttctac gcctgcgcaa gcttgcagca gctgctgcac tccctctagc cggggcatct 540 ccattggcca ccatcttgct ttatccctct gcatgataat atgagtttca aatgtaaggt 600 ttgcagcact aatattacag aaaaccaaca gaacaacaga gtttcatcca aagtcgtatt 660 gcatatacat aggaagtgtt aaaatatgtc tatcattttg gaagatacgg tttatgctgt 720 cacacagcat tttggagtg actattttat aagcacagaa gtttctcat tgtggaatt 780 gtcaaaggc aaaataagaa gcacagaagt ttctcaatg tggaatgt cagaaggcag 840 aaaggtac acatcttgga agtgtatgat agtactac acataccagt gaagttttag 900 ttgtcacatt tgagtgctaa taaaaatata aaaaagaaat ggttgctgtt gctcatgcct 960 atacattc ataatctatc aaactactg ctcctggatg ctgcatact atactaact 1020 aagcttaagt taaatttacc acagaaaag aaaaaatgac aacttagccc agaattctcc 1080 tgaaaaattt tgggctgtc ctgggcttgg ccaaacaccc attgacatga tgctgccca 1140 gtgtaagaac tgtaaaaca gtatagtgtc tgtgtagta cagggatggc agcatattca 1200 ttgctgcaac acagctacg ctacatgaaa ccaatttctt acgctggaat atgacaac 1260 aacatggagg agagatttcg taatagaatt ttgagcaat atgttggtac ggacaaatg 1320 atcccccaca aaaatccgca gagaagagatca tgagtgacac gcgatatatg aggtaacaca 1380 cgaacatctt atcaagaatt cagatccatt cccagatcct haaagcac tagataca 1440 acagaaatac ttcgataaaa caattcgatt tcccttcatg acacatccta acatcacatc 1500 aaaccccccg cagccaatct gaattctgaa cagcaagatc tggaacagaa gcggtaccca 1560 tcccagaatt ctaaatcggc caaaccaaac aagcccgatc taagacatcg attcaacatg 1620 aacgcgtacg gaatcaaagc aggctaatcg gagagatggc gaaaagagga tgattttcgc 1680 gcgcacctga tgaatctgcc ctgcgccaat cgctcgtgct cccgtcccaa cttggtcact 1740 cgtcttctcg cccgaaaatc tgagtgcgga attcagaatt ctctccgcgt ctgaacccgc 1800 gcgctgatat ctacccaact ggctggatta acgggttccg ttcaagatcc gatatcaagt 1860 gacgtggtcg gcgcgatctg attggccgga gcgcgtctcc gcgcgtcgat ctgagccgtc 1920 cgattcgttg ccgggtcccg atcgcgcggc ctggtgtgaa acgggtggcg tcaccgcgtg 1980 cggcgtggca ctgtgacgtg gcaacggtta tgcggttatg cacagtcatg ggctggacct 2040 tttggcccaa catctgtgga ctcgtggacc gggtttcggc ccttttatcc gctctacgga 2100 cgcagtccac gtcagccgac gtgggtccca ccacgaaggg cgtgcctccc tctaaaaatt 2160 gccaatgacg ataagagcaa agacggacgg gaggggaggg gtccaaatta aaactccaaa atccattcga acagcgaagg aaatttgttg gaaaatttg agatttggat ttttgttcta ggagagggga aggttagaag aagttgagat cggtggaga ctggagatcg aggggagatg ctgtgtctca cctcctcttc ctcctccgcg cccgctccgc tccttccctc tctcgctgat 2400 cgaccgagcc caggaatcgc gggcgggggt ggcaatgttc gcctgagcgt ggtttcttcg 2460. ccgcgccggt cgtggcctgg aaaggtcaag accaatttct cagttcctgc gactgcgcga aaaaacaaaa ccatggtgac tgttgtggag ggatcgcgt ccggccacca agtcctcttt 2580 caggggttca actgggagtc gtggaagcag agcggcgggt ggtacaacat gatgatgggc aaggtcgacg acatcgccgc tgccggagtc acccacgtct ggctgccacc gccgtcgcac tccgtctcca acgaaggtta catgcctggt cggctgtacg acatcgacgc gtccaagtac ggcaacgcgg cggagctcaa gtcgctcatc ggcgcgctcc acggcaaggg cgtgcaggcc atcgccgaca tcgtcatcaa ccaccgctgc gccgactaca aggatagccg cggcatctac tgcatcttcg agggcggcac ctccgacggc cgcctcgact ggggccccca catgatctgt 2940 cgcgacgaca ccaaatactc cgatggcacc gcaacctcg acaccggagc cgacttcgcc 3000 gccgcgcccg acatcgacca cctcaacgac cgggtccagc gcgagctcaa ggagtggctc 3060 ctctggctca agagcgacct cggcttcgac gcgtggcgcc ttgacttgc taggggctac 3120 tcgccggaga tggccaaggt gtacatcgac ggcacatccc cgagcctcgc cgtggccgag 3180 gtgtgggaca atatggccac cggcggcgac ggcaagccca actacgacca ggacgcgcac 3240 cggcagaatc tggtgaactg ggtggacaag gtgggcggcg cggcctcggc aggcatggtg 3300 ttcgacttca cgaccaaagg gatactgaac gctgccgtgg agggcgagct gtggaggctg 3360 atcgacccgc aggggaaggc ccccggcgtg atgggatggt ggccggccaa ggccgccacc 3420 ttcgtcgaca accacgatac aggctccacg caggccatgt ggccattccc ctccgacaag 3480 gtcatgcagg gctacgcgta catcctcacc caccccggca tcccatgcat cttctacgac 3540 catttcttca actgggggtt taggaccag atcgcggcgc tggtggcgat caggaagcgc 3600 aacggcatca cggcgacgag cgccctgaag atcctcatgc acgaaggaga tgcctacgtc 3660 gccgagatag acggcaaggt ggtggtgaag atcgggtcca ggtacgacgt gggggcggtg 3720 atcccggccg ggttcgtgac ctcggcacac ggcaacgact acgccgtctg ggagaagaac 3780 ggtgccgcgg caacactaca acggagctga agtctgcact gatccgtcat tcgatcggac 3840 aaagcagcat tagtccgttg atcggtggaa gaccactcgt cagtgttgag ttgaatgttt 3900 gatcaataaa atacggcaat gctgtaaggg ttgtttttta tgccattgat aatacactgt 3960 actgttcagt tgttgaactc tatttcttag ccatgccaag tgcttttctt attttgaata 4020 acattacagc aaaaagttga aagacaaaaa aaaaaacccc cgaacagagt gctttgcagt 4080 ctttcaccag gacggttgta tcggttcagc agtcagcgct gcgatcgcga caaatttgtt 4140 tgtcagatca aatttttaag caaaacataa gaaacagcac aaaagggtat agcagaagca 4200 aaatttggac acaatgatta gggatcactt attcattata gttcttccat gctgctctac 4260 cacagcaaaa cgtttcagac accatcaaac cagacttaag gatacacatt acaggtaaat 4320 agtacacaat gaaacgggac acgaccaagg accagaccag acaaccatag ctccattggg gaagacaaat aggcagactt gtgaacccta gaacagcagc agctctatgg ctgagcacgg tacctctaga ggcgcgccca ctttgtgtta attackcagtc ctgccatcac catccaggat catgtccttg aatgcgcccc caattgggat cataggcagc acatgctcct ggtgcgggac 4560 gatgatatcc aacaagtatg gccctggagt ctcgagcatc ttcttgatgg cggcacggac 4620 ttcactcttc tttgttacac ggactgccgg aatattgaac cccttagcaa tagtcacaaa atctggatat atctcgctct cacattccgg gttgcccaag tatgtatgcg ccctattcgc cttgtaaaac ctatcctcca attgcaccac catacccaaa tgttggttgt tcaacaccat caccttcaca gggaggttct caatgcggat caatgccagc tcctgaatgt tcatgaggaa gctaccatcc ccatcaatat caacaactgt gacacctggg ttagccacag aagcaccagc tgcggcaggc agcccaaatc ccattgcgcc cagaccagcc actgccgtgg ccgcttgtag gtgtaatatt gtgccgccca catctggtgc tgcccaacac cagtagcgat gattgcctca cctttcgtca gctcatccag cacctgaatg gcatattgcg gtgggatctc 5100 ttcaccaaaa gttttgtacc ccagaggaaa ctccctcttc tgctggtcca actcattgtg 5160 ccatgcacta aaatcagaac ttgtctttgt tgtgctctgt tgtagcagag cattcaagcc 5220 ctgtaaagcg agcttaacat ctgcgcaaat tgacacatgt ggttgcttgt tctttccaat 5280 ctctgctgga tcaatgtcaa tgtgcacaat cttggccctg cttgcaaaag cctcaatttt 5340 ccctgtcaca cgatcatcaa accgcacacc aaacgcaagc aacaggtcag ccttatccac 5400 ggcataattt gcgtacaccg tgccatgcat cccaagcatc cgcagggaca acgggtcgtc 5460 actggggaaa ttgccgaggc ccatcagagt ggttgtaact gggataccag tcagctcaac 5520 aaaccagcgc aattcgtcac cagatgcaga gcagccacca ccgacataga gaatcgggcg 5580 ccgtgactcg ccaaccagac gcaagacctg ctcaagcaat tctgtcgcgg gtggcttggg 5640 caggcgtgcg atgtaccctg gtagattcat cgaggtgtcc cagaccggca cggccatctg 5700 ctgctggatg tccttgggga tgtccaccag caccgggcca ggacggcccg aggacgcgag 5760 gaagaggct tcctgtatga cgcgggggat gtcctccaca tcaaggacaa ggtaattgtg 5820 cttggtgatg gagcgggtga cctcgactat gggcgtctcc tggaaggcgt cggtgccgat 5880 catgcggcgg gggacctggc ccgtgatggc gaccatcggg acggagtcga gcagcgcgtc 5940 ggcgagcgcg gacacgaggt tggttgcgcc ggggccggag gtggcgacgc agaccccgac 6000 gcggccggac gcgcgcgcgt acccggacgc cgcgaacgcc tcgccctgct cgtggcggaa 6060 gaggtggttg gtgatgaccg gggagcgcgt cagcgcctgg tggatctcca tcgacgcgcc 6120 gcctgggtag gcgaacacgt cgctgacgcc gcaccgctcc agcgcctcca cgaggatgtc 6180 cgcgcccttg cggggctcgg ccggccccca cggccggagc ggcgtggccg gcggcgccgg 6240 ggacggcggg gtgaccgggg acaccgccga gcacctgacc gccgccgcccc ccacccggcc 6300 tcgagcggga aggacgtggt gtcgctggtg gttcttacgg ccggtcttgg ccgtcgcggc 6360 ggcggacagg gcggcggccg cggccgcggc ggtcgtagcc atggtgggtg gtggcggcgg 6420 cggcggcggc gagggtttct gggtttgggc gagagggaga gaggggtgga gagtgtgggg 6480 gtgtgggtgt ttgtccgcg cgcggtgacg cagcgtgagg cgatgtgtgg ctcggatggg 6540 atcgtgtggg gccacgtcac agtgggcccc atatgcggt gggataggat gacacacagc 6600 cacgtcgggg tcgatctggg ccccgtgtc agtcgattgg atgaggatga caggtgggtc 6660 agtcccaata acgggtggag ggtacagaac ccgataaaaa atcgatctca aagtcggatg 6720 cggatgcaac cgcgagacct agcagctag cacccgcacc cgcacccgca caaacgcagc 6780 gcaagatgag cagtggcggc gagaagtccg gctcgggcgg cggcggcggt ggcggcggcg 6840 gcggggcggt gaagacgccc tccgacttc tcaagtccat cagggggcgc cccgtcgtcg 6900 tcaagctcaa ctccggcgtc gactaccgcg gtaaccccct gctcaattc ctccccttt 6960 ttgcctcaac cctagacccg cctcccgaaa accctagcac gagacgaatg cgatgtttgt 7020 tgtaccccgt atctctttct ccttaattgg aactctgcgt ttctttcgt taattagtgg 7080 ggggaaggaa aggcgtggac tctgtaggat tttctttcg atttgatgac caagggagat 7140 acttatttta gtgctgttta agatcctgct agtgcccggt gtagctaggc catttgagaa 7200 gcagataacc gtgttttttct gtaggacctt ctctaatctt gagctatttt gatattctaa 7260 ttacttatgg ttaaacccta gaacctcagt atgttttaac ttagtaagag attgctacag 7320 tattttatt tgtaggaaca acattgtagg tggttatcat gctactgact gtcttgtgta 7380 gagccctcct atcattaagg ggcttttg tttactaata gttagtttta gtacccattt 7440 ttctgtgagc tactaaaag atatttcca attcaaccta tggtaattta aagtacttta 7500 tgctgtatgt ccatttactg aggattga ttaatatta agaggagga catctgtgct 7560 taaggtttgc attgcaat ttgatagatt tatgctaaac aaaggtaatt gtgcatgctt 7620 gagatagaaa gggatttccc ttctttggtt tgatataa ggggttggca ttccatgatc 7680 aggagcatag tgcatttata ttttaatg tggctatgtg tatgcagttc tcaatttcac 7740 attggcggta cacccatgat atatttaatt gttacccaga accatataat agcctataa 7800 gagcatatgg tattccattg attggggcct tcggagtgt acctgtgtat gtaactatgc 7860 atataggtt tactttctgg tagttcttc ttctctcat cacttaagac atctggatcg 7920 ctgttatcaa gtcgtagact agtcataacg tcagtcaagt cagacgacta gagggctacg 7980 actcgaccaa atagcaagtc gcacaattag tcgtagatta gtcatagcaa atcatcattt 8040 caccatgcta attggcttat tgtgtttagt actttaaatt tatttcttgt taacttattg 8100 tcttgctggc tactccataa accgtagttt ataatactat atatagtgct tagtacaata 8160 gaatagtact agagactata tagtgcatcc attgttttca cacgaccaaa tcatggacta 8220 gtcgtggact agattttgaa tggaacagtt ttaccagaaa tacacttgtt cttttttttt 8280 ctgaatagtg ttgaatcagt agctgcaatg catagcttgt gcaataaaat cattatatac 8340 tatcaccaat ttcatggaat cttacttatt ggaaatttgt aacaaatcta ttttatcccc 8400 tgagttaccg tgttggtcta aaatcaactc gcatgtgaga caagatgaag aggaccatga 8460 agattgcctc tttcatttat tcatttgctg actgcttgca atgccactat aaacctaatc 8520 ggatgactgg ttgtcatgtc tccgctaact agagagaaag ggggaggagt gaagacttta 8580 cgatttaaat cctaggtttt ttaccaggtg aactccaagt cctggaccct tttttcccga 8640 tctagtaaca tagatgacac cgcgcgcgat aatttatcct agtttgcgcg ctatattttg 8700 ttttctatcg cgtattaaat gtataattgc gggactctaa tcataaaaac ccatctcata 8760 aataacgtca tgcattacat gttaattatt acatgcttaa cgtaattcaa cagaaattat 8820 atgataatca tcgcaagacc ggcaacagga ttcaatctta agaaacttta ttgccaaatg 8880 tttgaacgat cggggaaatt ccagtgcacc agagtcacag aaacacatca cacattcgtg 8940 agctcagctt agccatggat aacgcctaca ttattgccat tctctctgta gctatcctct 9000 tcttgctcca ctactacctc ctcggccgcg gcaatggcgg ggcggcgcgg ctgccgccgg 9060 gtccaccggc cgtcccgatc ctgggacacc tccacctcgt caagaagccg atgcacgcca 9120 ccatgtcccg cctcgccgag cggtacgggc cggtgttctc gctgcgcctc gggtcgcggc 9180 gcgccgtggt ggtgtcgtcg ccggggtgcg ccagggagtg cttcaccgag cacgacgtga 9240 ccttcgcgaa ccggcccagg ttcgagtcgc agctgctggt ctcgttcaac ggcgccgcgc 9300 tcgccacggc gagctacggc gcgcactggc gcaacctccg ccggatcgtc gccgtgcagc 9360 tgctctccgc gcaccgcgtc ggctcatgt ctgaaaatct cgaaacagcc gtgtcatagt 9420 caatcattag gtgttatagg aacaatcaa ggttttttca agtgttaatc ttcatactaa 9480 tatatacagt gggtactctt tatctactgc cgtggaactg tcatatttga ttatgaaatt 9540 ttagctctag aaataatttg atcatcaatg tcagactt atgaccttgc aaatacatt 9600 tcctaattga gaacagggta aaattatgaa ctagcctct gaaccttcat accaggcag 9660 cacattttt gttgtaaaat cacatcttaat atcagcggaa agactggacc agaagaa 9720 aaagttaaga caggcatata ctcttgatcc tctaaaagag atgaggcggt acatgatca 9780 accatgaaca ttaaagtgat acgtggaaca tgagacaca ataattgtc actggaacat 9840 aaatacaaaaggtttgtag taacttaccg acatgaggcc gacgcggtgc gcggagagca 9900 gctgcacggc gacgatccgg cggaggttgc gccagtgcgc gccgtagctc gccgtggcga 9960 gcgcggcgcc gttgaacgag accagcagct gcgactcga cctgggccgg tcgcgaagg 10020 tcacgtcgtg ctcggtgaag cactccctgg cgcaccccgg cgacgacacc accacggcgc 10080 gccgcgaccc gaggcgcagc gagacaccg gcccgtaccg ctcggcgagg cgggacatgg 10140 tggcgtgcat cggctcttg acgaggtgga ggtgtcccag gatcgggacg gccggtggac 10200 ccggcggcag ccgcgccgcc ccgccattgc cgcggccgag gaggtagtag tggagcaga 10260 agaggatagc tacagagaga atggcaataa tgtaggcgtt atccatggct aagctgagct 10320 cacgaatgtg tgatgtgtt ctgtgactct ggtgcactga agtaacacca aacaacaggg 10380 tgagcatcga caaagaac agtaccaagc aaataatag cgtatgaagg caggggctaaa 10440 aaaatccaca tatagctgct gcatatgcca tcatccaagt atcagat caaatatt 10500 aaaaacata cttgttttatt atatagata ggtactcaag gttagagcat atgaatagat 10560 gctgcatatg ccatcatgta tatgcatcag taaaacccac atcacatgt atacctatcc 10620 tagatcgata tttccatcca tcttaaactc gtaactatga agatgtatga cacacacata 10680 cagttccaaa attaataaat acaccaggta gtttgaaca gtattctact ccgatctaga 10740 acgaatgaac gaccgcccacacacacacacacacaac caagcgaac aaagcatct 10800 ctgtatatgc atcagtaaaa cccgcatcaa catgtatacc tatcctagat cgatatttcc 10860 atccatcatc ttcaattcgt aactatgaat atgtatggca cacacataca gatccaaaat 10920 taataaatcc accaggtagt ttgaaacaga attctactcc gatctagaac gaccgcccaa 10980 ccagaccaca tcatcacaac caagacaaaa aaaagcatga aaagatgacc cgacaaacaa 11040 gtgcacggca tatattgaaa taaggaaaaa gggcaaacca aaccctatgc aacgaaaaa 11100 aaaaaatcat gaaatcgatc ccgtctgcgg aacggctaga gccatcccag gattccccaa 11160 agaaacac tggcaagtta gcaatcagaa cgtgtctgac gtacaggtcg catccgtgta 11220 cgaacgctag cagcacggat ctaacacaaa cacggatcta acacaaacat gaacagaagt 11280 agaactaccg ggccctaacc atggaccgga acgccgatct agaaggta gagaggggg 11340 gggggggagg acgagcggcg taccttgaag cggaggtgcc gacgggtgga tttgggggag 11400 atctggttgt gtgtgtgtgc gctccgaaca acacgaggtt ggggaaagag ggtgtggagg 11460 gggtgtctat ttattacggc gggcgaggaa gggaaagcga aggagcggtg ggaaaggaat cccccgtagc tgccggtgcc gtgagaggag gaggaggccg cctgccgtgc cggctcacgt 11580 ctgccgctcc gccacgcaat ttctggatgc cgacagcgga gcaagtccaa cggtggagcg 11640. gaactctcga gaggggtcca gaggcagcga cagagatgcc gtgccgtctg cttcgcttgg cccgacgcga cgctgctggt tcgctggttg gtgtccgtta gactcgtcga cggcgtttaa caggctggca ttatctactc gaaacaagaa aaatgtttcc ttagtttttt taatttctta aagggtattt gtttaatttt tagtcacttt attttattct attttatatc taattatta 11940. 11940. 11940. 11940. 11940. 11940. 11940. 11940. 11940. 11940 tagtgtact aaaaaaatta gtctaaaa accacttacc ctaaacccta aatggatgta ctaataaaat ggatgaagta ttatataggt gaagctattt gcaaaaaaaa aggagaacac atgcacacta aaaagataa actgtaggt cctgttgtca aaatactcaa ttgtccttta gaccatgtct aactgttcat ttatatgatt ctctaaaaca ctgatattat tgtagtacta taacttat tattcgtaga gtaagtttta tattatagta aaataga taactgcac 12240 ttcaacaag tgtgacaaaa aaatatgtg gtaattttt ataacttaga catgcaatgc 12300 tcattatctc tagagagggg cacgaccgggg tcacgctgca catgcgcatc ggaccgttaa 12360 ttaaacaca tggtgcaaca gtgccagctg tagttagggg attactgagg ggagactggt 12420 gttgaatcta gatgtgcaa cgcacta ctacctaccg tgtcgctgtg aaatggaatt 12480 gcagatagtt ttttttcta ataacgagtt gcagaatgca gataactagt gggcaaccaa 12540 gaaaaacag aaagccccaa tgcaagtag gaaccaaa gagaagaaaggcatac 12600 aatcacaga acaatccaa gagaaaaca aacaatggtt ccgagctcta acaaatagg 12660 catcacaatc accgttctcc acctgaggat ccaatcattc aaatcctatc taactaccga 12720 gtactaccaa ccaggaag aagaacacaa cttcaggatg agatttacca tggagcccac 12780 gagctcagaa gcgaacaccg gactgcatca caccatgcat gccagggggg gaacaacgag 12840 agctcaacgt cgaacacctg acgctcacaa gaacgacgcg gcgagcagag cggcggcgga 12900 ggccacagtg gccgcaacgc tcgtggccgc cgcggtggcg ccgttcttct tctcggcttt 12960 gtcggcagcc tcttctcccg cgggcgcgtc ggcgggcgac atgtcaggcg tgtcggccgg 13020 aggcgcgggt ggggaatggg aaggcgactt gcccttcttt ttcttcttgc ccgccgcctt 13080 gggggagggc gccggcgagg agccttctgg cgcgggagaa gcggctggca catcgcttgc 13140 cggtcccggc gccggcgcgg gggaaggtgc gccaccgaag agctctggcg gcagcagcac 13200 gctgtccacc gtgtggataa ccgtcggggt gtcgtccagc acggtggacg cgacgcggga 13260 cttgtccatg ccggtgtcca tggacacgtc gtcgccctta gtgacgacgg agaggtcgta 13320 cttacccgct ccggtggagg ccagggtctg gatgtggccc ttgatggtct tgagcgacgc 13380 cttgggcgcg tactgcggca aggcgtggta ctggagaagc gtcaccagct cggcgctggt 13440 cagcttgctc agatccggca ggcccttggc ctggaacgcg tcgtcgttgg gcgcgaacag 13500 cgtcagcgcc ttgtccatgg ccgcctggta catcttcatc accccggacg acacgatgag 13560 ccgcgcgaac tgcttgcacc cggccttctc aagaagcgcg gtgaggttgg tcgacgcggc 13620 cgacggggag tcgaagaggc cgggaaggt gatggggtcg gagacctcaa gaacggagag 13680 gttgtacggc tcctgcttga cggacttggt gtaggtggcc tggaacttgg agccgggcgc 13740 ggcggaggcg aacccaacct tgccgccgcg caggttggtg atgttgacgt ggcccatgtt 13800 accggaggcg tcgccggtgg tctggtacag cgtggtggtg agctcggagc cgtcggagag 13860 ggagtgcagc ttcttggtgt cgtagtagtc gaggagggtg aggaggcgga gcgcgttctt 13920 gatgtcggcg agggagaggt tggagacgag ggaggacatg gcgccgttgg tgagcacgag 13980 gcaggtcacc gtgctccggc tgttgatctc gtcgcacacc ttggtctggg agaggtagct 14040 gttgtacagc gagtactccg ggtagccgtc gaggatgtcc gtgatgttgt gggagctcac 14100 cgccgcgacg gcgagggagg cggccaggag gaagagcagg cggcggtcgg tggcggccat 14160 ggcgggggtg gtggtgttgt gtgggtggt gtgacacggt gggagagagga aggagagtag 14220 tgtgcgccgt gttggggttt tagctttttc tgggcgtggg tttttggcct gttggacttt 14280 ggtcttggag gggttcaggt gttgggttga gtcttcaaag aaaaagagaa gttgagtttg 14340 tgccgtgacc atggttaggt gctggatgga gtactggagt gtgcagcact aaagcctgga 14400 catgtgctgc accctcgatg gttgtgatga ttttctgtgc ggcggtgggg tgctcttgtt 14460 ggctcgcgtg ctcagtgctg tggactatgg agtgctggtg ttttcatgcc taacacgttt 14520 gtgttaacca cacatgattg agagttttaa tcgaatactc gatatgctaa aaatccagta 14580 gtatggtcta agagtatcta tgagaatggc cacatatatt taggttatgt tggtacgaca 14640 ttaactcccc gtttttgttg gtaagctata attattaaat tgaggcacag cgttttattt 14700 tgcactataa ttagaggatt gaactagtca taccaataat aaggatggtg aaagttttaa 14760 caggtttgtt ttcgttgtag tattgtttta tgatgttagt cgaaaatacc tggtactctc 14820 tactaatatt attatactaa taagaaaaat aatccgaacc atttattatt aagggttaat 14880 tagtaattta ctggggtaac tttatcattt atgttttatt ttctgtctga atcgatctag 14940 gtcatcgcgg tggtattgct tatattctat agataaagcc CAAAAAAAAAAA agaagaaat 15000 gggtttagtc acttctaaat gatgattata ccaccgcacc atttttttaa cataatatt 15060 tatccacatt ttactacca tattacttata gagcggtatt acaaatagat ctacagtagt 15120 acaatagat ccgaatccct ttgatttaat aagattaatg gttaagtta cttagagaat 15180 gacctaaacc catccaaggg aatcttaca tttatgatta tgttatgcgt agaacacagt 15240 ttgagctaca atgtttatg gctccttca aaagggaat gaaaatcac acaaatagaa 15300 aaaaaaacat agtaaccaac atagaatgt acatgtaat aaatagatga ttgaaaaaca 15360 catgaaatag aaggtgcgta gtttggaccg taggattta gttatcacga gattattaca 15420 aaacgacgat aaaaatttcg ttggtcaaa tatcctcaac ttggttaat gtacagtttc 15480 attaatctta gcaagaaaa ggggaaaaa gatagtagat gttcctatcg caatggaatc 15540 aatggcaaag gaaaattttc ctctattatt attackagaga tctcctttta ctgttcca 15600 atccatcatt tcaatggat gatataagt gccaaatcca atagaattg aatccccaaa 15660 ggataactta agagtagag ctaacttag gcatcatgaa tagtgcaggc tcattcacag 15720 taaggtact taatagata tttgtagaat ttaaaactat gaacagaaa ttttccatag 15780 gaaccatttt ttccttcact ttttttgga ggatctaaaa catgagctca aatctcatgg 15840 ccttcgaaat agactattc aacatttatt cgtggagtgt tactgtacaa aatttctttg 15900 gagagttcta cagtttacta ctggtttata tactcattat agtatatctc atatttttga 15960 gattggctt gtggggttg aaaaaatc taccaaattt attcttgttg gagcatccgc 16020 tatatgttgg gctatatggt tgtgtagaaa tgatatggtt tttgataaat caccatctat 16080 gtcctatatg ctggttcttt tcagagcaac atactggctc cagtcctgag cttaactact 16140 aaagtgcgat gaagaatca gcccggggcag gcctccctcag cgatctagta acatagatga 16200 caccgcgcg c gataatttat cctagtttgc gcgctatatt ttgtttcta tcgcgtatta 16260 aatgtataat tgcgggactc taatcataaaacccatctc ataatacg tcatgcatta 16320 catgttaatt attackcatgct taacgtaatt caacagaaat catgtaatt tcatcgcaag accggcaaca ggattcaatc ttaagaaact ttattgccaa atgtttgaac gatctcagct gtgccccagt ttgctaggca ggtcgcagta cctggccaca gccatctcgt gctgctccac 16500 gtaggtctct ttgtcggcct ccttgattct ttccagtctc ctgtccacga agtagcc 16560 gggcatcttg aggttcttag cgggtttctt ggatctgtat gtggtcttga gggagcagtg caggtagccc ccgcccacga gcttcagggc catctggcta tggcctctca ggccgctgtc 16680. agcggggtac agcatctcgg tgctggcctc ccagccgagt gttttcttct gcatcacagg 16740 gccgttggat gggaagttga ccccgttgat cttgacgttg taggaggc agccgttctg gaggctggtg tcctgggtag cggtcagcac gcccccgtct tcgtatgtgg tgatcctctc 16860 cctgtgaag ccctcaggga aggactgctt aaagaagtcg gggatgccct gggtgtggtt gataaaggtt ttgctgccgt acatgaagct ggtagccagg atgtcgaagg cgaaggggag agggccgccc tcgaccacct tgatcttcat ggtctgggtg ccctcgtagg gcttgccttc 17040 gccctcggat gtgcacttga agtggtggtc gttcacggtg ccctccatgt agagtttcat 17100 gtgcatgttc tcggtgatca gcacgctatc ctcaccact gcggaagcgt tgcatgcaac 17160 aatagcaagg agagcaaata cgaaaatgat cttcattttt gtaggattct actactatgc 17220 ttcaactata atgtttgaat tgtgtgaagg atgaggaggg tttcattat gcttgtctat 17280 ttatagatgt ttccctatcg gttgctttag agtgttagtt ttgcttgatg ctatattagg 17340 atctaagtga gtcatattat ttggatattc tgttaggtgc acctaaaat gttctttgat 17400 atcatcatca aagtaacttt tatgcccatc atatatacat gatggtgagc aaaaaataa 17460 tgacatgact catcgctcac tttatgtgtc aatgtgataa ggattgcaac ttttgaaact 17520 aagtttgtta tgttttgtaa gctattattt tgataatgca ctacacgtgg aactttacga 17580 ctgtgtgggt ttatgctctt tgaattatat aatttcagta agaaaaaaaa ttatagtatg 17640 ttcaatggtt ttcattgttc cattaatact cttgtgaaaa cttgtttgtg atacgaaata 17700 agttaatgca ataactttta aattaacttt gcagagcttt acaataactc accaacttac 17760 tctaattgtg gttggggatt gatttaattc atacttttat agaccaaatt gatattgtgt 17820 tgctaaataa aaattatagt ggtgttgcta cacctacaca gacacagaag gaatcctgat 17880 atcatcagct atctactgct tcctccacat ggactcaaga agcagaagca aaaaagaaga 17940 aggcatttgc tccaacaaag ttttccggtg aaaggcaaca cattgttctg aacttcctgg 18000 catgtattat gtgaatctag caaattaacc aaacattgac acaatgcgac accttgtaat 18060 gtagccgtgc cgagaattgt atatctcact taccattgta tatcacacgt gccgagaata 18120 ggagattgat tttgccaac caaaacgctc taggcagacc aattgggcga cgtccacctg 18180 cttcactgga gcaccggaca ctgtctggtg gcataccaga cagtccggtg tgccagatca 18240 gggcaccctt cggttccttt gctcctttgc ttttgaaccc taactttgat cgtttattgg 18300 tttgtgttga acctttatgc acctgtggaa tatataatct agaacaaact agttagtcca 18360 atcatttgtg ttgggcattc aaccaccaaa attattatta ggaaaaggtt aaaccttatt 18420 tccctttcaa tctccccctt ttggtgatt gatgccaacaaaccaag aaaatatata 18480 agtgcagaat tgaactagtt tgcataggt aagtgcatag gttacttaga attaaatcaa 18540 tttatacttt tacttgatat gcatggttgc ttttacttt tttacattt tggaccacat 18600 ttgcaccact tgttttgtttttgcaatc ttttggaa ttctttttca aagtctttg 18660 aaatagtca aagtatatg aagattg window ttcaagatt tgaaatttct 18720 ccccctgttt aaatgcttt tcctttgact aaaaaact ccccctgaat aaattctcc 18780 tcttagcttt caagaggggtt ttataatagat atcattgga atatattta gatgctatt 18840 ttgaaaatat accaattgaa atcaacata ccaatttgaa atttaacata ccaatttaaa 18900 aaatttcaa aagtggtggt gcggtccttttgcttgggc ttatatttc tccccttg 18960 gcattaatcg ccaaaaacgg agacttgtg agccatttat actttccc cattggtaaa 19020 tgaaatatga gtgaaagatt ataccaatt tggacagtga tgcggagtga cggcgaagga 19080 taaacgatac cgttagagtg gagtggaagc cttgtcttcg ccgaagactc catttccctt 19200. 19200. 19200. 19200. 19200. 19200. 19200. 19200. 19200 gatatgatca aaggtataca aatgagctat gtgtgtaatg tttcaatcaa agtttcgaga atcaagaata tttagctcat tcctaagttt gctaaaggtt ttatcatcta atggtttggt aaagatatcg actaattgtt ctttggtgct aaagataagca atctcgatat cacccctttg ttggtgatcc ctcaaaaagt gataccgaat gtctatgtgc ttagtgcggc tgtgttcaac gggattatcc gccatgcaga tagcactctc attgtcacat aggagaggga ctttgctcaa tttgtagcca tagtccctaa ggttttgcct catccaaagt aattgcacac aacaatgtcc tgcggcaata tacttggctt cggcggtaga aagagctatt gagttttgtt tctttgaagt ccaagacacc agggatctcc ctagaaactg acaagtccct gatgtgctct tcctatcaat tttacaccct gcccaatcgg catctgata tcctattaaa tcaaaggtgg atcccttggg gtaccaaaga ccaaatttag gagtgtaaac taaatatctc atgattcttt tcacggccct 19800 aaggtgaact tccttaggat cggcttggaa tcttgcacac atgcatatag aaagcatact 19860 atctggtcga gatgcacata aatagagtaa agatcctatc atcgaccggt ataccttttg 19920 gtctacggat ttacctcccg tgtcgaggtc gagatgccca ttagttccca tgggtgtcct 19980 gatgggcttg gcatccttca ttccaaactt gttgagtatg tcttgaatgt actttgtttg 20040 gctgatgaag gtgccatctt ggagttgctt gacttgaaat cctagaaaat atttcaactt 20100 ccccatcata gacatctcga atttcggaat catgatccta ctaaactctt cacaagtaga 20160 tttgttagta gacccaaata taatatcatc aacataaatt tggcatacaa acaaaacttt 20220 tgaaatggtt ttagtaaaga gagtaggatc ggctttactg actctgaagc cattagtgat 20280 aagaaaatct cttaggcatt cataccatgc tgttggggct tgcttgagcc cataaagcgc 20340 ctttgagagt ttataaacat ggttagggta ctcactatct tcaaagccga gaggttgctc 20400 aacatagacc tattcacccc atttgatcac ttttttggtc cttcaggatc taatagttat 20460 gtataattta gagtctcttg tttaatggcc agatatttct aattaatcta agaatttatg 20520 atatttttta attttttatc atgtctgatg agaattaaca taaaggctca attgggtcct 20580 gaattaataa tagagtgaaa attaatccag aggctctatt agaaccttca attagtaata 20640 ccaagatata tataagatag tagagtatag tttaaatgtt ggcattgttc attctttctt 20700 ttgttattta attatgctt tccacggtgg tgtggtta cttctgaagg gtccaaataa 20760 tgcatgaaga gtttgaggac aagaagtctg ccctaaaaat agcgatgcaa aggcatggtg 20820 tccaagccat acatatagcg cactaattttt atcagcagaa caatggtatt tataggtcct 20880 agtgcccagg caacaagaga cacgaataaa gcatcgatca cgacaagatg ctgtgtctca 20940 cctcctcttc ctcctcgcg cccgctcgc tccttccctc tctcgctgat cgaccgagcc 21000 caggaatcgc gggcgggggt ggcaatgttc gcctgagcgt ggtttcttcg ccgcggcggt 21060 cgtggcctgg aaaggtcaag accaatttct cagttcctgc gactgcgcga aaaaaaaa 21120 ccatggtgac tgttgtggag gagatcgctt gttctggtac tggatctgga tttgaaatat 21180 tgtgtcaagg atttaactgg gaatctcata agtcaggaaa atggtatgtg gaacttggct 21240 caaaggccaa ggagttgtca tccatgggtt tcaccattgt ctggtcacca ccacctactg 21300 attctgtgtc gcctgaagga tacatgccaa gggatttgta taatctaaat tccagatatg 21360 ggaccatgga agagttgaag gaggctgtga aacgttttca tgaagccggt atgaaggttc 21420 ttggtgatgc cgtcctgaat cacaggtgtg ctcaatttca gaaccaaaat ggcgtctgga 21480 atatttttgg tggacgcctt aactgggatg atcgagcagt tgttgcagat gatccacatt 21540 tccagggaag aggaaacaag agcagtggag ataacttcca tgcagcccca aacattgatc 21600 actcgcaaga gtttgtgagg agtgatctta aagaatggct ttgttggatg agaaaggaag 21660 ttggatacga tggatggcga cttgattttg ttcgcggatt ttggggtgga tatgtccacg 21720 attacttgga agcaagcgaa ccatattttg footggaga gtactgggat tctctcagtt 21780 acacctatgg tgaaatggat tataatcaag atgcccacag gcagagaata gttgattgga 21840 taaatgctac aaatggaact gctggtgcat ttgatgttac cacgaaagga atacttcact 21900 ctgcactgga aagatctgag tactggcgtc tgtctgatga aaaaggaaaa ccccctggag 21960 tgttaggttg gtggccttcg cgtgctgtca catttataga aaatcatgac actggttcta 22020 ctcagggtca ttggagattc ccctttggta tggagttgca aggctatgtc tacatcttaa 22080 ctcacccagg cactcctgca atcttctatg atcatatatt ttcgcattta cagccagaga 22140 ttgctaaatt aatttctatt agaaatcgcc aaaagatcca ttgccgtagc aagatcaaga 22200 tactgaaagc agagggaaat ttatatgcgg cagagattga tgagagggta acaatgaaga 22260 ttggcgcagg acattttgag ccaagcggcc ccacaaactg ggtagttgct gccgagggac 22320 aggattacaa ggtctgggaa gtgtcatcgt agacttgccg cgctggtact tgcagaactt 22380 ctattgtaga cagtatacaa ccattcggta tagctcacaa aagggatcgt tcaaacattt 22440 ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 22500 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga gatgggtttt father gtcccgcaat father father gaaacaaaa fathercgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatctac 22680 gtaaagctta gattgtcgtt tcccgccttc agtttaaact atcagtgttt gacaggatat attggcgggt aaacctaaga gaaagagcg tttattagaa taacggatat ttaaaaagggc gtgaaaaggt ttatccgttc gtccatttgt atgtgcatgc caaccacagg gttcccctcg ggatcaaagt actttgatcc aacccctccg ctgctatagt gcagtcggct tctgacgttc 22920. agtgcagccg tcttctgaaa acgacatgtc gcacaagtcc taagttacgc gacaggctgc cgccctgccc ttttcctggc gttttcttgt cgcgtgtttt agtcgcataa agtagac 23040 ttgcgactag aaccggagac attacgccat gaacaagagc gccgccgctg gcctgctggg 23100 ctatgcccgc gtcagcaccg acgaccagga cttgaccaac caacgggccg aactgcacgc ggccggctgc accaagctgt tttccgagaa gatcaccggc accaggcgcg accgcccgga 23220 gctggccagg atgcttgacc acctacgccc tggcgacgtt gtgacagtga ccaggctaga 23280 ccgcctggcc cgcagcaccc gcgacctact ggacattgcc gagcgcatcc aggaggccgg 23340 cgcgggcctg cgtagcctgg cagagccgtg ggccgacacc accacgccgg ccggccgcat 23400 ggtgttgacc gtgttcgccg gcattgccga gttcgagcgt tccctaatca tcgaccgcac 23460 ccggagcggg cgcgaggccg ccaaggcccg aggcgtgaag tttggccccc gccctaccct 23520 caccccggca cagatcgcgc acgcccgcga gctgatcgac caggaaggcc gcaccgtgaa 23580 agaggcggct gcactgcttg gcgtgcatcg ctcgaccctg taccgcgcac ttgagcgcag 23640 cgaggaagtg acgcccaccg aggccaggcg gcgcggtgcc ttccgtgagg acgcattgac 23700 cgaggccgac gccctggcgg ccgccgagaa tgaacgccaa gaggaacaag catgaaaccg 23760 caccaggacg gccaggacga accgtttttc attaccgaag agatcgaggc ggagatgatc 23820 gcggccgggt acgtgttcga gccgcccgcg cacgtctcaa ccgtgcggct gcatgaaatc 23880 ctggccggtt tgtctgatgc caagctggcg gcctggccgg ccagcttggc cgctgaagaa 23940 accgagcgcc gccgtctaaa aaggtgatgt gtatttgagt aaaacagctt gcgtcatgcg 24000 gtcgctgcgt atatgatgcg atgagtaaat aaacaaatac gcaaggggaa cgcatgaagg 24060 ttatcgctgt acttaaccag aaaggcgggt caggcaagac gaccatcgca acccatctag 24120 cccgcgccct gcaactcgcc ggggccgatg ttctgttagt cgattccgat ccccagggca 24180 gtgcccgcga ttgggcggcc gtgcgggaag atcaaccgct aaccgttgtc ggcatcgacc 24240 gcccgacgat tgaccgcgac gtgaaggcca tcggccggcg cgacttcgta gtgatcgacg 24300 gagcgcccca ggcggcggac ttggctgtgt ccgcgatcaa ggcagccgac ttcgtgctga 24360 ttccggtgca gccaagccct tacgacatat gggccaccgc cgacctggtg gagctggtta 24420 agcagcgcat tgaggtcacg gatggaaggc tacaagcggc ctttgtcgtg tcgcgggcga 24480 tcaaaggcac gcgcatcggc ggtgaggttg ccgaggcgct ggccgggtac gagctgccca 24540 ttcttgagtc ccgtatcacg cagcgcgtga gctacccagg cactgccgcc gccggcacaa 24600 ccgttcttga atcagaaccc gagggcgacg ctgcccgcga ggtccaggcg ctggccgctg 24660 aaattaaatc aaaactcatt tgagttaatg aggtaaagag aaaatgagca aaagcaaa 24720 cacgctaagt gccggccgtc cgagcgcacg cagcagcaag gctccaacgt tggccagcct 24780 ggcagacacg ccagccatga agcgggtcaa ctttcagttg ccggcggagg atcacaccaa 24840 gctgaagatg tacgcggtac gccaaggcaa gaccattacc gagctgctat ctgaatacat 24900 cgcgcagcta ccagagtaaa tgagcaaatg ataaatgag tagatgaatt ttagcggcta 24960 aaagggcgg catggaaaat caagaacaac caggcaccga cgccgtggaa tgccccatgt 25020 gtgggaac gggcggttgg ccaggcgtaa gcggctgggt tgtctgccgg ccctgcaatg 25080 gcactggaac ccccaagccc ggagaatcgg cgtgacggtc gcaaaccatc cggcccggta 25140 caaatcggcg cggcgctggg tgatgacctg gtggagaagt tgaaggccgc gcaggccgcc 25200 cagcggcaac gcatcgaggc agaagcacgc cccggtgaat cgtggcaagc ggccgctgat 25260 cgaatccgca aagaatcccg gcaaccgccg gcagccggtg cgccgtcgat taggaagccg 25320 cccaagggcg acgagcaacc agattttttc gttccgatgc tctatgacgt gggcacccgc 25380 gatagtcgca gcatcatgga cgtggccgtt ttccgtctgt cgaagcgtga ccgacgagct 25440 ggcgaggtga tccgctacga gcttccagac gggcacgtag aggtttccgc agggccggcc 25500 ggcatggcca gtgtgtggga ttacgacctg gtactgatgg cggtttccca tctaaccgaa 25560 tccatgaacc gataccggga agggaaggagaagcccg gccgcgtgtt ccgtccacac 25620 gttgcggacg tactcaagtt ctgccggcga gccgatggcg gaagcagaa agacgacctg 25680 gtagaaacct gcattcggtt aaacaccacg cacgttgcca tgcagcgtac gaagaaggcc 25740 aagaacggcc gcctggtgac ggtatccgag ggtgaagcct tgattagccg ctacaagatc 25800 gtaaagagcg aaaccgggcg gccggagtac atcgagatcg agctagctga ttggatgtac 25860 cgcgagatca cagaaggcaa gaacccggac gtgctgacgg ttcaccccga ttactttttg 25920 atcgatcccg gcatcggccg ttttctctac cgcctggcac gccgcgccgc aggcaaggca 25980 gaagccagat ggttgttcaa gacgatctac gaacgcagtg gcagcgccgg agagttcaag 26040 aagttctgtt tcaccgtgcg caagctgatc gggtcaaatg acctgccgga gtacgatttg 26100 aaggaggagg cggggcaggc tggcccgatc ctagtcatgc gctaccgcaa cctgatcgag 26160 ggcgaagcat ccgccggttc ctaatgtacg gagcagatgc tagggcaaat tgccctagca 26220 ggggaaaaag gtcgaaaagg tctctttcct gtggatagca cgtacattgg gaacccaaag 26280 ccgtacattg ggaaccggaa cccgtacatt gggaacccaa agccgtacat tgggaaccgg 26340 tcacacatgt aagtgactga tataaagag aaaaaaggcg atttttccgc ctaaaactct 26400 ttaaaactta ttaaaactct taaaacccgc ctggcctgtg cataactgtc tggccagcgc 26460 acagccgaag agctgcaaaa agcgcctacc cttcggtcgc tgcgctccct acgccccgcc 26520 gcttcgcgtc ggcctatcgc ggccgctggc cgctcaaaaa tggctggcct acggccaggc 26580 aatctaccag ggcgcggaca agccgcgccg tcgccactcg accgccggcg cccacatcaa 26640 ggcaccctgc ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 26700 ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc 26760 gtcagcgggt gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg 26820 agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 26880 cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct 26940 tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 27000 tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 27060 gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 27120 aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 27180 ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 27240 gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 27300 ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 27360 ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 27420 cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 27480 attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 27540 ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 27600 aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggtttttt 27660 gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 27720 tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgcat 27780 tctaggtact aaaacaattc atccagtaaa atataatatt ttattttctc ccaatcaggc 27840 ttgatcccca gtaagtcaaa aatagctcg acatactgtt cttccccgat atcctccctg 27900 atcgaccgga cgcagaaggc aatgtcatac cacttgtccg ccctgccgct tctcccaaga 27960 tcaataaagc cacttacttt gccatctttc acaaagatgt tgctgtctcc caggtcgccg 28020 tgggaaaaga caagttcctc ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc 28080 ggatctttaa atggagtgtc ttcttcccag ttttcgcaat ccacatcggc cagatcgtta 28140 ttcagtaagt aatccaattc ggctaagcgg ctgtctaagc tattcgtata gggacaatcc 28200 gatatgtcga tggagtgaaa gagcctgatg cactccgcat acagctcgat aatcttttca 28260 gggctttgtt catcttcata ctcttccgag caaaggacgc catcggcctc actcatgagc 28320 agattgctcc agccatcatg ccgttcaaag tgcaggacct ttggaacagg cagctttcct 28380 tccagccata gcatcatgtc cttttcccgt tccacatcat aggtggtccc tttataccgg 28440 ctgtccgtca tttttaaata taggttttca ttttctccca ccagcttata taccttagca 28500 ggagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt tttcaattcc 28560 ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag tatttaaaga 28620 taccccaaga agctaattat aacaagacga actccaattc actgttcctt gcattctaaa 28680 accttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg tataacatag 28740 tatcgacgga gccgattttg aaaccgcggt gatcacaggc agcaacgctc tgtcatcgtt 28800 acaatcaaca tgctaccctc cgcgagatca tccgtgtttc aaacccggca gcttagttgc 28860 cgttcttccg aatagcatcg gtaacatgag caaagtctgc cgccttacaa cggctctccc 28920 gctgacgccg tcccggactg atgggctgcc tgtatcgagt ggtgattttg tgccgagctg 28980 ccggtcgggg agctgttggc tggctggtgg caggatatat tgtggtgtaa aca 29033 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 gagctcggag ccgtagga 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <400> 11 gtgagcacga ggcaggtg 18 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <400> 12 ccggagtact cgctgtac 18 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 accttttggc ccaacatctg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 agcctgtatc gtggttgtcg 20 <210> 15 <211> twenty two <212> DNA <213> Artificial Sequence <400> 15 ccaaacttgt tgagtatgtc tt 22 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <400> 16 cgatgcttta ttcgtgtct 19 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <400> 17 gtgtccgtta gactcgtcg 19 <210> 18 <211> 17 <212> DNA <213> Artificial Sequence <400> 18 ttggtcgtgt cccgttt 17 <210> 19 <211> twenty two <212> DNA <213> Artificial Sequence <400> 19 gtgggtactc tttatctact gc 22 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 gtgactctgg tgcactggaa 20 <210> twenty one <211> 20 <212> DNA <213> Artificial Sequence <400> twenty one ccttgattct ttccagtctc 20 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two tctttaagca gtccttccct 20 <210> twenty three <211> 30 <212> DNA <213> Artificial Sequence <400> twenty three gttaacgaca cctgtctccg gattaattaa 30 <210> twenty four <211> 696 <212> DNA <213> Artificial Sequence <400> twenty four ccgcggtgat cacaggcagc aacgctctgt catcgttaca atcaacatgc taccctccgc 60 gagatcatcc gtgtttcaaa cccggcagct tagttgccgt tcttccgaat agcatcggta 120 acatgagcaa agtctgccgc cttacaacgg ctctcccgct gacgccgtcc cggactgatg 180 ggctgcctgt atcgagtggt gattttgtgc cgagctgccg gtcggggagc tgttggctgg 240 ctggtggcag gatatattgt ggtgtaaaca aattgacgct tagacaactt aataacacat 300 tgcggacgtt tttaatgtat gctccaccat gttggcaagc tgctctagcc aatacgcaaa 360 ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag gtttcccgac 420 tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agctcactca ttaggcaccc 480 caggctttac actttatgct tccggctcgt atgttgtgtg gaattgtgag cggataacaa 540 tttcacacag gaaacagcta tgaccatgat tacctgcagg cccgggcagc gctgaagaac 600 ttccctaggc acgtgtacgt attttttacc aggtgaactc caagtcctgg accctttttt 660 aagcttagat tgtcgtttcc cgccttcagt ttaaac 696 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 ctgcaggccc gggcagcgct gaagaacttc 30 <210> 26 <211> 60 <212> DNA <213> Artificial Sequence <400> 26 tgtacacagt ctttcaccag gacggttgta tcggttcagc agtcgcgatc gcatgcgcat 60 <210> 27 <211> 27 <212> DNA <213> Artificial Sequence <400> 27 atttaaattt cgaaacgcgt cggaccg 27 <210> 28 <211> 57 <212> DNA <213> Artificial Sequence <400> 28 cctaggcacg tgtacgtatt ttttaccagg tgaactccaa gtcctggacc ctttttt 57 <210> 29 <211> 2190 <212> DNA <213> Artificial Sequence <400> 29 ccatggtggg tggtggcggc ggcggcggcg gcgagggttt ctgggtttgg gcgagaggga 60 gagaggggtg gagagtgtgg gggtgtgggt gttttgtccg cgcgcggtga cgcagcgtga 120 ggcgatgtgt ggctcggatg ggatcgtgtg gggccacgtc acagtgggcc ccatatgtcg 180 gtgggatagg atgacacaca gccacgtcgg ggtcgatctg ggcccgcgtg tcagtcgatt 240 ggatgaggat gacaggtggg tcagtcccaa taacgggtgg agggtacaga acccgataaa 300 aaatcgatct caaagtcgga tgcggatgca accgcgagac ctagcagtct agcacccgca 360 cccgcacccg cacaaacgca gcgcaagatg agcagtggcg gcgagaagtc cggctcgggc 420 ggcggcggcg gtggcggcgg cggcggggcg gtgaagacgc cctccgactt cctcaagtcc 480 atcaggggc gccccgtcgt cgtcaagctc aactccggcg tcgactaccg cggtaacccc 540 ctgctcaatt ccctccccct ttttgcctca accctagacc cgctccccga aaaccctagc 600 acgagacgaa tgcgatgttt gttgtacccc gtatctcttt ctccttaatt ggaactctgc 660 gtttcttttc gttaattagt ggggggaagg aaaggcgtgg actctgtagg attttctttt 720 cgatttgatg accaagggag atacttattt tagtgctgtt taagatcctg ctagtgcccg 780 gtgtagctag gccatttgag aagcagataa ccgtgtttt ctgtaggacc ttctctaatc 840 ttgagctatt ttgatattct aattacttat ggttaaaccc tagaacctca gtatgtttta 900 acttagtaag agattgctac agtattttta tttgtaggaa caacattgta ggtggttatc 960 atgctactga ctgtcttgtg tagagccctc ctatcattaa ggggcttttaa tgtttactaa 1020 tagttagttt tagtacccat ttttctgtga gctactaaaa agaatatttc caattcaacc 1080 tatggtaatt taaagtactt tatgctgtat gtccatttac tgaggattat gattaatatt 1140 taagagggag gacatctgtg cttaaggttt gcattgcaat atttgataga tttatgctaa 1200 acaaaggtaa ttgtgcatgc ttgagataga aagggatttc ccttctttgg gtttgataat 1260 aaggggttgg cattccatga tcaggagcat agtgcattta tattttaataa tgtggctatg 1320 tgtatgcagt tctcaatttc acattggcgg tacacccatg atatatttaa ttgttaccca 1380 gaaccatata atagcctaat aagagcatat ggtattccat tgattggggc cttcggaagt 1440 gtacctgtgt atgtaactat gcatataagg tttactttct ggtagttctt tcttctcctc 1500 atcacttaag acatctggat cgctgtttatc aagtcgtaga ctagtcataa cgtcagtcaa 1560 gtcagacgac tagagggcta cgactcgacc aaatagcaag tcgcacaatt agtcgtagat 1620 tagtcatagc aaatcatcat ttcaccatgc taattggctt attgtgttta gtactttaaa 1680 tttatttctt gttaacttat tgtcttgctg gctactccat aaaccgtagt ttataatact 1740 atatatagtg cttagtacaa tagaatagta ctagagacta tatagtgcat ccattgtttt 1800 cacacgacca aatcatggac tagtcgtgga ctagattttg aatggaacag ttttaccaga 1860 aatacacttg ttcttttttt ttctgaatag tgttgaatca gtagctgcaa tgcatagctt 1920 gtgcaataaa atcattatat actatcacca atttcatgga atcttactta ttggaaattt 1980 gtaacaaatc tattttatcc cctgagttac cgtgttggtc taaaatcaac tcgcatgtga 2040 gacaagatga agaggaccat gaagattgcc tctttcattt attcatttgc tgactgcttg 2100 caatgccact ataaacctaa tcggatgact ggttgtcatg tctccgctaa ctagagagaa 2160 agggggagga gtgaagactt tacgtgtaca 2190 <210> 30 <211> 330 <212> DNA <213> Artificial Sequence <400> 30 tccggatta tttagcaaa tttgtttgtc agatcaaatt tttagcaaa acataagaa 120. ttggacacaa tgattaggga tcacttattc attatagttc ttccatgctg ctctaccaca gcaaaacgtt tcagacacca tcaaaccaga cttaaggata cacattacag gtaaatagta cacaatgaaa cgggacacga ccaaggacca 300. snow snow snow snow snow snow snow snow snow snow agcagct ctatggctga ggacggtacc

Claims

1. A genetically intelligent breeding system for rice hybrid breeding, characterized in that, Rice containing GAT sterile lines, GAT maintainer lines, and ordinary restorer lines; wherein the GAT sterile line is a recessive nuclear male sterile rice line, the recessive nuclear male sterile line is a rice line carrying the homozygous recessive male sterility gene gms2, and the GAT maintainer line is a recessive nuclear male sterility maintainer line rice line. The GAT maintainer line contains a single copy of the GAT vector and the homozygous recessive male sterility gene gms2. The gms2 is a rice GMS2 gene mutant, which is a deletion of the AACAGCTAC bases at positions 118 to 126 of the coding region of the rice GMS2 gene. The sequence of the gms2 mutant comes from Chinese Patent 202010491100.

4. The GAT vector contains plant male fertility restoration gene element expression cassette C48490, plant pollen abortion gene element expression cassette K5400, plant pollen abortion gene element expression cassette Khv, gene transformation and maintainer line screening element expression cassette MALS, herbicide sensitivity element expression cassette Mi, and seed screening element expression cassette Mzfn. Specifically, the functional component expression boxes are as follows: (1) Plant male fertility restoration gene element expression cassette C48490, used to restore male fertility of recessive nuclear sterile mutant gms2, wherein the plant male fertility restoration gene element expression cassette C48490 consists of a promoter, a male fertility restoration gene coding region and a terminator connected in sequence to function normally; wherein the male fertility restoration gene is the wild-type gene of GMS2; The promoter is the 2000bp sequence upstream of the start codon ATG of the rice GMS2 gene, the coding region is the coding region of the GMS2 gene, and the terminator is the 500bp sequence downstream of the stop codon TGA of the GMS2 gene. (2) Plant pollen abortion gene element expression cassette K5400, used to remove pollen containing GAT and maintain the heterozygous state of GAT maintainer line, its nucleotide sequence is shown in SEQ ID NO.2; (3) Plant pollen abortion gene element expression cassette Khv, used to remove pollen containing GAT and maintain the heterozygous state of GAT maintainer line, its nucleotide sequence is shown in SEQ ID NO.3; (4) Gene transformation and maintainer line screening element expression cassette MALS, used for gene transformation and purification of GAT maintainer lines, the nucleotide sequence of which is shown in SEQ ID NO.4; (5) Herbicide-sensitive element expression cassette Mi, used to remove pollen from herbicide-sensitive GAT maintainer lines, to purify GAT sterile lines, and to prevent seed leakage, and its nucleotide sequence is shown in SEQ ID NO.5; (6) Seed screening element expression cassette Mzfn, used for mechanical sorting of seeds, the nucleotide sequence of which is shown in SEQ ID NO.

6.

2. The intelligent genetic breeding system according to claim 1, characterized in that, The GAT sterile line is a sterile line controlled by a single recessive nuclear gene. When the gene locus is in a recessive homozygous state, it exhibits male sterility; in heterozygous and dominant homozygous states, it exhibits male fertility.

3. The genetically intelligent breeding system according to any one of claims 1-2, characterized in that, The GAT maintainer line self-pollinates, and the resulting seeds are separated in a 1:1 ratio to obtain the GAT maintainer line and the GAT sterile line. The two types of seeds are separated by the maintainer line selection element, enabling the GAT maintainer line to reproduce itself. The GAT maintainer line pollinates the GAT sterile line, causing the GAT sterile line to produce seeds and maintain the male sterility of its offspring, thereby achieving the reproduction of the recessive male sterile line.

4. A GAT vector for a GAT genetically intelligent breeding system based on the GMS2 gene, characterized in that, The GAT vector is constructed on the final vector by connecting functional element expression boxes via a connector sequence. The functional element expression boxes are as follows: (1) Plant male fertility restoration gene element expression cassette C48490, used to restore male fertility of recessive nuclear male sterile mutant gms2, gms2 is a rice GMS2 gene mutant, which is a deletion of AACAGCTAC bases at positions 118 to 126 of the coding region of the rice GMS2 gene. The sequence of the gms2 mutant comes from Chinese Patent 202010491100.

4. The plant male fertility restoration gene element expression cassette C48490 consists of a promoter, a male fertility restoration gene coding region and a terminator connected in sequence to function normally; the male fertility restoration gene is the wild-type gene of GMS2; The promoter is the 2000bp sequence upstream of the start codon ATG of the rice GMS2 gene, the coding region is the coding region of the GMS2 gene, and the terminator is the 500bp sequence downstream of the stop codon TGA of the GMS2 gene. (2) Plant pollen abortion gene element expression cassette K5400, used to remove pollen containing GAT and maintain the heterozygous state of GAT maintainer line, its nucleotide sequence is shown in SEQ ID NO.2; (3) Plant pollen abortion gene element expression cassette Khv, used to remove pollen containing GAT and maintain the heterozygous state of GAT maintainer line, its nucleotide sequence is shown in SEQ ID NO.3; (4) Gene transformation and maintainer line screening element expression cassette MALS, used for gene transformation and purification of GAT maintainer lines, the nucleotide sequence of which is shown in SEQ ID NO.4; (5) Herbicide-sensitive element expression cassette Mi, used to remove pollen from herbicide-sensitive GAT maintainer lines, to purify GAT sterile lines, and to prevent seed leakage, and its nucleotide sequence is shown in SEQ ID NO.5; (6) Seed screening element expression cassette Mzfn, used for mechanical sorting of seeds, the nucleotide sequence of which is shown in SEQ ID NO.

6.

5. The GAT carrier according to claim 4, characterized in that, The GAT vector is pC0309-KhvMALSMiMzfnC48490K5400, and its nucleotide sequence is shown in SEQ ID NO.

9.

6. The application of the genetic intelligent breeding system according to any one of claims 1-3 or the GAT vector according to any one of claims 4-5 in rice hybrid breeding and seed production, production of non-transgenic hybrid rice, large-scale maintenance of recessive nuclear male sterile rice lines, or large-scale propagation of recessive nuclear male sterile rice lines.

7. A method for maintaining the homozygous recessive state of recessive male-sterile rice plants, characterized in that, The GAT vector according to any one of claims 4-5 is introduced into a GAT male-sterile line with a recessive homozygous genotype to create a GAT transformant containing only a single copy of the GAT vector. The genotype of the GAT transformant is recessive homozygous / GAT-. The GAT transformant is then pollinated with the GAT male-sterile line, and the resulting seeds still have a recessive homozygous genotype, thereby maintaining the male sterility of the offspring of the GAT male-sterile line and successfully propagating the GAT male-sterile line. The GAT male-sterile line is a rice variety carrying the homozygous recessive male sterility gene gms2. gms2 is a rice GMS2 gene mutant, which is a deletion of the AACAGCTAC base at positions 118 to 126 of the coding region of the rice GMS2 gene. The sequence of the gms2 mutant is derived from Chinese Patent 202010491100.

4.

8. A method for maintaining the heterozygous state of recessive nuclear male-sterile rice plants, characterized in that, Introducing the GAT vector according to any one of claims 4-5 into a GAT-sterile line with a recessive homozygous genotype creates a GAT transformant containing only a single copy of the GAT vector. The genotype of the GAT transformant is recessive homozygous / GAT-. The GAT transformant is self-pollinated to produce two genotypes of seeds: one is recessive homozygous / GAT-, which is the GAT maintainer line; the other is recessive homozygous / --, which is the GAT-sterile line. According to the laws of inheritance, the two segregate in a 1:1 ratio, that is, the GAT locus with the genotype recessive homozygous / GAT- in the self-pollinated offspring of the GAT transformant remains heterozygous. The GAT-sterile line is a rice variety carrying the homozygous recessive male sterility gene gms2. gms2 is a rice GMS2 gene mutant, which is a deletion of the AACAGCTAC bases at positions 118 to 126 of the coding region of the rice GMS2 gene. The sequence of the gms2 mutant comes from Chinese Patent 202010491100.

4.

9. A method for screening or distinguishing self-pollinated seeds of rice GAT transformants and rice plants, characterized in that, By introducing the GAT vector according to any one of claims 4-5 into a GAT male-sterile line with a recessive homozygous genotype, a GAT transformant containing only a single copy of the GAT vector is created. The genotype of the GAT transformant is recessive homozygous / GAT-. The seeds produced by self-pollination of the GAT transformant show a 1:1 segregation ratio. The GAT male-sterile line is a rice variety carrying the homozygous recessive male sterility gene gms2. gms2 is a rice GMS2 gene mutant, which is a deletion of the AACAGCTAC bases at positions 118 to 126 of the coding region of the rice GMS2 gene. The sequence of the gms2 mutant is derived from Chinese Patent 202010491100.

4. 50% of the seeds produced by self-pollination of GAT transformants are seeds and plants containing the GAT vector, and their genotype is recessive homozygous / GAT-, exhibiting high resistance to herbicides targeting acetyllactate synthase. 50% of the seeds produced by self-pollination of GAT transformants do not contain the GAT vector. They are genotyped as recessive homozygous, do not contain the GAT element, and do not have high resistance to herbicides. The herbicide is bispyribac-sodium, imidacloprid, or metribuzin.

10. A method for preventing pollen drift in GAT plants, characterized in that, The GAT vector described in any one of claims 4-5 is transferred into plants, so that when the pollen matures, the plant material containing the GAT vector will specifically cause the pollen containing the GAT vector to abort due to the presence of pollen abortion gene elements, while ensuring that the pollen without the GAT vector develops and releases pollen normally, thereby reducing the probability of pollen containing the GAT vector escaping. The plant in question is rice.

11. A method for preventing the drift or mixing of rice GAT seeds or rice plants, characterized in that, The rice seeds or rice plants contain the GAT carrier as described in any one of claims 4-5. During the seed stage, the material containing GAT seeds or plants is killed at a specific time by coating or by applying a specific concentration of herbicide from the seedling stage to the flowering stage, thereby preventing GAT seeds or plants from being mixed with other common materials. The herbicide is bentazon or bensulfuron-methyl.

12. A method for producing sterile seeds using a recessive nuclear male sterile line in plants, characterized in that, Using the genetic intelligent breeding system described in any one of claims 1-3, the GAT maintainer line and the GAT sterile line are mixed and sown in a certain proportion. The GAT maintainer line is used to pollinate the GAT sterile line. After pollination, a herbicide is applied to specifically kill the GAT maintainer line, leaving only the GAT sterile line for seed harvesting. The herbicide is bentazon or bensulfuron-methyl. The plant in question is rice.

13. A method for purifying recessive nuclear male sterile lines in plants, characterized in that, Using the genetic intelligent breeding system described in any one of claims 1-3, the GAT sterile line is screened by seed coating or by applying herbicides from the seedling stage to the flowering stage to ensure the purity of the GAT sterile line; the herbicide is bentazon or bensulfuron-methyl; The plant in question is rice.

14. A method for hybridization seed production using a recessive nuclear male-sterile line in plants, characterized in that, Using the intelligent genetic breeding system according to any one of claims 1-3, GAT maintainer line seeds and GAT sterile line seeds are produced by self-pollination of GAT maintainer lines; GAT sterile line seeds are produced by pollinating GAT maintainer lines with GAT sterile lines; and hybrid seeds are produced by crossbreeding GAT sterile lines with conventional materials. The plant in question is rice.

15. A method for hybridization breeding using recessive nuclear male-sterile lines in plants, characterized in that, The genetic intelligent breeding system described in any one of claims 1-3 is used to select and breed GAT maintainer lines by hybridization with ordinary materials, and to select GAT maintainer lines and sterile lines by conventional backcrossing or by pedigree method. The selection process is supplemented by screening of various molecular markers of GAT or screening of herbicides. The plant in question is rice.

16. A method for preparing commercially viable rice hybrids without GAT elements using the genetically intelligent breeding system according to any one of claims 1-3, characterized in that, By crossing the GAT maintainer line with conventional material A, F1 hybrids were obtained. Subsequently, F2 hybrids were obtained through self-pollination. In the F2 generation, materials containing homozygous recessive nuclear male sterility sites and GAT elements were selected by supplementing GAT molecular markers and herbicides. Stable materials of higher generations were obtained through continuous self-pollination, from which new GAT maintainer lines and GAT male sterile lines were obtained. The newly selected GAT male sterile lines and ordinary restorer lines were crossed to select ordinary commercial hybrids. These hybrids do not contain GAT elements and are ordinary commercial hybrids.

17. A method for sorting plants and offspring with different functions, characterized in that, The GAT vector described in any one of claims 4-5 is transferred into plants. Using the gene transformation and maintainer line selection element expression cassette and herbicide sensitive element expression cassette in the GAT vector, plants and offspring with different functions are selected based on a combination of positive and negative bidirectional selection of chemical herbicides and phenotypic selection. Positive selection of chemical herbicides is for herbicides such as bispyribac-sodium, imidacloprid, or metsulfuron-methyl, while negative selection is for herbicides such as bentazon or bensulfuron-methyl. The plant in question is rice.

Images