Application of a cellobiose phosphorylase polypeptide
By performing site-directed mutagenesis and genetic modification on cellobiose phosphorylase peptides, the technological gap in the catalytic production of galactose-1-phosphate from lactose by CBP has been filled, enabling efficient and low-cost industrial production and simplifying the process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-10
- Publication Date
- 2026-04-03
AI Technical Summary
In existing technologies, cellobiose phosphorylase peptide (CBP) is widely used to catalyze the conversion of cellobiose to glucose-1-phosphate. However, there is a lack of effective means to catalyze the conversion of lactose to galactose-1-phosphate. Moreover, its natural source bacteria are distributed in harsh environments, making large-scale industrial production difficult.
By site-directed mutagenesis of cellobiose phosphorylase peptide derived from *Vibrio thermophilus*, its ability to catalyze the conversion of lactose to galactose-1-phosphate was optimized. Then, by using genetically modified recombinant bacteria expression and immobilized enzyme technology, the catalytic conversion of lactose to galactose-1-phosphate in a buffer system with pH 3–11 was achieved.
This paper presents a green, efficient, and scalable industrial method for the production of galactose-1-phosphate, which avoids the cumbersome steps and high costs of chemical methods, reduces production costs, and simplifies the process.
Smart Images

Figure BDA0003347534070000101 
Figure BDA0003347534070000121 
Figure HDA0003347534080000011
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and enzyme engineering technology, and specifically relates to the application of a cellobiose phosphorylase polypeptide. Background Technology
[0002] Carbohydrates are one of the basic building blocks of living organisms, often participating in metabolic processes in free form (oligosaccharides or polysaccharides) or in conjugates. All important life processes rely on carbohydrates and their derivatives. Phosphorylated sugars, such as glucose-1-phosphate and galactose-1-phosphate, are widely found in plants, animals, and microorganisms. They are substrates for many enzymes and play important biological functions in the life activities of organisms. Glucose-1-phosphate is an important central metabolite in polysaccharide synthesis and can be used as an important starting material for the biosynthesis of various glycosides. Furthermore, glucose-1-phosphate has high medicinal value, significantly inhibiting fatty liver infiltration, promoting calcium accumulation in bones and teeth, and enhancing the active transport of calcium in the small intestine of mammals. It can also be used as an antibacterial agent and as a component in the manufacture of wound hemostatic materials and drug sustained-release materials (Zhang Yao et al., Recombinant Pyrococcus furiosus dextran phosphorylase catalyzes the synthesis of glucose-1-phosphate from starch, 2016, Vol.30, No.2); its platinum chelates can even be used in cancer treatment. Galactose-1-phosphate also has important biological functions. It is an important early diagnostic marker for screening newborns for hereditary galactose metabolism disorders and can exert cytotoxicity by inhibiting cell metabolism.
[0003] The current industrial production of glucose-1-phosphate is quite complex, mainly involving the catalysis of sucrose phosphorylase (SPaSe) or soluble starch by dextran phosphorylase (GPaSe). In the former method, SPaSe is a room-temperature enzyme, making industrial application difficult, and half of the carbon atoms in sucrose are converted into the byproduct fructose, resulting in incomplete utilization of the sugar source. In the latter method, the raw material production process for soluble starch is very cumbersome. For the preparation of galactose-1-phosphate, galactose-1-phosphate uridine diphosphate transferase can be used to catalyze the reaction of glucose-1-phosphate with UDP-galactose to form galactose-1-phosphate and UDP-glucose (CN201810182540.4); or galactokinase can be used to catalyze the reaction of galactose (CN201010548354.1). Artificially synthesized phosphorylated sugars have enormous application potential as precursors for the preparation of pharmaceuticals, foods, or food additives.
[0004] Sugar phosphorylases catalyze the phosphorylation of glycosidic bonds to produce phosphorylated sugars. Since the energy of a glycosyl phosphate bond is lower than that of a glycosyl glycosidic bond (the substrate of glycosyltransferases), the reaction is reversible. Therefore, sugar phosphorylases can be used to directly synthesize or degrade sugar chains to produce phosphorylated sugars through reversible reactions, providing a green, simple, and efficient approach.
[0005] Cellobiosesaccharide phosphorylase (CBP, EC2.4.1.20) is a member of the GH94 family of glycoside hydrolases. First discovered in *Clostridium thermocellum* in 1955, it exists as an intracellular enzyme in cellulose-utilizing bacterial cells. It was found that CBP can catalyze the reversible phosphorylation of cellobioses to glucose-1-phosphate and glucose without ATP consumption. Furthermore, its phosphorylation activity for cellobiosesaccharide degradation is significantly greater than that of hydrolases. Studies have shown that CBP from *Clostridium thermocellum* exhibits a phosphorylation rate for β-glucan that is more than 20 times higher than its hydrolysis rate, demonstrating strong substrate specificity in catalyzing the conversion of cellobioses to glucose-1-phosphate.
[0006] In addition, researchers have found that the natural sources of CBP are all anaerobic bacteria, and they are mostly distributed in environments with very harsh living conditions, such as Clostridium thermophilum, Ruminococcus leucis, Vibrio fibrinolyticus, Clostridium fecal microbiota, Ruminococcus suis, Moist Fibromonas, Thermophyton floccosum, and Thermophyton floccosum. Therefore, obtaining a large amount of CBP is still quite difficult, which hinders its large-scale application in industrial production. Summary of the Invention
[0007] According to existing technology, cellobiose phosphorylase peptides have strong substrate specificity in catalyzing the production of glucose-1-phosphate from cellobiose. However, the inventors have unexpectedly discovered that cellobiose phosphorylase peptides also have excellent properties in catalyzing the production of galactose-1-phosphate from lactose. Currently, there are no reports on the use of CBP to catalyze the production of galactose-1-phosphate from lactose.
[0008] The present invention also provides a method for preparing cellobiose phosphorylase polypeptide suitable for industrial production.
[0009] The technical solution of the present invention is as follows:
[0010] Application of a cellobiose phosphorylase polypeptide in catalyzing the production of galactose-1-phosphate from lactose.
[0011] According to a preferred embodiment of the present invention, the cellobiose phosphorylase polypeptide comprises:
[0012] (1) A cellobiose phosphorylase polypeptide with an amino acid sequence as shown in SEQ ID NO.1;
[0013] (2) A cellobiose phosphorylase polypeptide mutant with a cellobiose phosphorylase that catalyzes the production of galactose-1-phosphate from lactose, as shown in SEQ ID NO.1, by site-directed mutagenesis of the amino acid sequence shown in SEQ ID NO.1.
[0014] More preferably, the cellobiose phosphorylase polypeptide with the amino acid sequence shown in SEQ ID NO.1 is derived from *Acetivibrio thermocellus*.
[0015] More preferably, the catalytic activity of the cellobiose phosphorylase polypeptide mutant is -25% to 25% of the catalytic activity of the cellobiose phosphorylase polypeptide with the amino acid sequence as shown in SEQ ID NO.1.
[0016] More preferably, the cellobiose phosphorylase polypeptide mutant is a site-directed single mutant, a site-directed double mutant, or a site-directed multiple mutant.
[0017] More preferably, the mutation sites of the cellobiose phosphorylase polypeptide mutant are as follows:
[0018] 1) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 355 from arginine to alanine; or
[0019] 2) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 355 from arginine to leucine; or
[0020] 3) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 360, changing from arginine to leucine; or
[0021] 4) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 499 from glutamine to phenylalanine; or
[0022] 5) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 636 from glutamic acid to alanine; or
[0023] 6) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 640 from tyrosine to alanine; or
[0024] 7) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 645 from lysine to alanine; or
[0025] 8) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 645 from lysine to phenylalanine; or
[0026] 9) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 645 from lysine to leucine; or
[0027] 10) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 646 from glutamic acid to alanine; or
[0028] 11) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 651 from phenylalanine to tyrosine; or
[0029] 12) The amino acid sequence shown in SEQ ID NO.1 is mutated at position 501 from threonine to isoleucine, and at position 654 is mutated at position 654 from asparagine to alanine; or
[0030] 13) Combinations of two or more different mutation sites as described in 1) to 12) above.
[0031] According to a preferred embodiment of the present invention, the cellobiose phosphorylase polypeptide catalyzes the formation of galactose-1-phosphate from lactose by means of the following method: in a buffer system with a pH of 3 to 11, lactose is converted into galactose-1-phosphate under the catalysis of the cellobiose phosphorylase polypeptide or its mutant.
[0032] More preferably, the buffer solution is HEPES buffer or Tris-HCl buffer.
[0033] More preferably, the buffer system contains KH2PO4, and the molar ratio of KH2PO4 to the buffer solute is (3-5):5.
[0034] More preferably, the pH of the buffer solution system is 6 to 9; even more preferably, it is 8.
[0035] More preferably, the cellobiose phosphorylase polypeptide or its mutant can participate in the catalytic reaction in the form of a free enzyme or an immobilized enzyme.
[0036] More preferably, the immobilized enzyme of the cellobiose phosphorylase polypeptide or its mutant is prepared according to the following method:
[0037] Within a temperature range of 20-30℃, cellobiose phosphorylase polypeptide or its mutant is mixed with immobilized resin and stirred until homogeneous. After 12-24 hours, the mixture is separated, and the solid is washed with buffer to obtain immobilized enzyme.
[0038] Preferably, the immobilization resin is selected from amino 703 resin, amino 700 resin or epoxy 600 resin, and the buffer solution is Tris-HCl buffer solution.
[0039] More preferably, the reaction temperature of the catalysis is 20℃~80℃; even more preferably, it is 40℃~60℃.
[0040] According to a preferred embodiment of the present invention, the specific steps of the cellobiose phosphorylase polypeptide catalyzing the conversion of lactose to galactose-1-phosphate are as follows:
[0041] (1) Construct a recombinant plasmid encoding cellobiose phosphorylase polypeptide or its mutant gene, and introduce the recombinant plasmid encoding cellobiose phosphorylase polypeptide or its mutant gene into the host bacteria to construct an engineered strain of cellobiose phosphorylase polypeptide or its mutant.
[0042] (2) Inducing expression of cellobiose phosphorylase polypeptide or its mutant strain from step (1), and obtaining crude enzyme solution of cellobiose phosphorylase polypeptide or its mutant strain after cell disruption.
[0043] (3) Using lactose as a substrate and the cellobiose phosphorylase polypeptide or its mutant crude enzyme solution from step (2) as a biocatalyst, galactose-1-phosphate is generated at 20°C to 80°C in a buffer system containing KH2PO4 with a pH of 3 to 11.
[0044] According to a preferred embodiment of the present invention, the host bacteria in step (1) is Escherichia coli, Bacillus subtilis, Bacillus licheniformis, Kluyveromyces martensii, or Kluyveromyces lactis.
[0045] According to a preferred embodiment of the present invention, in step (1), when the host bacterium is Escherichia coli, the plasmid vector of the recombinant plasmid is pET28a; when the host bacterium is Bacillus subtilis or Bacillus licheniformis, the plasmid vector of the recombinant plasmid is pEB03; and when the host bacterium is Kluyveromyces martensii or Kluyveromyces lactis, the plasmid vector of the recombinant plasmid is pklac1.
[0046] According to a preferred embodiment of the present invention, the culture medium used for the induction expression in step (2) is LB medium or YPD medium. When the host bacterium is Escherichia coli, Bacillus subtilis or Bacillus licheniformis, the culture medium used is LB medium. When the host is Kluyveromyces martensii or Kluyveromyces lactis, the culture medium used is YPD medium.
[0047] According to a preferred embodiment of the present invention, the crude enzyme solution of cellobiose phosphorylase polypeptide in step (3) can also be purified and used as a biocatalyst to catalyze the generation of galactose-1-phosphate.
[0048] Beneficial effects:
[0049] This invention provides a method for synthesizing galactose-1-phosphate using lactose as a substrate in the presence of cellobiose phosphorylase polypeptide or its mutant. This method is a green, efficient, and scalable industrial method for the production of galactose-1-phosphate.
[0050] The present invention also provides CBP or CBP mutant expressed using genetically modified recombinant bacteria.
[0051] Compared to chemical methods for synthesizing phosphorylated sugars, the technical solution of this invention offers numerous advantages, including milder conditions, higher efficiency, higher selectivity, and fewer byproducts. It avoids the cumbersome protection and deprotection processes of chemical methods, significantly reduces the use of organic reagents, and is relatively inexpensive compared to metal catalysts (silver, palladium). This not only helps save production costs but also allows for large-scale industrial application. Currently, glycosyltransferases and glycoside hydrolases are widely used for the enzymatic production of glycosides. Glycosyltransferases require high-energy nucleotide sugars as substrates for glycosyl reactions, resulting in higher process requirements and costs. The hydrolysis rate of glycoside hydrolases has been proven to be much lower than the phosphorylation rate of CBP in many reactions, and CBP can catalyze the production of phosphorylated sugars without consuming ATP, greatly reducing production costs and simplifying the process. The CBP enzyme production method of this invention exhibits high production levels and excellent catalytic characteristics, making it valuable for large-scale industrial production of phosphorylated sugars and promoting their further application in the synthesis of other sugar derivatives. Attached Figure Description
[0052] Figure 1 This is an SDS-PAGE electrophoresis image of CBP from Example 1.
[0053] Figure 2 This is an SDS-PAGE electrophoresis image of the CBP mutant (R355A) from Example 2.
[0054] Figure 3 This is an SDS-PAGE electrophoresis image of the CBP mutant (T501I / N654A) from Example 3.
[0055] Figure 4 The enzyme catalytic activity of CBP at different temperatures.
[0056] Figure 5 The thermal stability of CBP at different temperatures.
[0057] Figure 6 The relative enzyme activity of CBP at different pH values.
[0058] Figure 7 The curve shows the change in the concentration of galactose-1-phosphate during the CBP-catalyzed synthesis of lactose in Example 5. Detailed Implementation
[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; all materials and reagents are commercially available unless otherwise specified.
[0060] The present invention will be further described in detail below through embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Modifications or substitutions to the details and form of the technical solution without departing from the structural concept and scope of use of the present invention shall fall within the protection scope of the present invention.
[0061] The activity assay system and method for cellobiose phosphorylase polypeptide and its mutants of the present invention are as follows:
[0062] Assay system: 10 mM cellobiose, 10 mM KH2PO4, 5 mM Mg 2+ 5mM dithiothreitol, 20μg CBP or CBP mutant was added to the experimental group, and an equal amount of boiled CBP or CBP mutant was added to the control group. 50mM HEPES buffer (pH 7.0) was added to 1mL.
[0063] Determination method: The above reaction system was placed in a 50℃ water bath and reacted for 15 min. The reaction was terminated by boiling for 10 min. The enzyme activity of cellobiose phosphorylase polypeptide or its mutant was determined by detecting the amount of glucose by high performance liquid chromatography. The amount of enzyme required to generate 1 μmol of glucose in 1 minute was defined as 1 U.
[0064] The quantitative determination method for cellobiose phosphorylase polypeptide and its mutant protein in this invention is the Coomassie Brilliant Blue method (Bradford method), as detailed below:
[0065] The method for preparing the protein standard curve is as follows: Standard bovine serum albumin (5 mg / mL) is diluted to 0, 5, 10, 15, 20, 25, 30, 40, 50, and 100 μg / mL. 20 μL of each diluted standard bovine serum albumin gradient solution is placed in the microplate holder, and 200 μL of Bradford reagent is added and thoroughly mixed. Immediately after mixing, the absorbance at 595 nm is measured using a microplate reader. The actual absorbance is calculated by subtracting the absorbance of the blank control at 595 nm from the measured absorbance. The actual absorbance is used as the x-axis, and the concentration of standard bovine serum albumin is used as the y-axis to construct the CBP protein standard curve as follows: y = 0.163x + 0.0388, R² = 0.997, with a linear range of 0.1-0.5 mg / mL.
[0066] The method for quantitative determination of protein samples is as follows: Dilute the sample to be tested to an appropriate concentration so that it is within the linear range of the standard curve during detection. Take 20 μL of the diluted sample into the microplate tank, add 200 μL of Bradford reagent and mix thoroughly. Use protein-free water or buffer as a blank control. Immediately after mixing, use a microplate reader to detect the absorbance of the mixture at 595 nm. The actual absorbance is obtained by subtracting the absorbance of the blank control at 595 nm from the detected absorbance. Substitute the actual absorbance after detection into the standard curve to calculate the actual concentration of protein in the sample to be tested.
[0067] The yield of galactose-1-phosphate and glucose-1-phosphate is calculated by quantifying the amount of reaction substrate lactose or cellobiose consumed. The molar concentration of consumed lactose or cellobiose is the molar concentration (mM) of galactose-1-phosphate or glucose-1-phosphate produced.
[0068] Example 1. Expression and purification of cellobiose phosphorylase polypeptide (CBP) and its mutants in Escherichia coli.
[0069] The cellobiose phosphorylase (CBP) encoding gene is derived from *Acetivibriothermocellus*. The amino acid sequence of CBP is shown in SEQ ID No:1. The CBP encoding gene was cloned into the pET28a plasmid and then introduced into *Escherichia coli* for expression. The specific steps are as follows:
[0070] (1) Construction of recombinant plasmid pET28a-CBP
[0071] Using the genome of *Acetivibrio thermocellus* as a template, the CBP encoding gene was amplified by PCR. The CBP encoding gene was then inserted into the PET-28a plasmid vector to construct the recombinant plasmid pET28a-CBP encoding gene.
[0072] First, the primer design is as follows:
[0073] CBP-F: 5'-ACCATGGGCAGCAGCTTAGCCTAGCAACAC-3', SEQ ID No: 2;
[0074] CBP-R: 5'-GTGGTGGTGGTGGTGATGAAGTACGGTTTT-3', SEQ ID No: 3;
[0075] PET28a-CBP-F: 5'-AAAACCGTACTTCATCACCACCACCACCAC-3', SEQ ID No: 4;
[0076] PET28a-CBP-R: 5'-GTGTTGCTAGGCTAAGCTGCTGCCCATGGT-3', SEQ ID No: 5;
[0077] Using high-fidelity Phanta Max Super-Fidelity DNA Polymerase, with CBP-F / CBP-R as primers and *Vibrio thermocellulose* genome as template, the CBP-encoding gene was amplified by PCR, including:
[0078] PCR amplification reaction system (50 μL): 1 μL of *Vibrio thermophilus* genome, 25 μL of 2×Phanta Max Buffer, 1 μL of 10 pmol / μL dNTP Mix, 2 μL each of 10 pmol / μL forward and reverse primers CBP-F / CBP-R, 1 μL of 1 U / μL Phanta Max Super-Fidelity DNA Polymerase, and ddH2O added to 50 μL;
[0079] PCR amplification reaction program: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 1.5 min, 33 cycles; 72℃ for 5 min; store at 4℃.
[0080] Simultaneously, using PET28a-CBP-F / PET28a-CBP-R as primers and the PET-28a empty plasmid vector as a template, PCR amplification was performed on the linear PET-28a fragment carrying a 15bp homologous arm of the CBP coding gene, wherein:
[0081] PCR amplification reaction system (50 μL): 1 μL PET-28a empty plasmid vector, 25 μL 2×Phanta Max Buffer, 1 μL 10 pmol / μL dNTP Mix, 2 μL each of 10 pmol / μL forward and reverse primers PET28a-CBP-F / PET28a-CBP-R, 1 μL 1 U / μL Phanta Max Super-Fidelity DNA Polymerase, and ddH2O added to 50 μL;
[0082] PCR amplification reaction program: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 4 min, 33 cycles; 72℃ for 5 min; store at 4℃.
[0083] After PCR amplification, each fragment was recovered using a gel extraction kit to ensure a high concentration of each DNA fragment for successful subsequent experiments. Then, the PET-28a linear fragment and the CBP coding gene were ligated using the MultiF Seamless Assembly Mix kit to obtain the recombinant plasmid PET28a-CBP.
[0084] Using a point mutation kit (KOD-Plus-Mutagenesis Kit, Code No. SMK-101), the recombinant plasmid obtained above was subjected to site-directed mutagenesis with the following primers to obtain the mutant recombinant plasmid PET28a-CBP'. The specific mutation sites are as follows:
[0085] R355A: The CBP amino acid sequence at position 355 is mutated from arginine (R) to alanine (A);
[0086] R355L: The CBP amino acid sequence is mutated at position 355 from arginine (R) to leucine (L);
[0087] R360L: The CBP amino acid sequence is mutated at position 360 from arginine (R) to leucine (L);
[0088] Q499F: The CBP amino acid sequence is mutated at position 499 from glutamine (Q) to phenylalanine (F);
[0089] E636A: The CBP amino acid sequence is mutated at position 636 from glutamic acid (E) to alanine (A);
[0090] Y640A: The CBP amino acid sequence at position 640 is site-directed from tyrosine (Y) to alanine (A);
[0091] K645A: The CBP amino acid sequence is mutated at position 645 from lysine (K) to alanine (A);
[0092] K645L: The CBP amino acid sequence is mutated at position 645 from lysine (K) to leucine (L);
[0093] The K645F:CBP amino acid sequence is mutated at position 645 from lysine (K) to phenylalanine (F);
[0094] E646A: The CBP amino acid sequence is mutated at position 646 from glutamic acid (E) to alanine (A);
[0095] F651Y: The CBP amino acid sequence is mutated at position 651 from phenylalanine (F) to tyrosine (Y);
[0096] The primer sequences corresponding to the above site-directed mutations are as follows:
[0097] R355A-F: 5’-GCTGGTATGGGTTTCAGAGATTCAAACCAGGACTTG-3’, SEQ ID No:6,
[0098] R355A-R: 5’-TCCGATACCGGATTCAAAGTATGAAGCGC-3’, SEQ ID No:7;
[0099] R355L-F: 5’-CTGGGTATGGGTTTCAGAGATTCAAACCAGGACTTG-3’, SEQ ID No:8,
[0100] R355L-R: 5’-TCCGATACCGGATTCAAAGTATGAAGCGC-3’, SEQ ID No:9;
[0101] [[ID=1S]]R360L-F: 5’-TTAGATTCAAACCAGGACTTGCTGGGATTTGTACACCAGAT-3’, SEQ ID No:10,
[0102] R360L-R: 5’-GAAACCCATACCTCTTCCGATACCGGATTCAAAGTATGAAG-3’, SEQ ID No:11;
[0103] Q499F-F: 5’-TTCACCACAACAAGCAAAGACGGAAAAGTGGCAGAG-3’, SEQ ID No:12,
[0104] Q499F-R: 5’-GAACGACTCATCCGGAACGGTGGAGAAGC-3’, SEQ ID No:13;
[0105] E636A-F: 5’-CTATTTCAACATATCCACCGGGATACAAAGAAAATGCCG-3’, SEQID No:14,
[0106] E636A-R: 5’-CTCCGTACTCAATATAGTATCTTGTAAACGCGGG-3’, SEQ ID No:15;
[0107] Y640A-F: 5’-GCTCCACCGGGATACAAAGAAAATGCCG-3’, SEQ ID No:16,
[0108] Y640A-R:5’-TGTTGAAATTTCTCCGTACTCAATATAGTATCTTGTAAACGCGGG-3’,SEQ IDNo:17;
[0109] K645A-F:5’-GCTGAAAATGCCGGTATATTCTGCCACAACAATGC-3’,SEQ ID No:18,
[0110] K645A-R:5’-GTATCCCGGTGGATATGTTGAAATTTCTCCGTACTCAA-3’,SEQ ID No:19;
[0111] K645L-F:5’-CTGGAAAATGCCGGTATATTCTGCCACAACAATGC-3’,SEQ ID No:20,
[0112] K645L-R:5’-GTATCCCGGTGGATATGTTGAAATTTCTCCGTACTCAA-3’,SEQ ID No:21。
[0113] K645F-F:5’-TTCGAAAATGCCGGTATATTCTGCCACAACAATGC-3’,SEQ ID No:22,
[0114] K645F-R:5’-GTATCCCGGTGGATATGTTGAAATTTCTCCGTACTCAA-3’,SEQ ID No:23;
[0115] E646A-F:5’-CTAATGCCGGTATATTCTGCCACAACAATGCATGGATAATC-3’,SEQ ID No:24,
[0116] E646A-R:5’-CTTTGTATCCCGGTGGATATGTTGAAATTTCTCCGTACTC-3’,SEQ ID No:25;
[0117] F651Y-F:5’-ATTGCCACAACAATGCATGGATAATCTGTGCTGAAACG-3’,SEQ ID No:26,
[0118] F651Y-R:5'-ATATACCGGCATTTTCTTTGTATCCCGGTGGATATGTTGAAATTTCTCCG-3', SEQ ID No: 27;
[0119] (2) Plasmid transformation of Escherichia coli
[0120] Take 50 μL of competent E. coli BL21(DE3) cells, add 1 μL of recombinant plasmid pET28a-CBP or pET28aCBP', mix with a pre-cooled pipette tip, and incubate on ice for 30 min; then heat in a 42℃ incubator for 45 s and quickly immerse in an ice-water bath for 2 min; add 800 μL of antibiotic-free LB liquid medium and incubate at 37℃ and 200 rpm in a metal shaker for 1 h; after incubation, take 100 μL of bacterial culture and spread it on kanamycin-resistant LB solid medium, and incubate at 37℃ for 12–24 h.
[0121] (3) Culture of Escherichia coli and induction of CBP / CBP mutant expression
[0122] Prepare LB liquid medium, sterilize at 121℃ for 30 min by high-temperature steam, cool to room temperature for later use. Pick a single colony transformed in step (2) and place it in 50 mL of LB liquid medium containing kanamycin resistance. Incubate at 37℃ and 200 rpm for 12 h to obtain seed culture. Take 10 mL of seed culture and transfer it to 1 L of LB liquid medium containing kanamycin. Incubate at 37℃ and 200 rpm for about 3 h. Wait for the bacterial culture OD 600 When the concentration is 0.6-0.8, add 1 mL of 1M IPTG solution to make the final IPTG concentration 1 mM. Incubate at 16℃ and 150 rpm for 12-18 h on a shaker. Centrifuge the bacterial suspension at 10000×g for 10 min and collect the induced bacterial cells. Resuspend the bacterial cell pellet in 20 mM imidazole buffer (containing PBS), place it on ice, and sonicate for 30 min until the bacterial suspension changes from turbid to a light-transmitting colloidal liquid to obtain the lysed bacterial suspension, releasing the target protein. Place the lysed bacterial suspension in a 50 mL centrifuge tube, centrifuge at 10000×g for 30 min, discard the pellet, and keep the supernatant to obtain the crude enzyme solution of CBP or CBP mutant.
[0123] (4) Purification of CBP / CBP mutant
[0124] First, the crude enzyme solution of CBP or CBP mutant was filtered through a 0.22 μm filter membrane, and then the protein was purified using a GE HisTrap HP (5 mL) nickel column. Six column volumes were first washed with ultrapure water, and then equilibrated with 20 mM imidazole (containing PBS). The filtered CBP or CBP mutant crude enzyme solution was then loaded. After loading, a gradient elution was performed using 20 mM imidazole buffer (containing PBS), 40 mM imidazole buffer (containing PBS), and 250 mM imidazole buffer (containing PBS). The protein eluted with 250 mM imidazole buffer (containing PBS) was collected. The purified protein was then desalted using a desalting column to remove imidazole and other salts. Finally, the protein was eluted with 50 mM Tris-HCl buffer, and the results were verified by SDS-PAGE electrophoresis. The SDS-PAGE verification results for CBP are shown below. Figure 1 The validation results for other CBP mutants were the same as for CBP, yielding protein bands of CBP peptides or CBP mutant peptides with a size of approximately 100 kDa.
[0125] (5) CBP / CBP mutant activity assay
[0126] The activities of the above CBP / CBP mutants were measured, and the changes in CBP mutant activity were calculated based on the activity of CBP. The results are shown in Table 1. The results indicate that, relative to CBP activity, except for the mutant CBP... Q499F The activity of the mutant remained unchanged, while the activities of other mutants increased or decreased to varying degrees.
[0127] Table 1. Activity changes of recombinant CBP mutant expressed in Escherichia coli.
[0128] Site mutation Changes in CBP activity relative to CBP mutants <![CDATA[CBP R355A ]]> 6% <![CDATA[CBP R355L ]]> 13% <![CDATA[CBP R360L ]]> -12% <![CDATA[CBP Q499F ]]> 0 <![CDATA[CBP Y640A ]]> -14% <![CDATA[CBP E636A ]]> 22% <![CDATA[CBP K645A ]]> 15% <![CDATA[CBP K645L ]]> 4% <![CDATA[CBP K645F ]]> -1% <![CDATA[CBP E646A ]]> -25% <![CDATA[CBP F651Y ]]> -12%
[0129] illustrate:
[0130] 1. R stands for arginine; A for alanine; L for leucine; Q for glutamine; F for phenylalanine; E for glutamic acid; K for lysine; and Y for tyrosine.
[0131] 2. Unmutated CBP activity is recorded as 100%.
[0132] Example 2. Expression and purification of CBP / CBP mutants in Bacillus subtilis and Bacillus licheniformis
[0133] The CBP encoding gene was cloned into the shuttle plasmid pEB03, and then introduced into Bacillus subtilis or Bacillus licheniformis for efficient expression. The specific steps are as follows:
[0134] (1) Construction of recombinant plasmid pEB03-CBP
[0135] Following Example 1, after obtaining the CBP encoding gene and the linear fragment of plasmid pEB03, the pEB03 linear fragment and the CBP encoding gene were ligated using the MultiF Seamless Assembly Mix kit to obtain the recombinant plasmid pEB03-CBP. The primer sequences for PCR amplification of the pEB03 linear fragment are as follows:
[0136] pEB03-CBP-F: 5'-GATAAGCTTATGAAGTTCGGTTTTTTTGATGATGCAAACAAA-3', SEQ IDNo: 28;
[0137] pEB03-CBP-R: 5'-CAGGAATTCTCCCATAATTACTTCAACTTTGTGAGTCTTTCC-3', SEQ ID No: 29.
[0138] Using the same method as in Example 1, a point mutation kit (KOD-Plus-Mutagenesis Kit, Code No. SMK-101) was used, with primers designed as in Example 1. Mutations were performed on key amino acid sites (R355, Q499, E636, or K645) in the CBP amino acid sequence to obtain the mutant recombinant plasmid pEB03 CBP'. The specific mutation sites are as follows:
[0139] R355A: The CBP amino acid sequence at position 355 is mutated from arginine (R) to alanine (A);
[0140] R355L: The CBP amino acid sequence is mutated at position 355 from arginine (R) to leucine (L);
[0141] Q499F: The CBP amino acid sequence is mutated at position 499 from glutamine (Q) to phenylalanine (F);
[0142] E636A: The CBP amino acid sequence is mutated at position 636 from glutamic acid (E) to alanine (A);
[0143] K645A: The CBP amino acid sequence is mutated at position 645 from lysine (K) to alanine (A);
[0144] K645L: The CBP amino acid sequence is mutated at position 645 from lysine (K) to leucine (L);
[0145] (2) Transformation of free recombinant plasmids pEB03-CBP / pEB03-CBP' in Bacillus subtilis or Bacillus licheniformis
[0146] Streaking a 1-circular bacillus subtilis or bacillus licheniformis glycerol suspension onto an LB agar plate (LB medium: 1% peptone, 0.5% yeast extract, 1% NaCl, 1.5% agar powder added to the plate, all percentages by mass), incubate overnight at 37°C; pick a single colony and transfer it to 1 mL of LB liquid medium, incubate overnight at 37°C and 200 rpm; the next day, transfer 200 μL of the culture to 200 mL of growth medium (i.e., LB liquid medium with 0.5 M sorbitol added), incubate at 37°C and 200 rpm until OD reaches 0.5%. 600nm When the pH reaches 0.85-0.95, incubate on ice for 10 min, centrifuge at 5000 rpm for 5 min at 4℃, then wash 4 times with pre-cooled electroporation medium (electroporation medium: LB liquid medium with 0.5M sorbitol and 10% glycerol), and finally resuspend in 2 mL of pre-cooled electroporation medium.
[0147] The treated bacterial culture was dispensed into 80 μL tubes, and 1 μL (approximately 50 ng) of recombinant plasmid pEB03-CBP or pEB03-CBP' was added. The tubes were then transferred to pre-cooled electroporation cuvettes and placed on ice for 1-1.5 min. Electroporation was then performed using an electroporator with the following parameters: voltage 2000 V, resistance 200 Ω. The tubes were then placed on ice for 2 min, followed by the addition of 1 mL of recovery medium (i.e., LB liquid medium with 0.5 M sorbitol and 0.38 M mannitol). The tubes were then incubated at 37 °C and 200 rpm for 90 min. The bacterial culture was then spread onto chloramphenicol (50 μg / mL) LB plates, and transformants were picked to obtain the recombinant Bacillus subtilis or Bacillus licheniformis genetically engineered strains.
[0148] (3) Culture of recombinant Bacillus subtilis or Bacillus licheniformis and expression of CBP / CBP mutant
[0149] Single colonies of the above-mentioned recombinant Bacillus subtilis or Bacillus licheniformis genetically engineered strains were cultured overnight at 37°C and 200 rpm in 10 mL LB liquid medium to obtain the primary seed culture. The primary seed culture was inoculated into 1 L LB liquid medium and cultured at 37°C and 200 rpm until OD reached. 600 The solution was brought to approximately 0.8, yielding a secondary seed culture. This secondary seed culture was then inoculated into a 100L LB liquid fermenter and cultured at 37°C with citric acid and NaOH to maintain a pH of approximately 7.0. Aeration and stirring were maintained, and dissolved oxygen was kept at 20-30%. The fermentation proceeded until the OD reached a certain level. 600The solution was brought to approximately 0.8, yielding a tertiary seed culture. Finally, the tertiary seed culture was inoculated into a 3T fermenter with LB liquid medium, incubated at 36–38°C with aeration and stirring, dissolved oxygen controlled at 20–30%, and pH maintained at 6–8 with citric acid and NaOH. The culture was incubated for approximately 26 hours, followed by centrifugation at 10000×g for 30 min to remove bacterial cells. The supernatant was concentrated using an ultrafiltration membrane with a molecular weight cutoff of 10000-30000 to obtain CBP or a CBP mutant concentrate. SDS-PAGE electrophoresis was used to verify the presence of the CBP mutant recombinantly expressed in Bacillus subtilis. R355A The SDS-PAGE verification results are as follows Figure 2 The validation results for other CBP or CBP mutants were the same as those for the CBP described above, yielding protein bands of CBP peptides or CBP mutant peptides with a size of approximately 100 kDa.
[0150] (4) Purification of CBP / CBP mutant
[0151] CBP or CBP mutant concentrate was purified by affinity chromatography using a GE AKTApurifier chromatography system and a 5 mL HisTrap FFcrude column. The column was first washed with 6 column volumes of pure water, then equilibrated with buffer B (0.5 M imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 8.0) at a flow rate of 10 mL / min. The column was then equilibrated again with buffer A (0.5 M NaCl, 20 mM Tris-HCl, pH 8.0) at the same flow rate until the baseline stabilized, at a flow rate of 10 mL / min. The CBP or CBP mutant concentrate was then loaded at a flow rate of 5 mL / min. After loading, the sample was eluted with buffer B, and the protease solution was collected upon the appearance of a peak.
[0152] (5) CBP / CBP mutant activity assay
[0153] The activities of the above CBP / CBP mutants were measured, and the changes in CBP mutant activity were calculated based on the CBP activity in each host bacterium. The results are shown in Table 2. The results indicate that, relative to the CBP activity of the corresponding Bacillus species, the CBP mutants expressed in different Bacillus species, except for the mutant CBP... Q499F The activity of the mutant remained unchanged, while the activities of other mutants were increased to varying degrees.
[0154] Table 2. Activity changes of recombinant CBP mutants.
[0155]
[0156] illustrate:
[0157] 1. In the table, R represents arginine; A represents alanine; L represents leucine; Q represents glutamine; F represents phenylalanine; E represents glutamic acid; and K represents lysine.
[0158] 2. Unmutated CBP activity is recorded as 100%.
[0159] Example 3. Expression of CBP / CBP mutants in *Kluyveromyces martensii* or *Kluyveromyces lactis*
[0160] (1) Construction of recombinant plasmids
[0161] The unmutated CBP coding gene was ligated to the pklac1 plasmid to obtain the recombinant plasmid pklac1-CBP. Simultaneously, key amino acid sites in the CBP amino acid sequence shown in SEQ ID No:1 were mutated, and codons were optimized according to yeast codon preferences to obtain the CBP mutant coding gene fragment. This CBP mutant coding gene was then ligated to the pklac1 plasmid to obtain the mutant recombinant plasmid pklac1-CBP'. The construction of all these recombinant plasmids was completed with the assistance of BGI Genomics.
[0162] The specific mutation sites of key amino acids in the CBP amino acid sequence are as follows:
[0163] R355A: The CBP amino acid sequence at position 355 is mutated from arginine (R) to alanine (A);
[0164] R355L: The CBP amino acid sequence is mutated at position 355 from arginine (R) to leucine (L);
[0165] Q499F: The CBP amino acid sequence is mutated at position 499 from glutamine (Q) to phenylalanine (F);
[0166] E636A: The CBP amino acid sequence is mutated at position 636 from glutamic acid (E) to alanine (A);
[0167] K645A: The CBP amino acid sequence is mutated at position 645 from lysine (K) to alanine (A);
[0168] K645L: The CBP amino acid sequence is mutated at position 645 from lysine (K) to leucine (L);
[0169] In the T501I / N654A:CBP amino acid sequence, position 501 is mutated from threonine (T) to isoleucine (I), and position 654 is mutated from asparagine (N) to alanine (A).
[0170] (2) Amplification of CBP / CBP mutant expression cassette
[0171] Based on the nucleotide sequence of the recombinant plasmid pklac1-CBP / pklac1-CBP', primers were designed and PCR amplification was performed to obtain the CBP / CBP mutant expression cassette.
[0172] The nucleotide sequences of the PCR primers are as follows:
[0173] CBP-F1:5'-GTCGTTCCAGACCATAACAAGCAAAGACGGAAAAGTGGCA-3',SEQ ID No:30,
[0174] CBP-R1:5'-TATCCATGCATTGGGCTGGCAGAATATACCGGCATTTTCTTT-3',SEQ ID No:31,
[0175] R355L-F1:5'-CTGGGTATGGGTTTTAGAGATTCTAATCAAGACTTGTTGG-3',SEQ ID No:32,
[0176] R355L-R1:5'-TCCGATACCGGATTCAAAGTATGAAGCGC-3',SEQ ID No:33,
[0177] R355A-F1:5'-GCCGGTATGGGTTTTAGAGATTCTAATCAAGACTTGTTG-3',SEQ ID No:34,
[0178] R355A-R1:5'-ACCAATACCAGACTCAAAGTAAGAAGCAGACC-3',SEQ ID No:35,
[0179] Q499F-F1:5'-TTCACTACTACTTCTAAAGACGGCAAGGTCGC-3',SEQ ID No:36,
[0180] Q499F-R1:5'-AAAAGACTCATCTGGGACAGTAGAGAAGCAG-3',SEQ ID No:37,
[0181] E636A-F1:5'-CCATCTCTACTTATCCACCAGGTTATAAAGAGAATGCTG-3',SEQ ID No:38,
[0182] E636A-R1:5'-CGCCGTACTCAATGTAATATCTAGTAAAAGCTGG-3',SEQ ID No:39,
[0183] K645A-F1:5'-GCCGAGAATGCTGGTATTTTCTGCCACAATAACG-3',SEQ ID No:40,
[0184] K645A-R1:5'-ATAACCTGGTGGATAAGTAGAGATCTCGCCGT-3',SEQ ID No:41,
[0185] K645L-F1:5'-CTCGAGAATGCTGGTATTTTCTGCCACAATAACG-3',SEQ ID No:42,
[0186] K645L-R1:5'-GTATCCCGGTGGATATGTTGAAATTTCTCCGTACTCAA-3',SEQ ID No:43,
[0187] T501I / N654A-F1:5'-CCGCGGGGATCGACTCATAAAATAGTAACCTTCT-3',SEQ ID No:44,
[0188] T501I / N654A-R1: 5'-GCCGCGAAATTTAGGAATTTTAAACTTGGGCTTG-3', SEQ ID No: 45;
[0189] PCR amplification reaction system (50 μL): DNA template (pklac1-CBP / pklac1-CBP') 1 μL (approximately 50 ng), 2×Phanta Max Buffer 25 μL, 10 pmol / μL dNTP Mix 1 μL, 10 pmol / μL forward and reverse primers 2 μL each, 1 U / μL Phanta Max Super-Fidelity DNA Polymerase 1 μL, and ultrapure water added to 50 μL;
[0190] PCR amplification program: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 5 min, 33 cycles; 72℃ for 5 min; store at 4℃.
[0191] After agarose gel electrophoresis, the gel was excised and recovered to obtain the CBP / CBP mutant expression cassette containing homologous arms of *Kluyveromyces marxi* and *Kluyveromyces lactis* at both ends.
[0192] (3) The CBP / CBP mutant expression cassette was transformed into *Kluyveromyces martensii* and *Kluyveromyces lactis*.
[0193] Pick freshly cultured *Kluyveromyces martensii* or *Kluyveromyces lactis* colonies and add them to 1 mL of YPD medium. Incubate in a constant temperature shaker at 30°C and 250 rpm for 12-14 h. Transfer the culture to 50 mL of fresh YPD medium and initially inoculate with OD. 600 Incubate at 0.2°C, 30°C, and 200 rpm for 3-4 hours until OD reaches 0.2. 600 The concentration of the bacterial cells was 0.8–1. After centrifugation to collect the bacterial cells, 5–10 μg of bacterial cells were added to ice-cold sterile ultrapure water, centrifuged at 5000 × g for 5 min at 4 °C, the supernatant was discarded, and the bacterial cells were collected. Then, 1 mL of 0.1 M LiCl solution was added to resuspend the bacterial cells, centrifuged at 13000 × g for 15 s at 4 °C, the supernatant was discarded, and 400 μL of 0.1 M LiCl solution was added to resuspend the bacterial cells. 50 μL of the resuspended bacterial cells was taken out, centrifuged at 13000 × g for 15 s at 4 °C, and the supernatant was discarded. 240 μL of 50% PEG3350 solution and 36 μL of 1 M LiCl solution were added to the treated bacterial cells. LiCl solution, 25 μL of pretreated salmon sperm DNA solution (2 mg / mL) (reacted at 95°C for 10 min in a PCR instrument, then rapidly cooled in an ice-water bath and kept on ice for later use), 50 μL of the CBP / CBP mutant expression cassette solution to be transformed, vortex vigorously until the cells are completely distributed, incubate at 30°C for 30 min, then heat shock in a 42°C water bath for 25 min; cool to room temperature, centrifuge at 8000×g for 2 min to collect the cells, resuspend the cells in 1 mL of YPD medium, and incubate at 30°C in a shaker for 1–4 h. Then, take 25–100 μL of the bacterial solution and spread it on YPD medium plates containing G418 resistance; place the plates in a 30°C incubator and invert for 2–3 days, then pick transformants to verify whether the CBP / CBP mutant expression cassette has been successfully transformed.
[0194] (4) Culture of Kluyveromyces martensii and Kluyveromyces lactis and expression of CBP / CBP mutant
[0195] Single colonies of the successfully transformed *Kluyveromyces martensii* or *Kluyveromyces lactis* were cultured overnight at 30°C and 200 rpm in 1 mL of YPD liquid medium to obtain the primary seed culture. The primary seed culture was inoculated into 100 mL of YPD liquid medium and cultured at 30°C and 200 rpm until OD reached [value missing]. 600The pH was increased to approximately 0.8 to obtain a secondary seed culture. This secondary seed culture was then inoculated into a 100 LYPG liquid fermenter at 30°C. The pH was controlled to approximately 7.0 with citric acid and NaOH, and aeration and stirring were maintained. Dissolved oxygen was controlled at 20-30%. The culture was incubated for approximately 26 hours, followed by centrifugation at 10000×g for 30 minutes to remove the bacterial cells. The supernatant was concentrated using an ultrafiltration membrane with a molecular weight cutoff of 10000-30000 to obtain the CBP / CBP mutant concentrate. SDS-PAGE electrophoresis was used to verify the presence of the CBP mutant recombinantly expressed in *Kluyveromyces martensii*. T501I / N654A The SDS-PAGE verification results are as follows Figure 3 The validation results of other CBP or CBP mutants are consistent with those of CBP. T501I / N654A Similarly, protein bands of CBP peptides or CBP mutant peptides with a size of approximately 100 kDa were obtained.
[0196] (5) CBP / CBP mutant activity assay
[0197] The activities of the above CBP / CBP mutants were measured, and the changes in CBP mutant activity were calculated based on the CBP activity in each host strain. The results are shown in Table 3. The results indicate that, relative to the CBP activity of the respective yeast strains, the CBP mutants expressed in different yeast strains, except for the mutant CBP... Q499F The activity of the mutant remained unchanged, while the activities of other mutants changed to varying degrees.
[0198] Table 3. Activity changes of various CBP mutants in *Kluyveromyces martensii* or *Kluyveromyces lactis*
[0199]
[0200] illustrate:
[0201] 1. In the table, R represents arginine; A represents alanine; L represents leucine; Q represents glutamine; F represents phenylalanine; E represents glutamic acid; K represents lysine; T represents threonine; I represents isoleucine; and N represents asparagine.
[0202] 2. Unmutated CBP activity is recorded as 100%.
[0203] Experimental Example 1. Effect of temperature on the catalytic activity and stability of cellobiose phosphorylase peptides and their mutants
[0204] 1. The effect of temperature on enzyme catalytic activity
[0205] The catalytic activity of the CBP obtained in Example 1 was measured at temperatures ranging from 10 to 80 °C. The catalytic activity of CBP at 50 °C was defined as 100%, and this was used as a reference condition for other temperatures. The experimental results are as follows: Figure 4As shown, the catalytic activity of CBP for cellobiose begins to appear at 20℃, reaches its maximum at 60℃, and decreases rapidly with increasing temperature after 60℃, but still has activity at 80℃.
[0206] 2. The effect of temperature on enzyme stability
[0207] CBP was incubated at different temperatures ranging from 10 to 80°C, and samples were taken at 12 h and 24 h to determine its activity and detect the thermal stability of CBP at each temperature.
[0208] Experimental results are as follows Figure 5 As shown, CBP exhibits good stability in its catalytic activity towards cellobiose within the temperature range of 40℃ to 60℃, maintaining high activity even after 12 hours of incubation. Notably, the catalytic activity of CBP decreases significantly after 24 hours of incubation at 60℃; and its stability deteriorates above 60℃.
[0209] The effect of temperature on the catalytic activity and stability of other CBPs and CBP mutants in Examples 1-3 was detected using the above method. The results were consistent with those of the CBPs detected above. The CBPs showed activity in the range of 20℃-80℃, with the strongest activity at 60℃, and good stability in the range of 40℃-60℃.
[0210] Experimental Example 2. Effect of pH on the catalytic activity of CBP and its mutants
[0211] The effect of pH on the catalytic activity of CBP obtained in Example 1 was determined. Different pH values between 3 and 11 were selected, and the activity of CBP was measured using citrate buffer and 50 mM HEPES buffer, respectively. The catalytic activity of CBP at pH 7.0 in HEPES buffer was defined as 100%, and this was used as a reference condition for other pH values.
[0212] Experimental results showed that the CBP obtained in Example 1 was active between pH 3 and 11, with better activity between pH 6 and 9, and exhibited optimal catalytic activity at pH 8.0. Figure 6 As shown.
[0213] The effect of pH on the catalytic activity of other CBPs and CBP mutants in Examples 1-3 was detected using the above method, and the results were consistent with those of CBP.
[0214] Example 4. Using CBP (Q499F) The mutant catalyzes the synthesis of glucose-1-phosphate from cellobiose.
[0215] Cellobiose was reacted with KH2PO4 and the purified CBP from Example 1. Q499FThe mutants were mixed in 50 mM HEPES buffer (pH 8.0), with a cellobiose concentration of 20 mM, a KH₂PO₄ concentration of 30 mM, and CBP concentration in the mixed solution. (Q499F) The concentration of glucose was 0.2 g / L. After reaction at 60 °C, samples were taken at regular intervals to detect the yield of glucose-1-phosphate. The results showed that the yields of glucose-1-phosphate were 12.82 mM, 14.05 mM, and 13.11 mM at the 6th, 12th, and 24th hours of the reaction, respectively.
[0216] Example 5. Utilization of CBP to catalyze the conversion of lactose to galactose-1-phosphate
[0217] Lactose was mixed with KH₂PO₄ and CBP purified in Example 1 in 50 mM HEPES buffer (pH 8.0). The concentration of lactose in the mixed solution was 20 mM, the concentration of KH₂PO₄ was 30 mM, and the concentration of CBP was 0.2 g / L. After reaction at 60 °C, samples were taken at regular intervals to determine the yield of galactose-1-phosphate. The results are as follows: Figure 7 As shown. At the 2nd, 6th, and 12th hours of the reaction, the yields of galactose-1-phosphate were 7.6 mM, 13.75 mM, and 13.5 mM, respectively.
[0218] Example 6. Catalysis of lactose to galactose-1-phosphate using immobilized CBP
[0219] Enzyme immobilization: CBP purified in Example 1 was mixed with amino 703 resin, amino 700 resin, and epoxy 600 resin, respectively. The mixtures were incubated at 25°C and 100-150 rpm for 18-20 hours to obtain a final solution. The final solution was filtered and washed three times with 50 mM pH 8.0 Tris-HCl buffer. The immobilized enzyme on the resins was stored at 4°C for later use. The filtrate volume was recorded, and the protein content was measured using a micro-volume analyzer to calculate the adsorption rate of the immobilized enzyme. 1 g of amino 703 resin adsorbed 610 mg of CBP, with an adsorption rate of 61%; 1 g of amino 700 resin adsorbed 490 mg of CBP, with an adsorption rate of 49%; and 1 g of epoxy 600 resin adsorbed 183 mg of CBP, with an adsorption rate of 18.3%.
[0220] Lactose, 1 mg of immobilized enzyme CBP, and KH₂PO₄ were mixed in 50 mM HEPES buffer (pH 8.0), and the volume was adjusted to 1 mL with HEPES buffer. The concentration of lactose in the mixed solution was 20 mM, and the concentration of KH₂PO₄ was 50 mM. After reacting at 60 °C for 12 h, samples were taken, and the yield of galactose-1-phosphate of the amino 703 resin immobilized enzyme was 13.7 mM, the yield of galactose-1-phosphate of the amino 700 resin immobilized enzyme was 11.5 mM, and the yield of galactose-1-phosphate of the epoxy 600 resin immobilized enzyme was 4.1 mM.
[0221] Example 7. Using CBP T501I / N654A The mutant catalyzes the conversion of lactose to galactose-1-phosphate.
[0222] CBP expressed and purified from *Kluyveromyces martensii* in Example 3 was used. T501I / N654A The CBP mutant enzyme was immobilized using the same method as in Example 6, with amino 703 resin as the immobilization carrier.
[0223] Take lactose and 1 mg of immobilized enzyme CBP T501I / N654A The mutant and KH₂PO₄ were mixed in 50 mM HEPES buffer (pH 8.0) and brought to a final volume of 1 mL with HEPES buffer. The concentration of lactose in the mixture was 20 mM, and the concentration of KH₂PO₄ was 50 mM. After reacting at 60 °C for 12 h, samples were taken, and the yield of galactose-1-phosphate was determined to be 10.4 mM.
[0224] Example 8. Catalysis of lactose to galactose-1-phosphate using CBP / CBP mutant
[0225] Lactose, KH2PO4, and the CBP / CBP mutant purified from Bacillus subtilis expression in Example 2 were mixed in 50 mM Tris-HCl buffer (pH 6.5). The concentration of lactose in the mixed solution was 20 mM, the concentration of KH2PO4 was 30 mM, and the concentration of CBP / CBP mutant was 0.2 g / L. After reacting at 55 °C for 6 h, samples were taken to detect the yield of galactose-1-phosphate. The results are shown in Table 4.
[0226] Table 4. Galactose-1-phosphate catalytic yield of recombinant CBP / CBP mutant expression
[0227] CBP / CBP mutant Galactose-1-phosphate yield CBP 13.75mM <![CDATA[CBP R355A ]]> 14.9mM <![CDATA[CBP R355L ]]> 15.5mM <![CDATA[CBP Q499F ]]> 13.7mM <![CDATA[CBP E636A ]]> 16.5mM <![CDATA[CBP K645A ]]> 15.95mM <![CDATA[CBP K645L ]]> 14.0mM
[0228] Example 9. Catalysis of maltose, trehalose and sucrose using CBP
[0229] Maltose, trehalose, or sucrose were mixed with KH₂PO₄ and the purified cellobiose phosphorylase polypeptide CBP or CBP mutant from Example 1 in 50 mM Tris-HCl buffer (pH 6.5). The concentrations of maltose, trehalose, or sucrose were 20 mM, KH₂PO₄ was 30 mM, and the concentration of CBP / CBP mutant was 0.2 g / L. After reacting at 55°C for 6 h, samples were taken for analysis. The results showed that the content of the three disaccharides did not change over time and was not consumed, indicating that CBP does not have a catalytic effect on these three disaccharides.
[0230] In summary, Examples 1-9 demonstrate that, compared to unmutated CBP, the activity of mutated CBP peptides varies depending on the mutation site, sometimes increasing and sometimes decreasing, without a fixed pattern. However, all mutants can generate galactose-1-phosphate from lactose as a substrate. Furthermore, CBP and its mutants do not exhibit catalytic activity towards other disaccharides such as maltose, trehalose, and sucrose.
[0231] Comparative Example 1. Study on lactose catalysis by CBP (derived from *Cellobacterium*) expressed in *Escherichia coli*.
[0232] The gene encoding cellobiose phosphorylase polypeptide (CBP) was derived from *Cellulomonas udaDSM20108*, GenBank ID: AY343322. The CBP encoding gene (AY343322) was cloned into the pGEM-T plasmid and then introduced into *E. coli* for expression. The specific steps are as follows:
[0233] Using the C. uda DSM20108 genome as a template, the CBP coding gene was amplified by PCR. The pGEM-T plasmid was selected, and the CBP coding gene was inserted into the pGEM-T plasmid to construct a recombinant plasmid, following the method described in Example 1. The primers for PCR amplification of the CBP coding gene are designed as follows:
[0234] Upstream primer: 5'-AACGTTACGGGCACTTCGACGAC-3', SEQ ID No: 46
[0235] Downstream primer: 5'-ATTCTGCAGCTAGAGGGTCACGTCGACGC-3', SEQ ID No: 47;
[0236] Following Example 1, after obtaining the CBP encoding gene and the pGEM-T linear fragment, the pGEM-T linear fragment and the CBP encoding gene were ligated using the MultiF Seamless Assembly Mix kit to obtain the recombinant plasmid pGEM-T-CBP. The pGEM-T-CBP plasmid was then transformed into *E. coli*. Positive transformants of *E. coli* were cultured in TSB liquid medium for 16 hours, centrifuged at 10000×g for 30 min to remove bacterial cells, and the supernatant was concentrated using an ultrafiltration membrane with a molecular weight cutoff of 10000-30000 to obtain the cellobiose phosphorylase polypeptide concentrate.
[0237] The above-mentioned CBP concentrate was used to catalyze the conversion of lactose to galactose-1-phosphate, as follows: 30 mL of CBP concentrate was mixed with 170 mL of substrate solution (200 mM lactose and 30 mM KH2PO4 in 50 mM Mes buffer (pH 6.6)). The catalytic reaction was carried out at 37 °C for 12 h. After sampling and analysis, the results showed that the yield of galactose-1-phosphate was extremely small, only 0.1 mM, which was negligible.
[0238] Comparative Example 1 shows that the CBP expressed by Escherichia coli (derived from the genus Fibrio) does not have the activity of catalyzing the conversion of lactose to galactose-1-phosphate. SEQUENCE LISTING <110> Shandong Henglu Biotechnology Co., Ltd. <120> Application of a cellobiose phosphorylase polypeptide <160> 47 <170> PatentIn version 3.5 <210> 1 <211> 807 <212> PRT <213> Acetivibrio thermocellus <400> 1 Met Lys Phe Gly Phe Phe Asp Asp Ala Asn Lys Glu Tyr Val Ile Thr 1 5 10 15 Val Pro Arg Thr Pro Tyr Pro Trp Ile Asn Tyr Leu Gly Thr Glu Asn 20 25 30 Phe Phe Ser Leu Ile Ser Asn Thr Ala Gly Gly Tyr Cys Phe Tyr Arg 35 40 45 Asp Ala Arg Leu Arg Arg Ile Thr Arg Tyr Arg Tyr Asn Asn Val Pro 50 55 60 Ile Asp Met Gly Gly Arg Tyr Phe Tyr Ile Tyr Asp Asn Gly Asp Phe 65 70 75 80 Trp Ser Pro Gly Trp Ser Pro Val Lys Arg Glu Leu Glu Ser Tyr Glu 85 90 95 Cys Arg His Gly Leu Gly Tyr Thr Lys Ile Ala Gly Lys Arg Asn Gly 100 105 110 Ile Lys Ala Glu Val Thr Phe Phe Val Pro Leu Asn Tyr Asn Gly Glu 115 120 125 Val Gln Lys Leu Ile Leu Lys Asn Glu Gly Gln Asp Lys Lys Lys Ile 130 135 140 Thr Leu Phe Ser Phe Ile Glu Phe Cys Leu Trp Asn Ala Tyr Asp Asp 145 150 155 160 Met Thr Asn Phe Gln Arg Asn Phe Ser Thr Gly Glu Val Glu Ile Glu 165 170 175 Gly Ser Val Ile Tyr His Lys Thr Glu Tyr Arg Glu Arg Arg Asn His 180 185 190 Tyr Ala Phe Tyr Ser Val Asn Ala Lys Ile Ser Gly Phe Asp Ser Asp 195 200 205 Arg Asp Ser Phe Ile Gly Leu Tyr Asn Gly Phe Asp Ala Pro Gln Ala 210 215 220 Val Val Asn Gly Lys Ser Asn Asn Ser Val Ala Asp Gly Trp Ala Pro 225 230 235 240 Ile Ala Ser His Ser Ile Glu Ile Glu Leu Asn Pro Gly Glu Gln Lys 245 250 255 Glu Tyr Val Phe Ile Ile Gly Tyr Val Glu Asn Lys Asp Glu Glu Lys 260 265 270 Trp Glu Ser Lys Gly Val Ile Asn Lys Lys Lys Ala Tyr Glu Met Ile 275 280 285 Glu Gln Phe Asn Thr Val Glu Lys Val Asp Lys Ala Phe Glu Glu Leu 290 295 300 Lys Ser Tyr Trp Asn Ala Leu Leu Ser Lys Tyr Phe Leu Glu Ser His 305 310 315 320 Asp Glu Lys Leu Asn Arg Met Val Asn Ile Trp Asn Gln Tyr Gln Cys 325 330 335 Met Val Thr Phe Asn Met Ser Arg Ser Ala Ser Tyr Phe Glu Ser Gly 340 345 350 Ile Gly Arg Gly Met Gly Phe Arg Asp Ser Asn Gln Asp Leu Leu Gly 355 360 365 Phe Val His Gln Ile Pro Ala Arg Ala Arg Glu Arg Leu Leu Asp Leu 370 375 380 Ala Ala Thr Gln Leu Glu Asp Gly Gly Ala Tyr His Gln Tyr Gln Pro 385 390 395 400 Leu Thr Lys Lys Gly Asn Asn Glu Ile Gly Ser Asn Phe Asn Asp Asp 405 410 415 Pro Leu Trp Leu Ile Leu Ala Thr Ala Ala Tyr Ile Lys Glu Thr Gly 420 425 430 Asp Tyr Ser Ile Leu Lys Glu Gln Val Pro Phe Asn Asn Asp Pro Ser 435 440 445 Lys Ala Asp Thr Met Phe Glu His Leu Thr Arg Ser Phe Tyr His Val 450 455 460 Val Asn Asn Leu Gly Pro His Gly Leu Pro Leu Ile Gly Arg Ala Asp 465 470 475 480 Trp Asn Asp Cys Leu Asn Leu Asn Cys Phe Ser Thr Val Pro Asp Glu 485 490 495 Ser Phe Gln Thr Thr Thr Ser Lys Asp Gly Lys Val Ala Glu Ser Val 500 505 510 Met Ile Ala Gly Met Phe Val Phe Ile Gly Lys Asp Tyr Val Lys Leu 515 520 525 Cys Glu Tyr Met Gly Leu Glu Glu Glu Ala Arg Lys Ala Gln Gln His 530 535 540 Ile Asp Ala Met Lys Glu Ala Ile Leu Lys Tyr Gly Tyr Asp Gly Glu 545 550 555 560 Trp Phe Leu Arg Ala Tyr Asp Asp Phe Gly Arg Lys Val Gly Ser Lys 565 570 575 Glu Asn Glu Glu Gly Lys Ile Phe Ile Glu Ser Gln Gly Phe Cys Val 580 585 590 Met Ala Glu Ile Gly Leu Glu Asp Gly Lys Ala Leu Lys Ala Leu Asp 595 600 605 Ser Val Lys Lys Tyr Leu Asp Thr Pro Tyr Gly Leu Val Leu Gln Asn 610 615 620 Pro Ala Phe Thr Arg Tyr Tyr Ile Glu Tyr Gly Glu Ile Ser Thr Tyr 625 630 635 640 Pro Pro Gly Tyr Lys Glu Asn Ala Gly Ile Phe Cys His Asn Asn Ala 645 650 655 Trp Ile Ile Cys Ala Glu Thr Val Val Gly Arg Gly Asp Met Ala Phe 660 665 670 Asp Tyr Tyr Arg Lys Ile Ala Pro Ala Tyr Ile Glu Asp Val Ser Asp 675 680 685 Ile His Lys Leu Glu Pro Tyr Val Tyr Ala Gln Met Val Ala Gly Lys 690 695 700 Asp Ala Lys Arg His Gly Glu Ala Lys Asn Ser Trp Leu Thr Gly Thr 705 710 715 720 Ala Ala Trp Asn Phe Val Ala Ile Ser Gln Trp Ile Leu Gly Val Lys 725 730 735 Pro Asp Tyr Asp Gly Leu Lys Ile Asp Pro Cys Ile Pro Lys Ala Trp 740 745 750 Asp Gly Tyr Lys Val Thr Arg Tyr Phe Arg Gly Ser Thr Tyr Glu Ile 755 760 765 Thr Val Lys Asn Pro Asn His Val Ser Lys Gly Val Ala Lys Ile Thr 770 775 780 Val Asp Gly Asn Glu Ile Ser Gly Asn Ile Leu Pro Val Phe Asn Asp 785 790 795 800 Gly Lys Thr His Lys Leu Lys 805 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 accatgggca gcagcttagc ctagcaacac 30 <210> 3 <211> 30 <212> DNA <213> Artificial sequence <400> 3 gtggtggtgg tggtgatgaa gtacggtttt 30 <210> 4 <211> 30 <212> DNA <213> Artificial sequence <400> 4 aaaaccgtac ttcatcaccaccaccaccac 30 <210> 5 <211> 30 <212> DNA <213> Artificial sequence <400> 5 gtgttgctag gctaagctgc tgcccatggt 30 <210> 6 <211> 36 <212> DNA <213> Artificial sequence <400> 6 gctggtatgg gtttcagaga ttcaaaccag gacttg 36 <210> 7 <211> 29 <212> DNA <213> Artificial sequence <400> 7 tccgataccg gattcaaagt atgaagcgc 29 <210> 8 <211> 36 <212> DNA <213> Artificial sequence <400> 8 ctgggtatgg gtttcagaga ttcaaaccag gacttg 36 <210> 9 <211> 29 <212> DNA <213> Artificial sequence <400> 9 tccgataccg gattcaaagt atgaagcgc 29 <210> 10 <211> 41 <212> DNA <213> Artificial sequence <400> 10 ttagattcaa accaggactt gctgggattt gtacaccaga t 41 <210> 11 <211> 41 <212> DNA <213> Artificial sequence <400> 11 gaaacccata cctcttccga taccggattc aaagtatgaa g 41 <210> 12 <211> 36 <212> DNA <213> Artificial sequence <400> 12 ttcaccacaa caagcaaaga cggaaaagtg gcagag 36 <210> 13 <211> 29 <212> DNA <213> Artificial sequence <400> 13 gaacgactca tccggaacgg tggagaagc 29 <210> 14 <211> 39 <212> DNA <213> Artificial sequence <400> 14 ctatttcaac atatccaccg ggatacaaag aaaatgccg 39 <210> 15 <211> 34 <212> DNA <213> Artificial sequence <400> 15 ctccgtactc aatatagtat cttgtaaacg cggg 34 <210> 16 <211> 28 <212> DNA <213> Artificial sequence <400> 16 gctccaccgg gatacaaaga aaatgccg 28 <210> 17 <211> 45 <212> DNA <213> Artificial sequence <400> 17 tgttgaaatt tctccgtact caatatagta tcttgtaaac gcggg 45 <210> 18 <211> 35 <212> DNA <213> Artificial sequence <400> 18 gctgaaaatg ccggtatatt ctgccacaac aatgc 35 <210> 19 <211> 38 <212> DNA <213> Artificial sequence <400> 19 gtatcccggt ggatatgttg aaatttctcc gtactcaa 38 <210> 20 <211> 35 <212> DNA <213> Artificial sequence <400> 20 ctggaaaatg ccggtatatt ctgccacaac aatgc 35 <210> twenty one <211> 38 <212> DNA <213> Artificial sequence <400> twenty one gtatcccggt ggatatgttg aaatttctcc gtactcaa 38 <210> twenty two <211> 35 <212> DNA <213> Artificial sequence <400> twenty two ttcgaaaatg ccggtatatt ctgccacaac aatgc 35 <210> twenty three <211> 38 <212> DNA <213> Artificial sequence <400> twenty three gtatcccggt ggatatgttg aaatttctcc gtactcaa 38 <210> twenty four <211> 41 <212> DNA <213> Artificial sequence <400> twenty four ctaatgccgg tatattctgc cacaacaatg catggataat c 41 <210> 25 <211> 40 <212> DNA <213> Artificial sequence <400> 25 ctttgtatcc cggtggatat gttgaaattt ctccgtactc 40 <210> 26 <211> 38 <212> DNA <213> Artificial sequence <400> 26 attgccacaa caatgcatgg ataatctgtg ctgaaacg 38 <210> 27 <211> 50 <212> DNA <213> Artificial sequence <400> 27 atataccggc attttctttg tatcccggtg gatatgttga aatttctccg 50 <210> 28 <211> 42 <212> DNA <213> Artificial sequence <400> 28 gataagctta tgaagttcgg tttttttgat gatgcaaaca aa 42 <210> 29 <211> 42 <212> DNA <213> Artificial sequence <400> 29 caggaattct cccataatta cttcaacttt gtgagtcttt cc 42 <210> 30 <211> 40 <212> DNA <213> Artificial sequence <400> 30 gtcgttccag accataacaa gcaaagacgg aaaagtggca 40 <210> 31 <211> 42 <212> DNA <213> Artificial sequence <400> 31 tatccatgca ttggcgtggc agaatatacc ggcattttct tt 42 <210> 32 <211> 40 <212> DNA <213> Artificial sequence <400> 32 ctgggtatgg gttttagaga ttctaatcaa gacttgttgg 40 <210> 33 <211> 29 <212> DNA <213> Artificial sequence <400> 33 tccgataccg gattcaaagt atgaagcgc 29 <210> 34 <211> 39 <212> DNA <213> Artificial sequence <400> 34 gccggtatgg gttttagaga ttctaatcaa gacttgttg 39 <210> 35 <211> 32 <212> DNA <213> Artificial sequence <400> 35 accaatacca gactcaaagt aagaagcaga cc 32 <210> 36 <211> 32 <212> DNA <213> Artificial sequence <400> 36 ttcactacta cttctaaaga cggcaaggtc gc 32 <210> 37 <211> 31 <212> DNA <213> Artificial sequence <400> 37 aaaagactca tctggggacag tagagaagca g 31 <210> 38 <211> 39 <212> DNA <213> Artificial sequence <400> 38 ccatctctac ttatccacca ggttataaag agaatgctg 39 <210> 39 <211> 34 <212> DNA <213> Artificial sequence <400> 39 cgccgtactc aatgtaatat ctagtaaaag ctgg 34 <210> 40 <211> 34 <212> DNA <213> Artificial sequence <400> 40 gccgagaatg ctggtatttt ctgccacaat aacg 34 <210> 41 <211> 32 <212> DNA <213> Artificial sequence <400> 41 ataacctggt ggataagtag agatctcgcc gt 32 <210> 42 <211> 34 <212> DNA <213> Artificial sequence <400> 42 ctcgagaatg ctggtatttt ctgccacaat aacg 34 <210> 43 <211> 38 <212> DNA <213> Artificial sequence <400> 43 gtatcccggt ggatatgttg aaatttctcc gtactcaa 38 <210> 44 <211> 34 <212> DNA <213> Artificial sequence <400> 44 ccgcggggat cgactcataa aatagtaacc ttct 34 <210> 45 <211> 35 <212> DNA <213> Artificial sequence <400> 45 gccgcggaaa tttaggaatt ttaaacttgg gcttg 35 <210> 46 <211> twenty three <212> DNA <213> Artificial sequence <400> 46 aacgttacgg gcacttcgac gac 23 <210> 47 <211> 29 <212> DNA <213> Artificial sequence <400> 47 attctgcagc tagagggtca cgtcgacgc 29
Claims
1. The application of a cellobiose phosphorylase polypeptide or a mutant thereof in catalyzing the conversion of lactose to galactose-1-phosphate, wherein the cellobiose phosphorylase polypeptide or the mutant thereof is: (1) A cellobiose phosphorylase polypeptide with an amino acid sequence as shown in SEQ ID NO.1, or; (2) A cellobiose phosphorylase polypeptide mutant with a site-directed mutation of the amino acid sequence shown in SEQ ID NO.1, which catalyzes the conversion of lactose to galactose-1-phosphate; in, The mutation sites of the cellobiose phosphorylase polypeptide mutant are as follows: 1) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 355 from arginine to alanine; or 2) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 355 from arginine to leucine; or 3) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 499 from glutamine to phenylalanine; or 4) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 636 from glutamic acid to alanine; or 5) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 645 from lysine to alanine; or 6) The amino acid sequence shown in SEQ ID NO.1 undergoes a site-directed mutation at position 645, changing from lysine to leucine; or 7) The amino acid sequence shown in SEQ ID NO.1 is mutated at position 501 from threonine to isoleucine, and at position 654 from asparagine to alanine.
2. The application as described in claim 1, characterized in that, The cellobiose phosphorylase polypeptide or its mutant catalyzes the formation of galactose-1-phosphate from lactose by means of the following method: in a buffer system with a pH of 3 to 11, lactose is converted into galactose-1-phosphate by the catalysis of the cellobiose phosphorylase polypeptide or its mutant.
3. The application as described in claim 2, characterized in that, The buffer solution is either HEPES buffer or Tris-HCl buffer.
4. The application as described in claim 3, characterized in that, The buffer system contains KH2PO4, and the molar ratio of KH2PO4 to the buffer solute is (3-5):
5.
5. The application as described in claim 2, characterized in that, The pH of the buffer system is 6-9.
6. The application as described in claim 2, characterized in that, The pH of the buffer system is 8.
7. The application as described in claim 2, characterized in that, The cellobiose phosphorylase polypeptide or its mutants participate in the catalytic reaction in the form of a free enzyme or an immobilized enzyme.
8. The application as described in claim 7, characterized in that, The immobilized enzyme of the cellobiose phosphorylase polypeptide or its mutant is prepared according to the following method: Within a temperature range of 20-30℃, cellobiose phosphorylase polypeptide or its mutant is mixed with immobilized resin and stirred until homogeneous. After 12-24 hours, the mixture is separated, and the solid is washed with buffer to obtain immobilized enzyme.
9. The application as described in claim 8, characterized in that, The immobilization resin is amino 703 resin, amino 700 resin or epoxy 600 resin, and the buffer solution is Tris-HCl buffer solution.
10. The application as described in claim 2, characterized in that, The reaction temperature for the catalysis is 20℃~80℃.
11. The application as described in claim 2, characterized in that, The reaction temperature for the catalysis is 40℃~60℃.
12. The application as described in claim 1, characterized in that, The specific steps by which the cellobiose phosphorylase polypeptide or its mutant catalyzes the conversion of lactose to galactose-1-phosphate are as follows: (1) Construct a recombinant plasmid encoding cellobiose phosphorylase polypeptide or its mutant gene, and introduce the recombinant plasmid encoding cellobiose phosphorylase polypeptide or its mutant gene into the host bacteria to construct an engineered strain of cellobiose phosphorylase polypeptide or its mutant gene. (2) Inducing expression of cellobiose phosphorylase polypeptide or its mutant strain from step (1), and obtaining crude enzyme solution of cellobiose phosphorylase polypeptide or its mutant strain after cell disruption. (3) Using lactose as a substrate and the cellobiose phosphorylase polypeptide or its mutant crude enzyme solution from step (2) as a biocatalyst, galactose-1-phosphate is generated at 20℃ to 80℃ in a buffer system containing KH2PO4 with a pH of 3 to 11.
13. The application as described in claim 12, characterized in that, One or more of the following conditions must be met: i. The host bacteria mentioned in step (1) are Escherichia coli, Bacillus subtilis, Bacillus licheniformis, Kluyveromyces martensii, or Kluyveromyces lactis; ii. In step (1), when the host bacterium is Escherichia coli, the plasmid vector of the recombinant plasmid is pET28a; when the host bacterium is Bacillus subtilis or Bacillus licheniformis, the plasmid vector of the recombinant plasmid is pEB03; when the host bacterium is Kluyveromyces martensii or Kluyveromyces lactis, the plasmid vector of the recombinant plasmid is pklac1. iii. The culture medium used for induction expression in step (2) is LB medium or YPD medium. When the host bacteria are Escherichia coli, Bacillus subtilis or Bacillus licheniformis, the culture medium used is LB medium. When the host is Kluyveromyces martensii or Kluyveromyces lactis, the culture medium used is YPD medium. iv. The crude enzyme solution of the cellobiose phosphorylase polypeptide or its mutant described in step (3) can also be purified and used to catalyze the generation of galactose-1-phosphate.
Citation Information
Patent Citations
Application of galactokinase in synthesizing N-acetylgalactose-1-phosphoric acid and derivatives thereof
CN102127570A
Galactose-1-phosphate uridyl transferase mutant proteins and application thereof
CN108410834A
Novel lactose phosphorylase enzymes
US20110008849A1