Preparation method of novel inhalable anthrax component vaccine based on a mutant strain of bacillus anthracis
By constructing the anthrax mutant strain A16R-5.1, an anthrax vaccine was prepared from the supernatant of anthrax culture, which solved the problem that existing vaccines could not provide effective protection. It achieved both safety and immune protection, making it suitable for the prevention and treatment of anthrax.
Patent Information
- Application Number
- CN202310151539.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-10
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2043-02-10
AI Technical Summary
Existing anthrax vaccines do not provide effective protection against deadly pulmonary anthrax, and traditional vaccines carry the risk of infection and side effects. There is also a lack of commercially available lung vaccines for inhalable anthrax.
By knocking out several extracellular protease activity-related genes in the Bacillus anthracis A16R strain, a mutant strain A16R-5.1 was constructed, and vaccines extracted from the supernatant of Bacillus anthracis culture were prepared, including liquid and dry powder inhalers, for direct administration to the lungs.
The mutant strain A16R-5.1 exhibits reduced virulence and improved safety. It can stably express protective antigens, induce humoral and cellular immunity, and effectively resist anthrax infection and toxin killing, making it suitable for the prevention and treatment of anthrax.
Smart Images

Figure CN116121165B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of immunomedical technology, specifically relating to a method for preparing a novel inhalable anthrax component vaccine based on a mutant strain of Bacillus anthracis. Background Technology
[0002] Anthrax is the pathogen of anthrax, an acute and highly contagious infectious disease that can be transmitted between humans and animals. It exists in both vegetative and spore forms. Anthrax spores are highly resistant to drying and chemical disinfectants and are easy to prepare. Based on different routes of infection, human anthrax is clinically classified into cutaneous anthrax, gastrointestinal anthrax, inhalation anthrax, and injection anthrax. Inhalation anthrax is the most severe clinical type, with a near 100% mortality rate without treatment.
[0003] Currently, there are two approved human anthrax vaccines. One is a live attenuated anthrax vaccine, composed of non-toxic spores of the Russian STI-1 strain and the Chinese A16R strain, respectively. However, its application is limited due to the risk of infection and adverse reactions from injection. The other is a cell-free culture supernatant vaccine with protective antigens as the main component, including the American anthrax vaccine adsorbent (AVA) and the British anthrax vaccine precipitant (AVP). However, repeated subcutaneous injections throughout the year and annual booster vaccinations can cause local and even systemic side effects. Most importantly, apart from AVA, no studies have proven that the above three anthrax vaccines provide complete protection against fatal pulmonary anthrax. Furthermore, needle-free vaccination is gaining increasing popularity and attention. Nevertheless, there is still no commercially available pulmonary vaccine for inhaled anthrax; therefore, developing a vaccine for the prevention and treatment of inhaled anthrax is essential. Summary of the Invention
[0004] The purpose of this invention is to provide a method for preparing a novel inhalable anthrax component vaccine based on a mutant strain of Bacillus anthracis, which has good safety and immunoprotective effects against fatal pulmonary anthrax and can be used to prepare various types of vaccines, especially inhaled vaccines.
[0005] This invention provides anthrax bacillus ( Bacillus anthracis The mutant strains include strains obtained by knocking out several extracellular protease activity-related genes in Bacillus anthracis A16R.
[0006] Preferably, extracellular protease activity-related genes include at least one of the following: nprR , mmzp , inhA1 , tasA , GBAA_2860 and lef .
[0007] This invention provides a strain of Bacillus anthracis ( Bacillus anthracis The mutant strain A16R-5.1, whose preservation number is CGMCC NO.26476, is a mutant strain of A16R-5.1.
[0008] This invention also provides a method for constructing the above-mentioned mutant strain A16R-5.1, comprising the following steps: using Bacillus anthracis A16R as the base strain, sequentially knocking out the mutations in Bacillus anthracis A16R... nprR, mmzp, inhA1, tasA and GBAA_2860 The mutant strain A16R-5 was obtained.
[0009] Using mutant strain A16R-5 as the base strain, the gene encoding the lethal factor was knocked out. lef Genes were extracted to obtain mutant strain A16R-5.1.
[0010] Preferably, the knockout includes knocking out nprR The upstream homologous arm of the sequence shown in SEQ ID NO.1 from position 1 to 726, and the downstream homologous arm of the sequence shown in SEQ ID NO.2 from position 1 to 778;
[0011] Knockout mmzp The upstream homologous arm of the sequence shown in SEQ ID NO.3 from position 1 to 795, and the downstream homologous arm of the sequence shown in SEQ ID NO.4 from position 1 to 791;
[0012] Knockout inhA1 The upstream homologous arm of the sequence shown in SEQ ID NO.5 from position 1 to 781, and the downstream homologous arm of the sequence shown in SEQ ID NO.6 from position 1 to 760;
[0013] Knockout tasA The upstream homologous arm of the sequence shown in SEQ ID NO.7 from position 1 to 807, and the downstream homologous arm of the sequence shown in SEQ ID NO.8 from position 1 to 799;
[0014] Knockout GBAA_2860 The upstream homologous arm of the sequence shown in SEQ ID NO.9 from position 1 to 794, and the downstream homologous arm of the sequence shown in SEQ ID NO.10 from position 1 to 789;
[0015] Knockout lef The upstream homologous arm of the sequence shown in SEQ ID NO.11 from position 1 to 815, and the downstream homologous arm of the sequence shown in SEQ ID NO.12 from position 1 to 764.
[0016] The present invention also provides the use of the above-mentioned mutant strain or the above-mentioned mutant strain A16R-5.1 in the preparation of products for the prevention and / or treatment of diseases caused by Bacillus anthracis.
[0017] Preferred products for the prevention and / or treatment of diseases caused by Bacillus anthracis include vaccines extracted from Bacillus anthracis culture supernatants.
[0018] The present invention also provides a method for preparing an anthrax vaccine extracted from the culture supernatant, comprising the following steps: inoculating the above-mentioned mutant strain A16R-5.1 into RM medium for culture, collecting the supernatant of the culture, and concentrating it to obtain a concentrated supernatant sample.
[0019] The present invention also provides a vaccine extracted from the culture supernatant of anthrax bacteria prepared using the above preparation method.
[0020] Preferably, the dosage form of the vaccine extracted from the anthrax culture supernatant includes a liquid formulation or a dry powder inhaler.
[0021] Beneficial effects: This invention provides a mutant strain of Bacillus anthracis, obtained by knocking out several extracellular protease activity-related genes from the attenuated strain A16R of Bacillus anthracis as the base strain, and simultaneously provides a strain with sequentially knocked-out genes. nprR , mmzp , inhA1 , tasA , GBAA_2860 and lef The mutant strain A16R-5.1, as confirmed by examples, has significantly reduced virulence compared to the existing vaccine strain A16R. It has no antibiotic resistance markers, can stably express protective antigens, and can be used to prepare an anthrax vaccine extracted from culture supernatant with good safety and immunogenicity. It is suitable for direct administration to the lungs, can induce humoral, cellular, and mucosal immunity, can effectively resist the killing effect of anthrax toxins, and can resist the infection and progression of anthrax bacilli.
[0022] Biological Preservation Information
[0023] Anthrax bacillus ( Bacillus anthracis The strain, with the accession number A16R-5.1, was deposited on January 13, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC NO.26476. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1Figure showing the PCR identification results of a mutant of Bacillus anthracis with low protein hydrolysis activity;
[0026] Figure 2 The image shows the results of Western blot analysis of the supernatant cultured with mouse anti-PA polyclonal antibody against multiple anthrax bacillus low proteolytic activity mutants, with SDS-PAGE as a load control.
[0027] Figure 3 The image shows the results of Western blot analysis of the supernatant of A16R-5 and A16R-5.1 strains cultured with mouse anti-PA polyclonal antibody, with SDS-PAGE as a load control.
[0028] Figure 4 Figure showing the survival rates of mice immunized with A16R-5 and A16R-5.1 via intratracheal nebulization.
[0029] Figure 5 The results of Western blot analysis of the dry powder inhalation solution and the liquid inhalation solution of the anthrax culture supernatant using mouse anti-CSE polyclonal antibody were shown, with SDS-PAGE as a load control.
[0030] Figure 6 Figure 1 shows the immunogenicity results of ELISA analysis of the dry powder inhaler solution and the liquid inhaler solution of the anthrax culture supernatant extracted from the anthrax culture supernatant using mouse anti-CSE polyclonal antibody.
[0031] Figure 7 Scanning electron microscope image of vaccine dry powder extracted from anthrax culture supernatant;
[0032] Figure 8 To immunize against B10.D2- Hc 0 Figure showing the survival status of mice after viral challenge;
[0033] Figure 9 To immunize against B10.D2- Hc 0 Graph showing mouse serum IgG antibody titer results;
[0034] Figure 10 To immunize against B10.D2- Hc 0 Graph showing mouse serum IgG1 antibody titer results;
[0035] Figure 11 To immunize against B10.D2- Hc 0 Graph showing mouse serum IgG2a antibody titer results;
[0036] Figure 12 To immunize against B10.D2- Hc 0 Graph showing the results of mouse serum IgG2a / IgG1 antibody titers;
[0037] Figure 13 To immunize against B10.D2- Hc 0 Figure showing the IgG antibody titer results in mouse lung homogenate;
[0038] Figure 14 To immunize against B10.D2- Hc 0 Figure showing the IgA antibody titer results in mouse lung homogenate. Detailed Implementation
[0039] This invention provides anthrax bacillus ( Bacillus anthracis The mutant strains include strains obtained by knocking out several extracellular protease activity-related genes in Bacillus anthracis A16R.
[0040] The extracellular protease activity-related genes described in this invention preferably include at least one of the following: nprR , mmzp , inhA1 , tasA , GBAA_2860 and lef The present invention does not specifically limit the method for knocking out genes related to extracellular protease activity, but preferably includes gene knockout using a CRISPR / Cas9 system.
[0041] This invention provides a strain of Bacillus anthracis ( Bacillus anthracis The mutant strain A16R-5.1, whose preservation number is CGMCC NO.26476, is a mutant strain of A16R-5.1.
[0042] The mutant strain A16R-5.1 of this invention is based on Bacillus anthracis A16R, with sequential knockouts... nprR , mmzp , inhA1 , tasA and GBAA_2860 After the gene, the gene encoding the lethal factor was knocked out. lef Genes were extracted to obtain the mutant strain A16R-5.1.
[0043] This invention also provides a method for constructing the above-mentioned mutant strain A16R-5.1, comprising the following steps: using Bacillus anthracis A16R as the base strain, sequentially knocking out the mutations in Bacillus anthracis A16R... nprR, mmzp, inhA1, tasA and GBAA_2860 The mutant strain A16R-5 was obtained.
[0044] Using mutant strain A16R-5 as the base strain, the gene encoding the lethal factor was knocked out. lef Genes were extracted to obtain mutant strain A16R-5.1.
[0045] In this invention, based on Bacillus anthracis A16R, the following are sequentially knocked out nprR , mmzp , inhA1 , tasA , GBAA_ 2860 Gene, that is, knockout based on A16R. nprR The resulting mutant strain was named A16R-1; the mutant strain was then knocked out based on A16R-1. mmzp A16R-2 was obtained; then, A16R-2 was knocked out. inhA1 A16R-3 was obtained; then A16R-3 was knocked out. tasA A16R-4 was obtained; then A16R-4 was knocked out. GBAA_2860 A16R-5 was obtained; considering the safety of the strain, the gene encoding the lethal factor was knocked out from A16R-5. lef The gene was obtained as A16R-5.1. The knockout described in this invention preferably includes: knockout... nprR The upstream homologous arm of the sequence shown in SEQ ID NO.1 from position 1 to 726, and the downstream homologous arm of the sequence shown in SEQ ID NO.2 from position 1 to 778;
[0046] Knockout mmzp The upstream homologous arm of the sequence shown in SEQ ID NO.3 from position 1 to 795, and the downstream homologous arm of the sequence shown in SEQ ID NO.4 from position 1 to 791;
[0047] Knockout inhA1 The upstream homologous arm of the sequence shown in SEQ ID NO.5 from position 1 to 781, and the downstream homologous arm of the sequence shown in SEQ ID NO.6 from position 1 to 760;
[0048] Knockout tasA The upstream homologous arm of the sequence shown in SEQ ID NO.7 from position 1 to 807, and the downstream homologous arm of the sequence shown in SEQ ID NO.8 from position 1 to 799;
[0049] Knockout GBAA_2860 The upstream homologous arm of the sequence shown in SEQ ID NO.9 from position 1 to 794, and the downstream homologous arm of the sequence shown in SEQ ID NO.10 from position 1 to 789;
[0050] Knockout lefThe upstream homologous arm of the sequence shown in SEQ ID NO.11 from position 1 to 815, and the downstream homologous arm of the sequence shown in SEQ ID NO.12 from position 1 to 764;
[0051] This invention preferably utilizes the CRISPR / Cas9 system for gene knockout, and the gene knockout method is the same at each stage. The knockout of extracellular protease activity-related genes in Bacillus anthracis A16R preferably includes the following steps:
[0052] Using anthrax A16R genomic DNA as a template, a vector was constructed, and the fragment was inserted into the SalI and XbaI sites of pJOE8999. The plasmid was digested with BsaI, and the large fragment was ligated to a small double-stranded DNA. This was transformed into competent DH5α cells, cultured overnight, and the plasmid was extracted and sequenced to confirm its correctness. The upstream and downstream homologous arms of a protease-encoding gene were ligated to a plasmid containing gRNA, transformed into competent DH5α cells, and cultured overnight. The recombinant plasmid was digested and identified, transformed into E. coli SCS110, and sequenced. The plasmid was then introduced into B. anthrax A16R via electroporation to obtain intermediate strain A. Intermediate strain A was screened for transformants on BHIG medium containing kanamycin (25 μg / ml) at 30°C. Single colonies were inoculated into liquid medium supplemented with 25 μg / ml kanamycin and cultured at 37°C with shaking for 3 h. Then, mannose was added to a final concentration of 0.4% to induce Cas9 protein expression. After culturing for another 3 hours, the culture was serially diluted and inoculated onto LB agar containing 25 μg / ml kanamycin and 0.4% mannose, and incubated overnight at 37°C. Intermediate strain A was subcultured to remove plasmid pJOE8999, yielding recombinant strain A with the specific protease-encoding gene knocked out. Following the same method, the next specific protease-encoding gene was knocked out sequentially in recombinant strain A to obtain recombinant strain B. This process was repeated until the mutant strain A16R-5.1 was obtained.
[0053] The present invention also provides the use of the above-mentioned mutant strain or the above-mentioned mutant strain A16R-5.1 in the preparation of products for the prevention and / or treatment of diseases caused by Bacillus anthracis.
[0054] The product for the prevention and / or treatment of diseases caused by Bacillus anthracis, as described in this invention, preferably comprises a vaccine extracted from the supernatant of Bacillus anthracis culture. The A16R-5.1 strain described in this invention has significantly lower virulence than the existing vaccine strain A16R, lacks antibiotic resistance markers, and can stably express protective antigens. The low protease deletion mutant strain constructed in this invention lays the foundation for the research of novel anthrax vaccines.
[0055] The present invention also provides a method for preparing an anthrax vaccine extracted from the culture supernatant, comprising the following steps: inoculating the above-mentioned mutant strain A16R-5.1 into RM medium for culture, collecting the supernatant of the culture, and concentrating it to obtain a concentrated supernatant sample.
[0056] The pre-cultivation process of this invention preferably includes four steps: strain activation, pre-cultivation, plate transfer, and formal cultivation of A16R-5.1. The strain activation preferably includes: resuscitating the A16R-5.1 glycerol strain using the LB solid medium streak plate method and incubating overnight at 37°C. The pre-cultivation preferably includes picking a single colony from the LB solid medium of A16R-5.1 and inoculating it into 5 mL of BHI liquid medium, then incubating at 37°C on a shaker for 9 hours (mid-log phase) at 220 rpm. The plate transfer after the pre-cultivation specifically includes spotting 10 μL of the pre-cultivated bacterial solution onto LB solid medium containing 1% skim milk powder and incubating overnight at 37°C. The present invention involves formally culturing the bacteria after transfer from the drop plate, specifically including scraping all colonies of strain A16R-5.1 from the drop plate and transferring them to a centrifuge tube containing 20 mL of RM medium, shaking to mix, and then taking 50 μL of the bacterial suspension for 10-fold dilution and measuring OD. 600 Value, OD 600When the concentration of 0.45 was 0.5 mL, the inoculum was fixed at 0.5 mL and transferred to a conical flask containing 500 mL of RM medium. The flask was then incubated at 37 °C on a shaker for 12 h at a speed of 110 rpm. The RM culture medium of the present invention preferably contains the following solutes in 100% by mass: glucose 5 g / L, KH2PO4 0.46 g / L, NaHCO3 8 g / L, NaCl 2.92 g / L, Tris 9.06 g / L, KCl 3.7 g / L, L-tryptophan 35 mg / L, L-glycine 65 mg / L, L-cysteine 25 mg / L, L-tyrosine 144 mg / L, L-valine 173 mg / L, L-leucine 230 mg / L, L-isoleucine 170 mg / L, L-threonine 120 mg / L, L-methionine 73 mg / L, L-aspartic acid 184 mg / L, L-sodium glutamate 612 mg / L, L-proline 43 mg / L, L-serine 235 mg / L. The RM culture medium contains the following components: L-phenylalanine 125 mg / L, L-lysine 230 mg / L, L-histidine hydrochloride 55 mg / L, L-arginine hydrochloride 125 mg / L, CaCl2·2H2O 7.4 mg / L, MgSO4·H2O 9.9 mg / L, MnSO4·H2O 0.9 mg / L, uracil 1.4 mg / L, adenine sulfate 2.1 mg / L, and thiamine-hydrochloride 1.0 mg / L. The solvent for the RM culture medium described in this invention is preferably ultrapure water.
[0057] In this invention, after the formal culturing, the supernatant of all cultures containing bacterial cells is collected, centrifuged, and then filtered for sterilization to obtain anthrax culture supernatant free of bacterial cells and debris. The centrifugation in this invention preferably involves transferring all A16R-5.1 bacterial culture to a 500mL centrifuge bottle, centrifuging to collect the supernatant at 8000 rpm for 15 minutes. The filtration for sterilization in this invention preferably involves using a vacuum pump and a filtration device to filter the supernatant for sterilization, removing residual bacterial cells and debris, and then storing it at 4°C. In this invention, the entire process of collecting and sterilizing the A16R-5.1 supernatant requires an ice bath to prevent protein degradation.
[0058] This invention involves concentrating the collected and sterilized supernatant. The entire concentration process requires an ice bath to prevent protein degradation. Preferably, the concentration includes:
[0059] (1) Membrane pack assembly and cleaning: Assemble the membrane pack, put 500 mL of deionized water into the sample bottle, turn on the constant flow pump to pump the liquid through the system at a speed of 200~400 mL / min to remove any air bags, and check for leaks at the pipe connection points;
[0060] (2) After completing step (1), place the supernatant sample in an ice bath and use a constant flow pump to pump the sample to the VIVAFLOW200 tangential flow ultrafiltration membrane pack for ultrafiltration concentration. The membrane pack has a flow rate of Mr 10,000. The filtered supernatant is placed in a sample bottle. The sample outlet tube is fixedly connected to the lower outlet of the membrane pack side wall by the constant flow pump. The flow rate is adjusted to 290 rpm. One end of the upper outlet is connected to a pressure gauge, and the other end is connected to the sample inlet tube. The upper wall of the membrane pack is connected to the filtrate. Turn on the constant flow pump switch and start running. After concentration at 4 ℃, the concentrated supernatant is obtained.
[0061] (3) After completing step (2), concentrate the supernatant to about 20 mL and add 500 mL of 4℃ physiological saline in the sample bottle for ultrafiltration again to remove excess culture medium components in the concentrated supernatant.
[0062] (4) After completing step (3), when the supernatant is concentrated to about 30 mL, transfer it to a 10KD ultrafiltration centrifuge tube, rotate at 6500 rpm, and take 10 min.
[0063] (5) After completing step (4), mix the concentrated samples of the same strain and store them in a -80℃ refrigerator for later use.
[0064] In this invention, the anthrax culture supernatant vaccine is preferably prepared by mixing samples prepared through multiple batches, with different batches of concentrated samples undergoing unified quality control, and the most stable protective antigen content selected.
[0065] The present invention also provides a vaccine extracted from the culture supernatant of anthrax bacteria prepared using the above preparation method.
[0066] The dosage form of the anthrax vaccine extracted from the culture supernatant of the present invention includes a liquid formulation or a dry powder inhaler, wherein the liquid formulation vaccine is a lung-delivered vaccine; the anthrax vaccine dry powder inhaler prepared by spray freeze-drying technology from the liquid formulation of the anthrax culture supernatant vaccine is a lung-delivered vaccine.
[0067] To further illustrate the present invention, the preparation method of the novel inhalable anthrax component vaccine based on a mutant strain of Bacillus anthracis provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0068] Unless otherwise specified, the experimental methods used in the embodiments of this invention are conventional methods. Unless otherwise specified, the experimental materials used in the embodiments of this invention were all purchased from conventional biochemical reagent stores. All quantitative experiments in the following embodiments were performed in triplicate, and the results were averaged.
[0069] Anthrax rPA protein: List Biological Laboratories Inc., catalog number: 171E.
[0070] Anthrax lethal toxin LF: List Biological Laboratories Inc., catalog number: 169L.
[0071] CpG, short for Class B CpG oligonucleotide, is an immunostimulant targeting human or mouse TLR9, and is a typical mucosal adjuvant. The CpG used in this example is Invivogen's product catalog number tlr1-2006-5, accessible at: https: / / www.invivogen.com / odn2006.
[0072] Anthrax Pasteur II strain: References: Liang X, Zhang H, Zhang E, et al. Identification of the pXO1 plasmid in attenuated Bacillus anthracis vaccines trains [J]. Virulence, 2016,7:578 - 586. Mikesell P, Ivins BE, Ristroph JD, Dreier TM. Evidence for Plasmid-Mediated Toxin Production in BacillusAnthracis. Infect Immun (1983) 39(1):371–6. The public can obtain it from the Academy of Military Medical Sciences of the Chinese People's Liberation Army.
[0073] Tangential flow membrane package: Vivaflow 200, Sartorius, Germany.
[0074] Example 1
[0075] I. Construction and Characterization of Anthrax Low-Protein Mutant Strains
[0076] Table 1. Plasmids used in the construction of mutant strains in this invention.
[0077]
[0078] Multiple extracellular protease activity-related genes in Bacillus anthracis A16R, including nprR , mmzp , inhA1 , tasA , GBAA_2860 and lef Using the CRISPR (Cas) 9 system, the gene editing plasmid was successively deleted and constructed and introduced from Bacillus anthracis A16R via electroporation.
[0079] 1) Obtain the sequence information of relevant genes from the Genbank genome sequence, including the coding region and upstream and downstream regions of about 1kb.
[0080] 2) Design the target sequence of sgRNA using an online tool (https: / / sg.idtdna.com / site / order / designtool / index / CRISPR_CUSTOM) and synthesize the related ssDNA and anneal it to form a double strand.
[0081] nprR-F (SEQ ID NO.13):tacgACACAAGAAGAATTATGTCA
[0082] nprR-R (SEQ ID NO.14): aaacTGACATAATTCTTCTTGTGT
[0083] inhA1-F (SEQ ID NO.15):tacgAAGTTAACACGAATCATACC
[0084] inhA1-R (SEQ ID NO. 16): aaacGGTATGATTCGTGTTAACTT
[0085] tasA-F (SEQ ID NO. 17): tacgTCTTTTTCAACTGTATCACC
[0086] tasA-R (SEQ ID NO.18): aaacGGTGATACAGTTGAAAAAAGA
[0087] mmzp-F (SEQ ID NO.19): tacgATAGGAATAGGTCACAACAG
[0088] mmzp-R (SEQ ID NO.20):aaacCTGTTGTGACCTATTCCTAT
[0089] GBAA_2860-F (SEQ ID NO.21):tacgCAAGTTGAAGGTATGTCTTG
[0090] GBAA_2860-R (SEQ ID NO.22):aaacCAAGACATACCTTCAACTTG
[0091] lef-F (SEQ ID NO.23):tacgATTGTACAAGGTACTTCCAA
[0092] lef-R (SEQ ID NO.24): aaacTTGGAAGTACCTTGTACAAT
[0093] 3) Using anthrax A16R genomic DNA as a template, a vector was constructed, and the fragment was inserted into the corresponding SalI and XbaI sites of pJOE8999. The plasmid was digested with BsaI, and the large fragment of the digested plasmid was ligated with the small double-stranded DNA. The mixture was transformed into competent DH5α cells, cultured overnight, and the plasmid was extracted, sequenced, and identified to obtain the correct plasmid.
[0094] 4) Ligate the upstream and downstream homologous arm fragments of a protease-encoding gene to a plasmid containing gRNA, transform into competent DH5α cells, and culture overnight.
[0095] 5) The recombinant plasmid was identified by enzyme digestion, transformed into E. coli SCS110, and simultaneously sequenced. After identification, it was introduced into Bacillus anthracis A16R via electroporation to obtain intermediate strain A.
[0096] 6) Transformants from intermediate strain A were screened at 30°C on BHIG medium containing kanamycin (25 μg / mL). Single colonies were inoculated into liquid medium supplemented with 25 μg / mL kanamycin and cultured on a shaker at 37°C for 3 h. Then, 0.4% mannose was added to induce Cas9 protein expression. After culturing for another 3 h, the culture was serially diluted and inoculated onto LB agar containing 25 μg / mL kanamycin and 0.4% mannose, and incubated overnight at 37°C.
[0097] 7) The intermediate strain A was passaged to lose plasmid pJOE8999, resulting in recombinant strain A with the specific protease-encoding gene knocked out.
[0098] Following the method described above, the next specific protease-encoding gene was sequentially knocked out in recombinant strain A to obtain recombinant strain B. This process was repeated until seven anthrax mutant strains with low protease activity were obtained.
[0099] Genome editing was induced using 0.4% mannose according to standard protocols. Mutation sites were identified by PCR analysis using gene-specific primers, and the edited plasmid-free mutant strains were used as the initial strains for the next round of genome editing.
[0100] In the above steps, the primers used to identify the mutants were synthesized by Tianyi Huiyuan Company and purified by desalting.
[0101] The primers for identifying the mutants are as follows:
[0102] nprR-F (SEQ ID NO. 25): CAGCGCGTGTGCCCCAAAGGG
[0103] nprR-R (SEQ ID NO.26): TTGACCAACAATATCAGGTTTACTG
[0104] inhA1-F (SEQ ID NO. 27):TTTGGAGACACCAGAGTTCATTG
[0105] inhA1-R (SEQ ID NO. 28): GTTCTAACGTAAGCGGCGTCAGCTG
[0106] tasA-F (SEQ ID NO.29):TAGTGCTACGCCGAAATACAAAAG
[0107] tasA-R (SEQ ID NO.30):GCAAGACACGAAAAGAAGGTGAGTG
[0108] mmzp-F (SEQ ID NO.31):TTATCTTTGATGGTTGAATCTATG
[0109] mmzp-R (SEQ ID NO.32): AGTGGGGTAGGTTAAGTTGATTTTG
[0110] GBAA_2860-F (SEQ ID NO.33):GTTCCGAAGAACCGATAGATTGAATG
[0111] GBAA_2860-R (SEQ ID NO.34): GGTAACTGTTGAAGGAACTTCAGTAG
[0112] lef-F (SEQ ID NO.35): GAAATGGTCAGCACCGCCAGAAG
[0113] lef-R (SEQ ID NO.36): TGTGTCTAATGTAGCAGATACATCTAG
[0114] PCR amplification results as follows Figure 1 As shown, the number of base pairs between each mutant strain and the previous mutant strain is consistent with the size of the knocked-out target gene fragment, indicating that the target gene has been successfully knocked out. The culture supernatant of each mutant strain was analyzed by SDS-PAGE and Western Blot using an anti-PA monoclonal antibody. The SDS-PAGE and Western Blot results of the mutant strain culture supernatant are shown below. Figure 2 As shown, starting with the A16R-3 mutant strain, which had three protease activity-related genes knocked out, the expression level of PA (approximately 83 kDa) gradually increased. Among them, the A16R-5 mutant strain had the highest PA expression level. Mice were immunized with the culture supernatant of A16R-5 using a handheld liquid aerosol lung delivery device, and the survival of the mice was observed.
[0115] The survival rate of mice immunized with A16R-5 culture supernatant is as follows: Figure 3 As shown, mice with different doses of the drug died after immunization, indicating that the A16R-5 strain has poor safety and is not suitable as a vaccine strain.
[0116] Considering the safety of the strain, the same method was used to knock out strain A16R-5. lef Genes were extracted to obtain strain A16R-5.1 (referred to as A16R-5Δlef). The culture supernatants of strains A16R-5 and A16R-5.1 were analyzed by SDS-PAGE and Western Blot using an anti-PA monoclonal antibody. The SDS-PAGE and Western Blot results of the culture supernatants of strains A16R-5 and A16R-5.1 are shown below. Figure 3 As shown, the PA expression level of A16R-5.1 was similar to that of A16R-5. Mice were immunized with the culture supernatant of A16R-5.1 using a handheld liquid aerosol lung delivery device, and the survival of the mice was observed. The survival of mice immunized with the culture supernatant of A16R-5.1 is shown in the figure. Figure 4 As shown, mice treated with different doses did not die after immunization, indicating that strain A16R-5.1 has good safety and is suitable as a vaccine strain.
[0117] II. Anthrax low-protease mutant strains and culture conditions
[0118] Genome editing plasmids were prepared using E. coli Top 10 cells and SCS110. Kanamycin was added to the culture medium at an appropriate final concentration (50 µg / mL for E. coli and 30 µg / mL for Bacillus anthracis).
[0119] All anthrax bacillus low protease mutant strains were prepared according to the above method and stored at -80°C in LB medium containing 30% glycerol.
[0120] 1. Strain activation: The A16R-5.1 glycerol strain was revived using the LB solid medium streak plate method and incubated overnight at 37°C.
[0121] 2. Pre-culture: Pick a single colony from LB solid medium of A16R-5.1 and inoculate it into BHI liquid medium containing 5 mL. Incubate at 37℃ in a shaker for 9 h (mid-log phase) at 220 rpm.
[0122] 3. Plate transfer: Take 10 μL of pre-cultured bacterial solution and inoculate it onto LB solid medium containing 1% skim milk powder, and incubate overnight at 37°C.
[0123] 4. Formal culture: Scrape all colonies of strain A16R-5.1 from the drop plate and transfer them to a centrifuge tube containing 20 ml of RM medium. Shake to mix well. Take 50 μL of the bacterial culture, dilute it 10 times, and measure the OD. 600 Value, OD 600 When the concentration of 0.45 was 0.5 mL, the inoculum was fixed at 0.5 mL and transferred to a conical flask containing 500 mL of RM medium. The flask was then incubated at 37 °C on a shaker for 12 h at a speed of 110 rpm.
[0124] Example 2: Preparation and evaluation of vaccine extracted from anthrax culture supernatant
[0125] I. Preparation of anthrax culture supernatant vaccine liquid inhalation formulation
[0126] 1. Prepare A16R-5.1 culture supernatant according to the method in Example 1.
[0127] 2. Centrifuge the supernatant of the anthrax low protease activity mutant strain A16R-5.1 from step 1: Transfer all the bacterial culture of A16R-5.1 to a 500mL centrifuge bottle, centrifuge and collect the supernatant at 8000 rpm for 15 min;
[0128] 3. Filtration and sterilization: The supernatant is filtered and sterilized using a vacuum pump and a filtration device to remove residual bacteria and debris, and then stored in a refrigerator at 4°C.
[0129] 4. The concentration of the supernatant from A16R-5.1 can be carried out according to the following procedure:
[0130] (a1) Membrane pack assembly and cleaning: Assemble the membrane pack, put 500 mL of deionized water into the sample bottle, turn on the constant flow pump to pump the liquid through the system at a speed of 200-400 mL / min to remove any air pockets, and check for leaks at the pipe connection points;
[0131] (a2) After completing step (a1), place the supernatant sample in an ice bath and use a constant flow pump to pump the sample to a VIVAFLOW200 tangential flow ultrafiltration membrane for ultrafiltration concentration. The membrane membrane has a flow cutoff of Mr 10,000. The filtered supernatant is placed in a sample bottle. The sample outlet tube is fixedly connected to the lower outlet of the membrane membrane side wall by the constant flow pump. The flow rate is adjusted to 290 rpm. One end of the upper outlet is connected to a pressure gauge, and the other end is connected to the sample inlet tube. The upper wall tubing of the membrane membrane is connected to the filtrate. Turn on the constant flow pump switch and start running. After concentration at 4 ℃, the concentrated supernatant is obtained.
[0132] (a3) After completing step (a2), concentrate the supernatant to about 20 mL, add 500 mL of physiological saline at 4℃ into the sample bottle and ultrafilter again to remove excess culture medium components from the concentrated supernatant.
[0133] (a4) After completing step (a3), when the supernatant is concentrated to about 30 mL, transfer it to a 10 KD ultrafiltration centrifuge tube, rotate at 6500 rpm, and take 10 min.
[0134] (a5) After completing step (a4), mix the concentrated samples of the same strain and store them in a -80℃ refrigerator for later use.
[0135] The concentration process of the supernatant must be carried out in an ice bath to prevent protein degradation, so as to obtain anthrax culture supernatant extract vaccine, hereinafter referred to as anthrax CSE (culture supernatant extract) vaccine.
[0136] The anthrax CSE vaccine is a liquid inhaler.
[0137] II. Preparation of anthrax culture supernatant vaccine dry powder inhaler
[0138] The dry powder inhaler was prepared according to the original excipient formulation and process in the laboratory.
[0139] 1. Before spraying, incubate the sample at 4°C for 2 hours on an ice bath. Add the anthrax CSE vaccine liquid inhalant to the spray-dried solution, which contains the following solutes by mass percentage: D-mannitol 1%, inositol 1%, L-leucine 0.5%, and poloxamer 188 0.05%, as well as CSE vaccine 0.1% and CpG 0.1% as a mucosal adjuvant.
[0140] 2. Adjust the pH to 7.2 using NaOH solution. Place the solution in ice for at least 2 hours. Then, inject the solution into a container containing liquid nitrogen using a syringe connected to a two-fluid pneumatic nozzle (TSE, 2 mm diameter) at a constant pressure of 1.5 bar and a feed rate of 5 mL / min. Collect the droplets in a stainless steel container filled with liquid nitrogen at a depth of 10 cm below the nozzle. The atomized droplets rapidly freeze into ice crystals under the liquid nitrogen. Transfer the ice crystals and a small amount of residual liquid nitrogen to a stainless steel cup and freeze-dry in a vacuum freeze-drying system for 48 hours. Remove the dried powder and store it at 4°C.
[0141] 3. Store the obtained dry powder in a sealed container at 20°C.
[0142] III. Evaluation of Vaccine Extracted from Anthrax Culture Supernatant
[0143] 1. Bioactivity detection
[0144] The anthrax CSE vaccine liquid inhaler and dry powder inhaler prepared in the previous step were used to detect the target protein in the vaccine by SDS-PAGE and Western Blot.
[0145] The results are as follows Figure 5 As shown, after the dry powder was reconstituted in PBS, SDS-PAGE and Western Blot were performed. The results showed that the protein content of the anthrax CSE vaccine liquid inhaler was consistent before and after being made into dry powder, and the protein components of the anthrax CSE vaccine were not degraded.
[0146] 2. The ELISA method was used, following the instructions of the ELISA auxiliary kit (catalog number: 1030011) from Shenzhen Dakowei Biotechnology Co., Ltd. Anthrax CSE vaccine (liquid) and anthrax CSE vaccine dry powder reconstituted solution (PBS solution) were used for coating, and antibody titers were measured to verify the dry powder titer. Anthrax CSE vaccine liquid inhalation formulation was used as a positive control.
[0147] The results are as follows Figure 6 As shown, the immunogenicity of the anthrax CSE vaccine is almost unaffected after it is made into dry powder.
[0148] 3. Observe the morphology of dry powder particles.
[0149] The dry powder particles were observed using a scanning electron microscope, with multiple fields of view taken to observe the particle morphology.
[0150] The results are as follows Figure 7 As shown (left is a 2500× scanning electron microscope image, right is a 110× scanning electron microscope image). The anthrax CSE vaccine dry powder inhaler particles are relatively uniform in size and approximately spherical.
[0151] Example 3: Evaluation of the immunogenicity and immunoprotective effect of vaccine extracted from anthrax culture supernatant.
[0152] I. Animal Immunization Experiments
[0153] Laboratory animals: B10.D2- Hc 0 H2 d H2 - T18 c / oSnJ (Abbreviated as B10.D2-) Hc 0 Mice, 6-8 weeks old, Cyagen Laboratory Animal Co., Ltd.
[0154] The experimental animals were divided into six groups (50 animals in each group) as follows:
[0155] Anthrax CSE vaccine liquid inhalation group: Mice were inoculated using a handheld liquid aerosol lung delivery device, with 20 µg of liquid inhalation agent per mouse. The liquid was completely delivered into the lungs of the mice, and there were no non-specific deaths. Inoculations were administered at week 0 (first immunization), week 3 (second immunization), and week 6 (third immunization).
[0156] Anthrax CSE vaccine dry powder inhalation group: Mice were inoculated using a handheld dry powder aerosol lung delivery device. 0.5 mg of anthrax culture supernatant was extracted per mouse as the vaccine dry powder inhaler, with a 0.3 mL bolus (using a 1 mL syringe), administered twice consecutively. The dry powder was completely delivered into the lungs of the mice, and no nonspecific mortality occurred. The trials were conducted at week 0 (first immunization), week 3 (second immunization), and week 6 (third immunization).
[0157] Anthrax CSE vaccine dry powder inhaler PBS resuspension group: 50µL / animal (prepared by dissolving 0.5mg anthrax CSE vaccine dry powder in 50µL PBS) was delivered using a handheld liquid aerosol lung delivery device. Administration was performed at week 0 (first immunization), week 3 (second immunization), and week 6 (third immunization).
[0158] Subcutaneous injection of PBS resuspension of anthrax CSE vaccine dry powder inhaler: Mice were subcutaneously inoculated using a 1 mL syringe, 20 µg / mouse (prepared by dissolving 0.5 mg of anthrax CSE vaccine dry powder in 100 μL PBS). Injections were administered at week 0 (first immunization), week 3 (second immunization), and week 6 (third immunization).
[0159] Anthrax CSE vaccine liquid subcutaneous injection group: Mice were subcutaneously inoculated with 20 µg of anthrax CSE vaccine liquid inhalation agent per mouse using a 1 mL syringe. Inoculations were administered at week 0 (first immunization), week 3 (second immunization), and week 6 (third immunization).
[0160] Anthrax CSE vaccine liquid with aluminum adjuvant subcutaneous injection group: Mice were subcutaneously injected with 20 µg of anthrax CSE vaccine liquid inhalant per mouse using a 1 mL syringe. Inoculations were administered at week 0 (first immunization), week 3 (second immunization), and week 6 (third immunization).
[0161] II. Animal challenge experiments
[0162] Week 9, anthrax B. anthracis Pasteur II strain was suspended in a 0.05% (w / w) aqueous solution of poloxamer and delivered via tracheal insertion into the lungs via liquid aerosol, live challenge dose B10.D2- Hc 0 Mice were 5 × 10 5 CFU / animal (approximately 200 × LD via lung delivery) 50 ).
[0163] The experiment was terminated in the 11th week after the virus challenge and the observation record was kept for 14 days.
[0164] 1. Mouse survival curve
[0165] After the challenge, 10 mice were randomly selected from each group. The mortality of the mice was recorded at time points of 0, 0.5 days, 1 day, 1.5 days, 2 days, 2.5 days, 3 days, 4 days, 5 days, 6 days...14 days after the challenge, and the survival curve of the mice was plotted.
[0166] The results are as follows Figure 8 As shown, mice immunized with both the reconstituted dry powder inhaler and the liquid inhaler via lung delivery of anthrax CSE vaccine had significantly higher survival rates than those immunized via lung delivery, subcutaneous immunization, and all CpG control groups. This indicates that the reconstituted dry powder inhaler, delivered via lung delivery, provides the same protective effect as the liquid inhaler in immunizing mice, effectively resisting anthrax infection.
[0167] 2. Antibody titer detection
[0168] Four surviving mice were taken from each group in week 0 (2 days before the first immunization), week 3 (2 days before the second immunization), week 6 (2 days before the third immunization), and week 9 (2 days before challenge). The titers of specific antibodies (IgG: Abcan, catalog number: ab6789; IgG1: Abcan, catalog number: ab97240; IgG2a: Abcan, catalog number: ab97245; IgA: Abcan, catalog number: ab97235) in serum and lung homogenate were detected.
[0169] Immune B10.D2- Hc 0 Mouse serum IgG antibody titer as follows Figure 9As shown. Immune B10.D2- Hc 0 Mouse serum IgG1 antibody titer as follows Figure 10 As shown. Immune B10.D2- Hc 0 Mouse serum IgG2a antibody titer as follows Figure 11 As shown. Immune B10.D2- Hc 0 Mouse serum IgG2a / IgG1 antibody titers as follows Figure 12 As shown. Immune B10.D2- Hc 0 Mouse lung homogenate IgG antibody titer as follows Figure 13 As shown. Immune B10.D2- Hc 0 Mouse lung homogenate IgG antibody titer as follows Figure 14 As shown. The results indicated that at 63 dppi, the serum specific IgG level in mice immunized with CSE vaccine via lung delivery was significantly higher than that in mice immunized with aluminum adjuvant subcutaneous injection. Figure 9 There was no significant difference in serum-specific IgG1 levels among the immunization groups immunized with different vaccine formulations. Figure 10 Serum-specific IgG2a levels were significantly higher in all CpG adjuvant immunization groups than in the subcutaneous injection immunization groups treated with aluminum adjuvant, and the trend was similar to that of the IgG2a / IgG1 ratio, indicating a Th1 / Th2 response balance. Figure 11 and Figure 12 The three vaccine formulations did not differ significantly in inducing humoral immune responses; the CpG adjuvant was able to generate a mixed Th1 / Th2 immune response, while the aluminum adjuvant primarily induced a Th2 immune response.
[0170] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A strain of anthrax bacillus ( Bacillus anthracis The mutant strain A16R-5.1 is characterized by, The mutant strain A16R-5.1 has the accession number CGMCC NO.26476.
2. The method for constructing the mutant strain A16R-5.1 according to claim 1, characterized in that, Includes the following steps: Using Bacillus anthracis A16R as the base strain, the following were sequentially knocked out: nprR, mmzp, inhA1, tasA and GBAA_2860 The mutant strain A16R-5 was obtained. Using mutant strain A16R-5 as the base strain, the gene encoding the lethal factor was knocked out. lef Genes were extracted to obtain mutant strain A16R-5.
1.
3. The construction method according to claim 2, characterized in that, The knockout includes knocking out nprR The upstream homologous arm of the sequence shown in SEQ ID NO.1 from position 1 to 726, and the downstream homologous arm of the sequence shown in SEQ ID NO.2 from position 1 to 778; Knockout mmzp The upstream homologous arm of the sequence shown in SEQ ID NO.3 from position 1 to 795, and the downstream homologous arm of the sequence shown in SEQ ID NO.4 from position 1 to 791; Knockout inhA1 The upstream homologous arm of the sequence shown in SEQ ID NO.5 from position 1 to 781, and the downstream homologous arm of the sequence shown in SEQ ID NO.6 from position 1 to 760; Knockout tasA The upstream homologous arm of the sequence shown in SEQ ID NO.7 from position 1 to 807, and the downstream homologous arm of the sequence shown in SEQ ID NO.8 from position 1 to 799; Knockout GBAA_2860 The upstream homologous arm of the sequence shown in SEQ ID NO.9 from position 1 to 794, and the downstream homologous arm of the sequence shown in SEQ ID NO.10 from position 1 to 789; Knockout lef The upstream homologous arm of the sequence shown in SEQ ID NO.11 from position 1 to 815, and the downstream homologous arm of the sequence shown in SEQ ID NO.12 from position 1 to 764.
4. The use of the mutant strain A16R-5.1 of claim 1 in the preparation of products for the prevention and / or treatment of diseases caused by Bacillus anthracis.
5. The application according to claim 4, characterized in that, The products mentioned for the prevention and / or treatment of diseases caused by Bacillus anthracis include vaccines extracted from Bacillus anthracis culture supernatants.
6. A method for preparing a vaccine extracted from anthrax culture supernatant, characterized in that, The process includes the following steps: inoculating the mutant strain A16R-5.1 of claim 1 into RM medium for culture, collecting the supernatant of the culture, and concentrating it to obtain a concentrated supernatant sample.
7. Vaccine extracted from the culture supernatant of anthrax bacteria prepared by the method described in claim 6.
8. The vaccine extracted from the supernatant of anthrax culture according to claim 7, characterized in that, The dosage form of the vaccine extracted from the anthrax culture supernatant includes liquid or dry powder inhalation formulation.
Citation Information
Patent Citations
Protease-deficient bacillus anthracis
CN103975072A