An Electrochemical Biosensor for Mycoplasma Detection and a Method for Detecting Mycoplasma

By developing an electrochemical biosensor for mycoplasma detection, using the combination of hollow structure nanorod electrodes and general gene fragments, combined with plasma gold nanostar materials, rapid and high-sensitivity detection of a variety of mycoplasma is achieved, solving the problems of high detection difficulty and low sensitivity in the prior art.

CN116136510BActive Publication Date: 2025-06-24SHANGHAI TENTH PEOPLES HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202210223154.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-09
Publication Date
2025-06-24
Estimated Expiration
2042-03-09

AI Technical Summary

Technical Problem

The prior art is difficult to achieve rapid and high sensitivity detection of a variety of mycoplasmas, especially in clinical diagnosis and cell contamination detection.

Method used

An electrochemical biosensor was developed, using a hollow structure nanorod electrode and connecting a universal gene fragment (UGF) on its surface, and indiscriminate capture and specific identification of multiple mycoplasmas were achieved through sandwich hybridization. The sensor also combines plasma gold nanostar materials to amplify electrochemical signals to improve detection sensitivity.

Benefits of technology

Fast, accurate and efficient detection of a variety of mycoplasmas is achieved, the response rate and sensitivity of the sensor is improved, and early and high specific diagnosis can be provided in clinical and laboratory settings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116136510B_ABST
    Figure CN116136510B_ABST
Patent Text Reader

Abstract

The present invention discloses an electrochemical biosensor for mycoplasma detection and a method for detecting mycoplasma. The electrochemical biosensor includes a nanorod electrode, and a first sequence with a nucleic acid sequence as shown in SEQ ID NO. 1 is connected to the surface of the nanorod electrode. By capturing the ssDNA of the mycoplasma to be detected, and then binding a second sequence modified with gold nanorods - electrochemical indicator, synchronous electrochemical detection of multiple mycoplasmas is achieved according to the specific peak positions of the indicator. The electrochemical biosensor of the present invention can rapidly, efficiently and highly sensitively detect multiple mycoplasmas such as Mycoplasma pneumoniae, Mycoplasma hyorhinis, Ureaplasma urealyticum, Mycoplasma hominis and Mycoplasma genitalium, providing guidance for the early detection of clinical mycoplasma infection diseases and cell contamination in biological experiments.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial detection, and particularly relates to an electrochemical biosensor for mycoplasma detection and a method for detecting mycoplasma. Background Art

[0002] Mycoplasma is a common pathogenic bacterium that can widely infect multiple organs and tissues of the human body and cause diseases.

[0003] On the other hand, cell culture is an important experimental technique in basic scientific research and drug research in modern bioscience. According to investigations, 30%-60% of cell lines in laboratories have been contaminated by mycoplasma, especially during the culture process of passaged cells, mycoplasma contamination is more common. Mycoplasma contamination can cause changes in cell growth rate, chromosome aberration, synthesis and metabolism of nucleic acids and amino acids, membrane structure alteration, apoptosis, etc., and finally cause changes in cell expression, thus affecting scientific research results. Therefore, specific detection and effective prevention of mycoplasma contamination in laboratories are of utmost importance.

[0004] Currently, the commonly used methods for detecting mycoplasma infection in basic and clinical settings mainly include isolation and culture methods, DNA detection methods, PCR detection methods, enzymatic detection, ELISA, and metagenomic sequencing, etc. Among them, the isolation and culture method is the gold standard for mycoplasma detection. However, due to the high culture requirements, long time consumption, and risks of high false positives and contamination rates of this method, it is difficult to implement in clinical practice and cannot fully meet the current clinical needs. Therefore, serum specific antibody detection of Mycoplasma pneumoniae is commonly used clinically, and the conversion of Mycoplasma pneumoniae IgM antibody (MP-IgM) to positive or a more than 4-fold increase in antibody titer is used to identify Mycoplasma pneumoniae infection. However, MP-IgM detection has a certain lag, generally requiring detection 1 week after the onset of the disease, and has a high false negative rate. Therefore, it is difficult to achieve real-time early diagnosis of mycoplasma pneumonia.

[0005] In addition, due to the extremely difficult isolation and culture of Ureaplasma urealyticum and Mycoplasma hominis, low sensitivity, and the need for several weeks for successful culture, with high requirements for culture equipment and environment, the culture method is difficult to be used as a routine diagnostic method for Ureaplasma urealyticum. Nucleic acid isothermal amplification real-time fluorescence detection technology (Simultaneous amplification and testing, SAT) is mainly used for Ureaplasma urealyticum and Mycoplasma hominis. This technology has high specificity and sensitivity, but has high requirements for detection instruments and is difficult to achieve full popularization and rapid screening in primary medical and health institutions. Therefore, how to establish a rapid and sensitive early detection method for mycoplasma infection is one of the urgent problems in current medical clinical diagnosis research and basic scientific experiments.

[0006] Electrochemical biosensors can identify specific biomolecules on electrodes and convert the presence of biomolecules into measurable signals through electron transduction. Compared with traditional detection methods, electrochemical biosensors have gradually been widely used in basic research due to their advantages such as high sensitivity, good specificity, fast response speed, and miniaturization of equipment. In response to the clinical needs for early diagnosis of infectious diseases such as Mycoplasma pneumoniae, Ureaplasma urealyticum, and Mycoplasma hominis, and the requirements of basic scientific experiments for early detection of mycoplasma contamination in cells, there is an urgent need to develop a new electrochemical biosensor to achieve rapid and highly sensitive detection of multiple mycoplasmas. Summary of the Invention

[0007] The present invention aims to solve at least the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes an electrochemical biosensor for mycoplasma detection, which can rapidly, accurately, efficiently, and conveniently synchronously detect multiple mycoplasmas in a sample.

[0008] The present invention also proposes a method for mycoplasma detection using the above-mentioned electrochemical biosensor.

[0009] According to one aspect of the present invention, there is provided an electrochemical biosensor for mycoplasma detection, comprising: a nanorod electrode having a hollow structure, and a first sequence such as SEQ ID NO.1 connected to the surface of the nanorod electrode.

[0010] The first sequence is a universal gene fragment (Universal Genefragment, UGF) for the detection of multiple mycoplasmas. By comparing the 16S rRNA genes of mycoplasmas including at least Mycoplasma pneumoniae, Mycoplasma hyorhinis, Ureaplasma urealyticum, Mycoplasma hominis, and Mycoplasma genitalium, a universal gene fragment sequence suitable for the detection of these mycoplasmas is obtained.

[0011] The first sequence (SEQ ID NO.1) is specifically: 5’-3’TGGTG CATGG TTGTC GTCAG CTCGTGTCGT GAGAT GTT.

[0012] In the present invention, the electrochemical biosensor is used to construct a sandwich hybridization method, which realizes the first non-discriminatory capture of multiple mycoplasmas and the last specific recognition of different mycoplasmas through base complementary pairing, and quantitatively detects the content of one / multiple mycoplasma DNAs.

[0013] In some embodiments of the present invention, the nanorod electrode has a hollow structure, and the nanorod electrode has a hollow conductive polymer material, which is connected to the first sequence through the hollow conductive polymer material. The hollow structure of the nanorod is, from the inside to the outside: a gold electrode, a hollow layer, and a hollow conductive polymer material.

[0014] In the embodiment of the present invention, the hollow conductive polymer material has a conductive conjugated polymer structure. The S-H or N-H bonds in its conductive conjugated polymer structure contribute to the adsorption of electrons, and the conjugated structure formed by the alternating arrangement of carbon-carbon single bonds and carbon-carbon double bonds. The two π electrons in the conjugated double bond are not fixed on a certain carbon atom, enabling them to translocate from one carbon atom to another. That is, the overlap of the π electron clouds within the molecule generates an energy band shared by the entire molecule. The π electrons are similar to the free electrons in a metal conductor and extend along the entire molecular chain. When an electric field is present, the electrons forming the π bond can move along the molecular chain, effectively improving the response speed and sensitivity.

[0015] In some preferred embodiments of the present invention, the hollow conductive polymer material includes at least one of poly(pyrrole-3-carboxylic acid), poly(pyrrole-2-carboxylic acid), polythiophene acetic acid, and poly(3,4-ethylenedioxythiophene).

[0016] In some preferred embodiments of the present invention, the hollow conductive polymer nanorods have a diameter of about 50 nm and a length of about 1 μm. The hollow conductive polymer nanorods effectively increase the specific surface area of the conversion interface and the active sites, improving the response rate of the electrochemical sensor. Moreover, the structure effectively restricts the arrangement direction of the nucleic acid sequence, increasing the effective capture rate of the mycoplasma target sequence and improving the specificity of the sensor.

[0017] In some preferred embodiments of the present invention, the nanorod electrode is prepared by the following method: a gold electrode is used to prepare zinc oxide nanorods in a zinc oxide solution by chronopotentiometry; the zinc oxide nanorods are used to deposit a conductive polymer by cyclic voltammetry to obtain an electrode modified with polymer nanorods; the electrode modified with polymer nanorods is placed in hydrochloric acid to remove the zinc oxide template to obtain a hollow conductive polymer modified electrode; the carboxyl groups on the surface of the hollow conductive polymer modified electrode are activated and then connected to the first sequence through an amide reaction to obtain the final nanorod electrode. In the present invention, zinc oxide nanorods are first prepared by surface modification and film deposition methods, and then a conductive polymer is electrochemically polymerized on the nanorods. The zinc oxide nanorod template is removed by hydrochloric acid to prepare hollow conductive polymer nanorods, greatly increasing the specific surface area and active sites, improving the electrochemical properties and post-modifiability of the sensor itself, and ultimately enhancing the sensitivity of the electrochemical sensor.

[0018] In some embodiments of the present invention, the electrochemical biosensor further includes a plasmonic gold nanostar material, and the plasmonic gold nanostar material is connected with an electrochemical indicator and a second sequence.

[0019] In the present invention, the gold nanostars prepared by underpotential deposition can amplify electrochemical signals to achieve trace detection of mycoplasma. Compared with traditional plasmonic enhancement materials (such as gold nanorods, gold nanobipyramids, and gold nanotriangles), the gold nanostar material has more local plasmonic electric field hot spots, which can amplify optoelectronic signals to a large extent, improve the sensitivity of the sensor, and achieve trace detection of mycoplasma infection.

[0020] In some preferred embodiments of the present invention, the electrochemical indicator includes at least one of ferrocene, methylene blue, anthraquinone, methyl viologen, and nile blue.

[0021] In some more preferred embodiments of the present invention, a second sequence of a mycoplasma is linked to a specific electrochemical indicator, so that specific peak positions of different electrochemical indicators can be obtained by differential pulse method in the later stage, and the concentrations of different mycoplasmas can be calculated according to different peak positions, realizing synchronous electrochemical detection of multiple mycoplasmas.

[0022] In some preferred embodiments of the present invention, the second sequence is a specific primer with a designed product of about 500 bp for mycoplasma;

[0023] The nucleic acid sequence of the mycoplasma-specific primer includes at least one group of i to v:

[0024] i. SEQ ID NO.2 and SEQ ID NO.3;

[0025] ii. SEQ ID NO.4 and SEQ ID NO.5;

[0026] iii. SEQ ID NO.6 and SEQ ID NO.7;

[0027] iv. SEQ ID NO.8 and SEQ ID NO.9;

[0028] v. SEQ ID NO.10 and SEQ ID NO.11.

[0029] In the invention, the above-mentioned mycoplasma-specific primers are respectively corresponding to the detection of different types of mycoplasma, and can be used to amplify the corresponding products to obtain the DNA (ssDNA) to be detected with a length of about 500 bp for different mycoplasmas:

[0030] Mycoplasma pneumoniae: forward primer 5'-3' ACTCCATGTGGAGCGGTAAA (SEQ ID NO.2), reverse primer 3'-5' CTCACGACACGAGCTGACG (SEQ ID NO.3);

[0031] Mycoplasma hyorhinis: Forward primer 5’-3’ GTAAACCTAGAGTGTAGTAGGGAGT (SEQ ID NO.4), reverse primer 3’-5’ ACATCTCACGACACGAGCTGA (SEQ ID NO.5);

[0032] Mycoplasma urealyticum: Forward primer 5’-3’ CGGAATTCCATGTGAAGCGG (SEQ ID NO.6), reverse primer 3’-5’ CATCTCACGACACGAGCTGA (SEQ ID NO.7);

[0033] Mycoplasma hominis: Forward primer 5’-3’ TATCAGTCTAGAGTGTGGTAGGGAG (SEQ ID NO.8), reverse primer 3’-5’ AACATCTCACGACACGAGCTGA (SEQ ID NO.9);

[0034] Mycoplasma genitalium: Forward primer 5’-3’ TTAATCTAGAGTGTGGTAGGGAGT (SEQ ID NO.10), reverse primer 3’-5’ AACATCTCACGACACGAGC (SEQ ID NO.11).

[0035] In some preferred embodiments of the present invention, the gold nanostar material is prepared by the following method: Mix chloroauric acid (HAuCl4) with silver nitrate (AgNO3), add ascorbic acid (AA) for reduction to obtain gold nanoparticles; Since the work function of Ag is less than that of Au, silver ions can undergo underpotential deposition on the surface of gold nanoparticles, be reduced to Ag, and further grow as seeds. By underpotential deposition, the surface atomic distribution of Au is changed to modify the surface of gold nanoparticles, and finally a gold nanostar structure is obtained. The plasma gold nanostar particles are modified with cysteamine to obtain amino-functionalized gold nanostars, and then connected to the activated electrochemiluminescence indicator through an amide reaction. Then, the gold nanostar - electrochemiluminescence indicator is carboxylated with 3-mercaptopropionic acid, and after activation, it is connected to the second sequence to obtain the final gold nanostar material (electrochemiluminescence indicator - gold nanostar - specific sequence material). In some embodiments of the present invention, the mycoplasma includes at least one of Mycoplasma pneumoniae, Mycoplasma hyorhinis, Mycoplasma urealyticum, Mycoplasma hominis, and Mycoplasma genitalium.

[0036] According to another aspect of the present invention, a method for detecting mycoplasma is provided, which uses the above-mentioned electrochemical biosensor for detection and includes the following steps:

[0037] S1. After high-temperature denaturation of the DNA sample to be tested, co-incubate it with the nanorod electrode and gradually cool it down to 55°C.

[0038] S2. Use cyclic voltammetry and electrochemical impedance spectroscopy to verify the electrochemical performance of the sensor.

[0039] S3. After adding the gold nanostar material, perform co-incubation at 55°C again.

[0040] S4. Use differential pulse voltammetry to detect the electrochemical signal on the electrochemical biosensor.

[0041] In some preferred embodiments of the present invention, step S4 further includes immersing the highly sensitive biosensor in a solution containing different concentrations of biomarkers, using differential pulse voltammetry to detect the electrochemical performance of the highly sensitive biosensor, and preparing a standard curve.

[0042] In some embodiments of the present invention, the method further includes the following step: S5. Use sodium hydroxide solution to restore the nanorod electrode to its initial state.

[0043] In the present invention, in view of the clinical needs for early diagnosis of infectious diseases such as Mycoplasma pneumoniae, Ureaplasma urealyticum, and Mycoplasma hominis, and the basic scientific experimental requirements for early detection of cell mycoplasma contamination, the present invention adopts the sandwich hybridization method (universal gene fragment - ssDNA - specific sequence) to specifically identify different mycoplasmas, and uses plasmonic nanostars to amplify weak electrochemical signals to achieve specific and highly sensitive synchronous detection of different mycoplasma DNAs.

[0044] According to a specific embodiment of the present invention, it has at least the following beneficial effects: The electrochemical biosensor provided by the present invention specifically and quantitatively detects the contents of multiple mycoplasmas simultaneously through sandwich DNA hybridization technology, providing guidance for early detection of clinical mycoplasma infectious diseases and cell contamination in biological experiments; among them, (1) the hollow nanorod electrode used has a high specific surface area and multiple active sites, which improves the electrochemical properties and post-modifiability of the sensor, and ultimately enhances the response rate and sensitivity of the electrochemical sensor; (2) the first sequence obtains a highly binding and conserved gene sequence and a specific confirmation sequence by analyzing the whole genomes of multiple mycoplasmas, and binds to the mycoplasma target sequence through base complementary pairing, improving the accuracy of the sensor. (3) Plasmonic gold nanostars effectively amplify electrochemical signals through charge accumulation and oscillation effects of local plasmonic electric field hotspots, improving the sensitivity of the electrochemical sensor. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The following further describes the present invention with reference to the drawings and embodiments, wherein:

[0046] Figure 1Flow chart of the preparation and application of the novel DNA hybridization-based plasmonic nanostar amplified signal electrochemical biosensor in Example 1 of the present invention;

[0047] Figure 2 Schematic diagram of the electrochemical indicator in Example 1 of the present invention;

[0048] Figure 3 Cyclic voltammetry and electrochemical impedance spectroscopy verification of the sensor preparation results in Example 1 of the present invention;

[0049] Figure 4 Preparation and characterization of gold nanostars in Example 1 of the present invention. Among them, A is a transmission electron microscope image, B is the characteristic UV-Vis absorption spectrum of gold nanostars, C is the high-angle annular dark-field image of gold nanostars, D is the dark-field image of Au element of gold nanostars, and E is the merged image of C and D;

[0050] Figure 5 Detection results of mycoplasma by the highly sensitive electrochemical sensor based on CP-AuNS-ECS in Example 1 of the present invention. Detailed implementation mode

[0051] The concept and technical effects of the present invention will be clearly and completely described below in conjunction with the embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention. The test methods used in the embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial sources.

[0052] Example 1: Sensor preparation and mycoplasma detection method

[0053] This example provides a method for detecting mycoplasma. The specific method process is as Figure 1 shown. First, the clinical samples / cell cultures infected with mycoplasma are cultured and extracted to obtain the sample ssDNA to be detected. After co-culturing the sample ssDNA to be detected with the nanorod electrode of the sensor (connected with the universal gene fragment UGF), a gold nanostar material connected with an electrochemical indicator (selectable electrochemical indicators such as Figure 2 shown ferrocene, methylene blue, anthraquinone, methyl viologen, and nile blue) and specific primers is added, and the electrochemical signal on the electrochemical biosensor is detected by differential pulse method to obtain the detection result of the test sample.

[0054] This embodiment also provides a method for preparing an electrochemical biosensor, which includes a nanorod electrode and a gold nanostar material, and specifically includes the following steps:

[0055] 1. Preparation of the nanorod electrode

[0056] Physically polish the gold electrode to obtain a mirror surface morphology; chemically polish it to remove surface impurities; electrochemically polish it to activate the electrode. Immerse the activated electrode in a zinc oxide and potassium chloride solution with supersaturated oxygen, and use chronopotentiometry to prepare zinc oxide nanorods at 80 °C under a fixed current density. Dissolve thiopheneacetic acid (TAA) and tetrabutylammonium perchlorate in anhydrous acetonitrile, pass N2 to remove the air in the solution, and use cyclic voltammetry (CV) to electrochemically polymerize a conductive polymer to obtain a PTAA-modified electrode. Immerse the electrode modified with the conductive polymer nanorods in hydrochloric acid to remove the zinc oxide template and obtain a hollow conductive polymer. Adjust the morphology and quality of the surface conductive polymer deposits by controlling the deposition conditions; observe the gold with different morphologies using a scanning electron microscope (SEM) and a transmission electron microscope (TEM) (peel the gold with different morphologies modified from the electrode).

[0057] Obtain the 16S rRNA gene conserved nucleic acid sequences of 5 mycoplasmas through NCBI, use Vector NTI software to align the nucleic acid sequences, and obtain a 38-bp universal gene fragment (Universal Gene fragment, UGF) 5'-3': TGGTG CATGG TTGTC GTCAG CTCGT GTCGT GAGAT GTT.

[0058] Immerse the modified electrode into a 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immerse it into a solution containing UGF to immobilize the primer through an amide reaction. After blocking with BSA, measure the current and impedance on the electrode surface using the three-electrode method to reveal the electrochemical performance of the electrode under different modification conditions.

[0059] Characterization of the nanorod electrode: Prepare zinc oxide nanorods using chronopotentiometry, electrochemically polymerize polythiopheneacetic acid by cyclic voltammetry, then remove the zinc oxide template through hydrochloric acid to obtain a hollow conductive polymer, connect and bind the primer by activating the carboxyl groups on the electrode surface, and block the electrode with BSA. From Figure 3As can be seen from (A and B), as the sensor gradually reacts, the peak current value of the electrode mainly shows a decreasing trend, indicating that the reagent is gradually bound to the electrode surface, hindering the electron conduction activity; in addition, the electrode resistance value increases, effectively proving the successful preparation of the sensor. From Figure 3 In the small figure of A, the successfully prepared nanorod electrode structure can be seen. Its size has a diameter of about 50 nm and a length of about 1 μm. The hollow conductive polymer nanorods effectively increase the specific surface area and active sites of the conversion interface, improving the response rate of the electrochemical sensor. And the structure effectively limits the arrangement direction of the nucleic acid sequence, increasing the effective capture rate of the Mycoplasma target sequence and improving the specificity of the sensor.

[0060] 2. Preparation of gold nanorod materials

[0061] The underpotential deposition method is used to prepare gold nanorods. Mix chloroauric acid (HAuCl4) and silver nitrate (AgNO3), add ascorbic acid (AA), and shake quickly. Au3+ is first reduced to gold nanoparticles by AA. Since the work function of Ag is less than that of Au, silver ions can undergo underpotential deposition on the surface of gold nanoparticles, be reduced to Ag, and further grow as seeds. By underpotential deposition, the surface atomic distribution of Au is changed, and the surface of gold nanoparticles is modified, finally obtaining the gold nanorod structure.

[0062] Carboxyl ferrocene is activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS). Add cysteamine and the thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine) for amino modification, and then add it to gold nanorods AuNS. Electrochemical signals are connected through S-Au bonds. Subsequently, 3-mercaptopropionic acid and TCEP are added to carboxylate AuNS-ECS. After further activating the carboxyl group with the MES solution of EDC / NHS, primers are bound to obtain SCP-AuNS-ECS.

[0063] Mix HAuCl4 and AgNO3, add AA and shake quickly. Au3+ is reduced to gold nanoparticles by AA. Since the work function of Ag is less than that of Au, it satisfies the principle of underpotential deposition, enabling Ag+ to be reduced to Ag0 atoms on the gold surface to form bimetallic nanoparticles and further grow as seeds. Finally, the surface atomic distribution of Au is gradually changed by underpotential deposition, and the surface of gold nanoparticles is modified, finally obtaining the gold nanorod structure.

[0064] Characterization of gold nanorod materials: From Figure 4 As can be seen, the transmission electron microscope image in 4A shows that the size of the gold nanorods is 50 nm and they have obvious tips.Figure 4 B is the characteristic UV-Vis absorption spectrum of gold nanorods. Compared with gold nanoparticles, the longitudinal peak of the ultraviolet absorption peak of the nanorods is shifted to about 1100 nm. Figure 4 C is the high-angle annular dark-field image of gold nanorods. After merging with Figure 4 the Au element in D ( Figure 4 E), it further proves the successful preparation of gold nanorods, providing a basis for the subsequent amplification of electrochemical signals and the preparation of highly sensitive sensors.

[0065] 3. Verification of the detection effect of the biosensor

[0066] After successfully modifying CP and ECS with AuNS to form CP-AuNS-ECS, the sensor is used to capture the mycoplasma to be detected, and then combined with CP-AuNS-ECS to check the binding signal of the mycoplasma. As can be seen from Figure 5 A, when the sensor is immersed in the GAPDH gene fragment, there is no current signal; when combined with CP-AuNS-ECS, a strong electrochemical signal appears. Compared with the sensor without nanorod modification, the current signal can be amplified by about 6.3 times after nanorod modification. Through the differential pulse method ( Figure 5 B), it can be seen that as the concentration of mycoplasma increases, the peak current gradually rises. Taking the mycoplasma concentration as the X-axis and the differential pulse current as the Y-axis, a linear correlation can be formed.

[0067] The embodiments of the present invention have at least the following beneficial effects:

[0068] In the embodiments of the present invention, zinc oxide nanorods and conductive polymers are used to modify the electrode. Subsequently, the zinc oxide nanorod template is removed to obtain a conductive polymer hollow nanorod electrode with ultra-high conductivity and a large active surface area. Subsequently, a conductive polymer is deposited on its surface to obtain a hollow conductive polymer nanorod, effectively improving physical and chemical properties such as stability, adhesion, electrochemical activation surface area, and conductivity. Moreover, the hollow conductive polymer can effectively limit the nucleic acid sequence arrangement direction, increase the effective capture rate of the mycoplasma target sequence, and improve the specific capture of the sensor. In addition, the present patent uses a film deposition and chemical coupling method to prepare a hollow conductive polymer sensor, which has the characteristics of controllable conditions and high device stability, avoiding the influence of unstable sensor performance in different batches and effectively increasing the sensor stability; by binding the mycoplasma-specific sequence on the sensor surface, the problem that biological recognition such as antibodies and enzymes is prone to denaturation and inactivation due to the influence of the surrounding environment is avoided, greatly improving the stability of the electrochemical sensor.

[0069] Meanwhile, based on the mycoplasma sequence, a conservative gene fragment and a specific sequence were designed, and a sensor modified with hollow conductive polymer nanorods was prepared. The mycoplasma single-stranded ssDNA was captured by the conservative sequence, and a mycoplasma-specific sequence modified with plasmonic nanostars and an electrochemical indicator was further designed. Simultaneous and spatial quantitative detection of multiple genera of trace mycoplasmas was achieved by sandwich hybridization.

[0070] Example 2: Detection of Mycoplasma pneumoniae

[0071] 1. Preparation of mycoplasma samples

[0072] The complete genome of Mycoplasma pneumoniae (ATCC 15531) was obtained through NCBI. Based on the complete genome of mycoplasma, specific primer pairs with a PCR product of about 500 bp were designed using primer-BLAST. Forward primer for Mycoplasma pneumoniae 5’-3’ACTCCATGTGGAGCGGTAAA, reverse primer 3’-5’ CTCACGACACGAGCTGACG.

[0073] Amplification by PCR: The total reaction volume was 50 μL. Sterilized ddH2O, forward and reverse primer pairs, Q5® high-fidelity DNA polymerase, and the infected sample were added. The amplification conditions were: pre-denaturation at 98 °C for 1 min, denaturation at 98 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, 30 cycles, and extension at 72 °C for 5 min.

[0074] The purity of the sample was verified by running the gel on a 0.5% agarose gel at 120 V for 30 min. Subsequently, the sample was recovered and purified using an agarose gel DNA recovery kit, and the nucleic acid concentration was detected using a micro-spectrophotometer. The obtained sample was commercially sequenced. Further, based on the obtained sample sequence, the specific mycoplasma type was analyzed through NCBI. Specific mycoplasma confirmation fragments were designed using primer-BLAST.

[0075] 2. Preparation of the sensor

[0076] The gold electrode was physically polished to obtain a mirror surface morphology, chemically polished to remove surface impurities, and electrochemically polished to activate the electrode. The activated electrode was immersed in a solution of zinc oxide and potassium chloride, with supersaturated oxygen, and zinc oxide nanorods were prepared by chronopotentiometry at 80 °C under a fixed current density. Thiopheneacetic acid (TAA) and tetrabutylammonium perchlorate were dissolved in anhydrous acetonitrile, and N2 was introduced to remove the air in the solution. Electrochemical polymerization of the conductive polymer was carried out using cyclic voltammetry (CV) to obtain a PTAA-modified electrode. The electrode modified with the conductive polymer nanorods was placed in hydrochloric acid to remove the zinc oxide template to obtain a hollow conductive polymer. The morphology and quality of the surface conductive polymer deposit were adjusted by controlling the deposition conditions; scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to observe gold with different morphologies (the modified gold with different morphologies was peeled off from the electrode). In this example, the electrode was prepared under the conditions of a deposition potential of 0.5 mA / cm2, a deposition time of 600 s, and a deposition environment of 80 °C.

[0077] The modified electrode was immersed in a 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immersed in a solution containing the conserved sequence (sequence SEQ ID NO.1) to immobilize the primer by an amide reaction. After blocking with BSA, the current and impedance on the electrode surface were measured using the three-electrode method to reveal the electrochemical performance of the electrodes under different modification conditions.

[0078] 3. Highly sensitive gold nanosphere - electrochemical signal primer design

[0079] Gold nanospheres were prepared using underpotential deposition. Chloroauric acid (HAuCl4) and silver nitrate (AgNO3) were mixed evenly, ascorbic acid (AA) was added, and the mixture was shaken rapidly. Au3+ was first reduced to gold nanoparticles by AA. Since the work function of Ag is less than that of Au, silver ions can undergo underpotential deposition on the surface of the gold nanoparticles, be reduced to Ag, and serve as seeds for further growth. By underpotential deposition, the surface atomic distribution of Au was changed to modify the surface of the gold nanoparticles, and finally a gold nanosphere structure was obtained.

[0080] Carboxyl ferrocene was activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS). Cysteamine and the thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine) were added for amination modification, and then added to gold nanorods AuNS. Electrochemical signals were connected through S-Au bonds. Subsequently, 3-mercaptopropionic acid and TCEP were added to carboxylate AuNS-ECS. After further activating the carboxyl group with the MES solution of EDC / NHS, the binding sequence bis(sequence SEQ ID NO.2) was obtained to get SCP-AuNS-ECS.

[0081] 4. Mycoplasma sample detection

[0082] In addition, the 16S rRNA conserved nucleic acid sequences of 5 mycoplasmas were obtained through NCBI. The nucleic acid sequences were aligned using Vector NTI software to obtain a 38-bp universal gene fragment (Universal Gene fragment, UGF) 5'-3': Sequence 1 TGGTG CATGG TTGTC GTCAG CTCGT GTCGT GAGAT GTT.

[0083] PCR buffer was added to the mycoplasma DNA sample and co-incubated with the prepared sensor. Denaturation was carried out at 98 °C for 5 min to break the hydrogen bonds of mycoplasma double-stranded DNA (dsDNA), and the double strands dissociated to form single-stranded DNA (ssDNA). The temperature was gradually lowered to 55 °C and maintained for 5 min. In the presence of Mg2+ in the PCR buffer, the UGF on the sensor captured the ssDNA. Subsequently, it was co-incubated with ESC-AuNS-SCP containing PCR buffer at 55 °C for 5 min to specifically identify and detect mycoplasma DNA by the sandwich DNA hybridization method, and the electrochemical signal on the sensor was detected using the differential pulse method. The NaOH solution was used to break the hydrogen bonds of the sandwich DNA hybridization to restore the electrode to the initial state of the sensor, and different concentrations of mycoplasma were repeatedly detected. According to the mycoplasma concentration and the electrochemical signal, a standard curve was made. The electrochemical signal of the GAPDH DNA fragment was detected using the above method to verify the anti-interference ability of the sensor.

[0084] Example 3: Detection of Mycoplasma hyorhinis

[0085] 1. Preparation of mycoplasma samples

[0086] Obtain the complete genome of Mycoplasma hyorhinis (ATCC 25902) through NCBI. Based on the complete genome of specific mycoplasmas, use primer-BLAST to design PCR primers as specific primer pairs of about 500 bp. Forward primer for Mycoplasma hyorhinis 5’-3’ GTAAACCTAGAGTGTAGTAGGGAGT, reverse primer 3’-5’ ACATCTCACGACACGAGCTGA.

[0087] Amplify by PCR: The total reaction volume is 50 μL. Add sterilized dd H2O, forward and reverse primer pairs, Q5® High-Fidelity DNA Polymerase, and the infected sample. The amplification conditions are pre-denaturation at 98 °C for 1 min, 98 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, with 30 cycles, and extension at 72 °C for 5 min.

[0088] Use 0.5% agarose gel electrophoresis at 120 V for 30 min to run the gel and verify the purity of the sample. Subsequently, use an agarose gel DNA recovery kit to recover and purify the sample, and detect the nucleic acid concentration with a micro-spectrophotometer. The obtained sample is sequenced commercially. Further, based on the obtained sample sequence, analyze through NCBI to obtain the specific mycoplasma type. Design multiple specific mycoplasma sequences according to primer-BLAST.

[0089] 2. Preparation of the sensor

[0090] Physically polish the gold electrode to obtain a mirror surface morphology; chemically polish to remove surface impurities; electrochemically polish to activate the electrode. Immerse the activated electrode in a solution of zinc oxide and potassium chloride, with supersaturated oxygen, and use chronopotentiometry to prepare zinc oxide nanorods at 80 °C under a fixed current density. Dissolve thiopheneacetic acid (TAA) and tetrabutylammonium perchlorate in anhydrous acetonitrile, pass N2 to remove the air in the solution, and electrochemically polymerize the conductive polymer using cyclic voltammetry (CV) to obtain a PTAA-modified electrode. Place the electrode modified with the conductive polymer nanorods in hydrochloric acid to remove the zinc oxide template to obtain a hollow conductive polymer. Adjust the morphology and quality of the surface conductive polymer deposit by controlling the deposition conditions; use scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to observe the gold with different morphologies (peel the gold with different morphologies modified from the electrode). In this example, the electrode is prepared under the conditions of a deposition potential of 0.5 mA / cm2, a deposition time of 600 s, and a deposition environment of 80 °C.

[0091] The modified electrode was immersed in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immersed in a solution containing specific primers to immobilize the primers through an amide reaction. After blocking with BSA, the current and impedance on the electrode surface were measured using the triple electrode method to reveal the electrochemical performance of the electrodes under different modification conditions.

[0092] 3. Design of Highly Sensitive Gold Nanostar-Electrochemical Signal Primers

[0093] Gold nanostars were prepared using the underpotential deposition method. Chlorauric acid (HAuCl4) was mixed with silver nitrate (AgNO3), ascorbic acid (AA) was added, and the mixture was shaken rapidly. Au3+ was first reduced to gold nanoparticles by AA. Since the work function of Ag is less than that of Au, silver ions can undergo underpotential deposition on the surface of the gold nanoparticles, be reduced to Ag, and serve as seeds for further growth. By changing the atomic distribution on the Au surface through underpotential deposition, the surface of the gold nanoparticles was modified, and finally, a gold nanostar structure was obtained.

[0094] Carboxyl ferrocene was activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS). Cysteamine and the thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine) were added for amino modification, and then it was added to gold nanostars AuNS to connect the electrochemical signal through an S-Au bond. Subsequently, 3-mercaptopropionic acid and TCEP were added to carboxylate AuNS-ECS. After further activating the carboxyl groups with a MES solution of EDC / NHS, primers were bound to obtain SCP-AuNS-ECS.

[0095] 4. Detection of Mycoplasma Samples

[0096] In addition, the 16S rRNA conserved nucleic acid sequences of 5 species of mycoplasma were obtained from NCBI, and the nucleic acid sequences were aligned using Vector NTI software to obtain a 38-bp universal gene fragment (Universal Gene fragment, UGF) 5'-3': Sequence 1 TGGTG CATGG TTGTC GTCAG CTCGT GTCGT GAGAT GTT.

[0097] Add PCR buffer to the Mycoplasma DNA sample and co-incubate it with the prepared sensor. Denature at 98 °C for 5 min to break the hydrogen bonds of the double-stranded DNA (dsDNA) of Mycoplasma, dissociate the double strands to form single-stranded DNA (ssDNA), gradually cool down to 55 °C and maintain for 5 min. In the presence of Mg2+ in the PCR buffer, let the UGF on the sensor capture ssDNA, and then co-incubate with ESC-AuNS-SCP containing PCR buffer at 55 °C for 5 min to specifically identify and detect Mycoplasma DNA by the sandwich DNA hybridization method, and use differential pulse method to detect the electrochemical signal on the sensor. Use NaOH solution to break the hydrogen bonds of the sandwich DNA hybridization to restore the electrode to the initial state of the sensor, and repeat the detection of Mycoplasma at different concentrations. According to the Mycoplasma concentration and the electrochemical signal, make a standard curve. Use the above method to detect the electrochemical signal of the GAPDH DNA fragment to verify the anti-interference ability of the sensor.

[0098] Example 4: Detection of Ureaplasma urealyticum

[0099] 1. Preparation of Mycoplasma samples

[0100] Obtain the complete genome of Ureaplasma urealyticum (ATCC 27618) through NCBI, and based on the specific Mycoplasma complete genome, use primer-BLAST to design PCR primers as a pair of specific primers about 500 bp. Forward primer of Ureaplasma urealyticum 5’-3’ CGGAATTCCATGTGAAGCGG, reverse primer 3’-5’CATCTCACGACACGAGCTGA.

[0101] Amplify by PCR: The total reaction volume is 50 μL, add sterilized dd H2O, forward and reverse primer pairs, Q5® high-fidelity DNA polymerase, and the infected sample. The amplification conditions are pre-denaturation at 98 °C for 1 min, 98 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, cycle 30 times, and extension at 72 °C for 5 min.

[0102] Use 0.5% agarose gel electrophoresis at 120 V for 30 min to run the gel to verify the purity of the sample, then use the agarose gel DNA recovery kit to recover and purify the sample, and detect the nucleic acid concentration by a micro-spectrophotometer. The obtained sample is sequenced commercially. Further, according to the obtained sample sequence, analyze the specific Mycoplasma type through NCBI. Design multiple specific Mycoplasma primers according to primer-BLAST.

[0103] 2. Preparation of the sensor

[0104] Physically polish the gold electrode to obtain a mirror surface morphology; chemically polish it to remove surface impurities; electrochemically polish it to activate the electrode. Immerse the activated electrode in a solution of zinc oxide and potassium chloride, with supersaturated oxygen, and use chronopotentiometry to prepare zinc oxide nanorods at 80 °C under a fixed current density. Dissolve thiophene acetic acid (TAA) and tetrabutylammonium perchlorate in anhydrous acetonitrile, pass N2 to remove the air in the solution, and electrochemically polymerize the conductive polymer using cyclic voltammetry (CV) to obtain a PTAA-modified electrode. Place the electrode modified with the conductive polymer nanorods in hydrochloric acid to remove the zinc oxide template and obtain a hollow conductive polymer. Adjust the morphology and quality of the surface conductive polymer deposit by controlling the deposition conditions; use scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to observe gold with different morphologies (peel the modified gold with different morphologies from the electrode). In this example, the electrode is prepared under the conditions of a deposition potential of 0.5 mA / cm2, a deposition time of 600 s, and a deposition environment of 80 °C.

[0105] Immerse the modified electrode into a 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immerse it into a solution containing specific primers to immobilize the primers through an amide reaction. After blocking with BSA, measure the current and impedance on the electrode surface using the three-electrode method to reveal the electrochemical performance of the electrodes under different modification conditions.

[0106] 3. Highly sensitive gold nanosphere - electrochemical signal primer design

[0107] Prepare gold nanospheres using the underpotential deposition method. Mix chloroauric acid (HAuCl4) and silver nitrate (AgNO3), add ascorbic acid (AA), and shake rapidly. Au3+ is first reduced to gold nanoparticles by AA. Since the work function of Ag is less than that of Au, silver ions can undergo underpotential deposition on the surface of the gold nanoparticles, be reduced to Ag, and serve as seeds for further growth. Modify the surface of the gold nanoparticles by changing the atomic distribution on the Au surface through underpotential deposition, and finally obtain a gold nanosphere structure.

[0108] Carboxyl ferrocene was activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS). Cysteamine and the thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine) were added for amination modification, and then it was added to gold nanorods AuNS, and the electrochemical signal was connected through S-Au bonds. Subsequently, 3-mercaptopropionic acid and TCEP were added to carboxylate AuNS-ECS. After further activating the carboxyl group with the MES solution of EDC / NHS, primers were bound to obtain SCP-AuNS-ECS.

[0109] 4. Mycoplasma sample detection

[0110] In addition, the 16S rRNA conserved nucleic acid sequences of 5 mycoplasmas were obtained through NCBI, and the nucleic acid sequences were aligned using Vector NTI software to obtain a universal gene fragment (UGF) with a length of 38 bp 5'-3': TGGTG CATGG TTGTC GTCAG CTCGT GTCGT GAGAT GTT.

[0111] PCR buffer was added to the mycoplasma DNA sample and co-incubated with the prepared sensor. Denaturation was carried out at 98 °C for 5 min to break the hydrogen bonds of mycoplasma double-stranded DNA (dsDNA), and the double strands dissociated to form single-stranded DNA (ssDNA). The temperature was gradually lowered to 55 °C and maintained for 5 min. In the presence of Mg2+ in the PCR buffer, the UGF on the sensor captured the ssDNA. Subsequently, it was co-incubated with ESC-AuNS-SCP containing PCR buffer at 55 °C for 5 min to specifically identify and detect mycoplasma DNA by sandwich DNA hybridization method, and the electrochemical signal on the sensor was detected using differential pulse method. The NaOH solution was used to break the hydrogen bonds of the sandwich DNA hybridization to restore the electrode to the initial state of the sensor, and different concentrations of mycoplasma were repeatedly detected. According to the mycoplasma concentration and the electrochemical signal, a standard curve was made. The electrochemical signal of the GAPDH DNA fragment was detected using the above method to verify the anti-interference ability of the sensor.

[0112] Example 5: Detection of Mycoplasma hominis

[0113] 1. Preparation of mycoplasma samples

[0114] The complete genome of Mycoplasma hominis (ATCC 23114) was obtained through NCBI. Based on the complete genome of specific mycoplasma, primer-BLAST was used to design PCR primers, which were specific primer pairs of about 500 bp. The forward primer of Mycoplasma hominis was 5’-3’TATCAGTCTAGAGTGTGGTAGGGAG, and the reverse primer was 3’-5’AACATCTCACGACACGAGCTGA.

[0115] PCR amplification: The total reaction volume was 50 μL. Sterilized dd H2O, forward and reverse primer pairs, Q5® High-Fidelity DNA Polymerase, and the infected sample were added. The amplification conditions were pre-denaturation at 98 °C for 1 min, denaturation at 98 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, with 30 cycles, and a final extension at 72 °C for 5 min.

[0116] 0.5% agarose gel electrophoresis was used at 120 V for 30 min to run the gel and verify the purity of the sample. Subsequently, an agarose gel DNA recovery kit was used to recover and purify the sample, and the nucleic acid concentration was detected by a micro-spectrophotometer. The obtained sample was sequenced commercially. Further, based on the obtained sample sequence, the specific mycoplasma type was obtained through NCBI analysis. Multiple specific mycoplasma sequences were designed according to primer-BLAST.

[0117] 2. Preparation of the sensor

[0118] The gold electrode was physically polished to obtain a mirror surface morphology, chemically polished to remove surface impurities, and electrochemically polished to activate the electrode. The activated electrode was immersed in a solution of zinc oxide, potassium chloride, and supersaturated oxygen. Zinc oxide nanorods were prepared using chronoamperometry at 80 °C under a fixed current density. Thiopheneacetic acid (TAA) and tetrabutylammonium perchlorate were dissolved in anhydrous acetonitrile, and N2 was introduced to remove the air in the solution. Electrochemical polymerization of the conductive polymer was carried out using cyclic voltammetry (CV) to obtain a PTAA-modified electrode. The electrode modified with the conductive polymer nanorods was placed in hydrochloric acid to remove the zinc oxide template and obtain a hollow conductive polymer. The morphology and quality of the surface conductive polymer deposit were adjusted by controlling the deposition conditions. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to observe the gold with different morphologies (the modified gold with different morphologies was peeled off from the electrode). In this example, the electrode was prepared under the conditions of a deposition potential of 0.5 mA / cm2, a deposition time of 600 s, and a deposition environment of 80 °C.

[0119] The modified electrode was immersed in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immersed in a solution containing specific primers to fix the primers through amide reaction. After blocking with BSA, the current and impedance on the electrode surface were measured using the ternary electrode method to reveal the electrochemical properties of the electrode under different modification conditions.

[0120] 3. Design of highly sensitive gold nanostar-electrochemical signal primers

[0121] Gold nanostars were prepared using the underpotential deposition method. Mix tetrachloroauric acid (HAuCl4) and silver nitrate (AgNO3), add ascorbic acid (AA), and shake rapidly. Au3+ is first reduced to gold nanoparticles by AA. Since the work function of Ag is smaller than that of Au, silver ions can be underpotentially deposited on the surface of gold nanoparticles, reduced to Ag, and further grow as seeds. The distribution of Au surface atoms is changed by underpotential deposition, and the surface of gold nanoparticles is modified, and finally the gold nanostar structure is obtained.

[0122] Carboxyferrocene was activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS), and amino-modified by adding cysteamine and thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine), and then added to gold nanostars AuNS to connect the electrochemical signal through the S-Au bond. Subsequently, 3-mercaptopropionic acid and TCEP were added to carboxylate AuNS-ECS, and the carboxyl group was further activated by MES solution of EDC / NHS, and the primer was bound to obtain SCP-AuNS-ECS.

[0123] 4. Mycoplasma sample testing

[0124] In addition, the conserved nucleic acid sequences of 16S rRNA of five mycoplasmas were obtained through NCBI, and the nucleic acid sequences were aligned using Vector NTI software to obtain a 38 bp universal gene fragment (UGF) 5'-3': TGGTG CATGG TTGTC GTCAG CTCGT GTCGT GAGAT GTT.

[0125] PCR buffer was added to the mycoplasma DNA sample and incubated with the prepared sensor. Denatured at 98°C for 5 min to break the hydrogen bonds of the mycoplasma double-stranded DNA (dsDNA), dissociate the double strands to form single strands and denature into single-stranded DNA (ssDNA), and then gradually cooled to 55°C for 5 min. In the presence of Mg2+ in the PCR buffer, the UGF on the sensor captured the ssDNA, and then incubated with ESC-AuNS-SCP containing PCR buffer at 55°C for 5 min to specifically identify and detect mycoplasma DNA through the sandwich DNA hybridization method, and the electrochemical signal on the sensor was detected using the differential pulse method. The hydrogen bonds of the sandwich DNA hybridization were destroyed using NaOH solution, so that the electrode returned to the initial state of the sensor, and the detection of mycoplasma at different concentrations was repeated. A standard curve was made based on the mycoplasma concentration and electrochemical signal. The electrochemical signal of the GAPDH DNA fragment was detected using the above method to verify the anti-interference ability of the sensor.

[0126] Example 6: Mycoplasma genitalium detection

[0127] 1. Preparation of Mycoplasma Samples

[0128] The complete genome of Mycoplasma genitalium (ATCC 33530) was obtained from NCBI, and based on the complete genome of the specific Mycoplasma, primer-BLAST was used to design a specific primer pair of PCR primers of about 500 bp. The forward primer of Mycoplasma genitalium was 5'-3'TTAATCTAGAGTGTGGTAGGGAGT, and the reverse primer was 3'-5' AACATCTCACGACACGAGC.

[0129] Amplification by PCR: The total reaction volume was 50 μL, and sterile dd H2O, forward and reverse primer pairs, Q5® High-Fidelity DNA Polymerase, and infected samples were added. Amplification conditions were 98°C 1 min initial denaturation, 98°C 30s, 55°C 30s, 72°C 1 min, 30 cycles, and 72°C extension for 5 min.

[0130] The purity of the sample was verified by running the gel at 120 V for 30 min using 0.5% agarose gel electrophoresis. The purified sample was then recovered using an agarose gel DNA recovery kit and the nucleic acid concentration was detected by a micro-spectrophotometer. The obtained sample was sequenced commercially. Further, the specific mycoplasma type was obtained based on the obtained sample sequence through NCBI analysis. Multiple specific mycoplasma sequences were designed based on primer-BLAST.

[0131] 2. Preparation of the sensor

[0132] The gold electrode was physically polished to obtain a mirror morphology; chemical polishing was performed to remove surface impurities; and electrochemical polishing was performed to activate the electrode. The activated electrode was immersed in a zinc oxide and potassium chloride solution, supersaturated with oxygen, and zinc oxide nanorods were prepared using a chronopotentiometry method at 80°C and a fixed current density. Thiopheneacetic acid (TAA) and tetrabutylammonium perchlorate were dissolved in anhydrous acetonitrile, and N2 was introduced to remove air from the solution. The conductive polymer was electrochemically polymerized using cyclic voltammetry (CV) to obtain a PTAA-modified electrode. The electrode modified with the conductive polymer nanorod was placed in hydrochloric acid, and the zinc oxide template was removed to obtain a hollow conductive polymer. The morphology and quality of the surface conductive polymer deposit were adjusted by controlling the deposition conditions; scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to observe gold with different morphologies (the modified gold with different morphologies was peeled off from the electrode). In this embodiment, the electrode was prepared using the deposition potential of 0.5 mA / cm2, the deposition time of 600 s, and the deposition environment of 80°C.

[0133] The modified electrode was immersed in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immersed in a solution containing specific primers to fix the primers through amide reaction. After blocking with BSA, the current and impedance on the electrode surface were measured using the ternary electrode method to reveal the electrochemical properties of the electrode under different modification conditions.

[0134] 3. Design of highly sensitive gold nanostar-electrochemical signal primers

[0135] Gold nanostars were prepared using the underpotential deposition method. Mix tetrachloroauric acid (HAuCl4) and silver nitrate (AgNO3), add ascorbic acid (AA), and shake rapidly. Au3+ is first reduced to gold nanoparticles by AA. Since the work function of Ag is smaller than that of Au, silver ions can be underpotentially deposited on the surface of gold nanoparticles, reduced to Ag, and further grow as seeds. The distribution of Au surface atoms is changed by underpotential deposition, and the surface of gold nanoparticles is modified, and finally the gold nanostar structure is obtained.

[0136] Carboxyferrocene was activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS), and amino-modified by adding cysteamine and thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine), and then added to gold nanostars AuNS to connect the electrochemical signal through the S-Au bond. Subsequently, 3-mercaptopropionic acid and TCEP were added to carboxylate AuNS-ECS, and the carboxyl group was further activated by MES solution of EDC / NHS, and the primer was bound to obtain SCP-AuNS-ECS.

[0137] 4. Mycoplasma sample testing

[0138] In addition, the conserved nucleic acid sequences of 16S rRNA of five mycoplasmas were obtained through NCBI, and the nucleic acid sequences were aligned using Vector NTI software to obtain a 38 bp universal gene fragment (UGF) 5'-3': TGGTG CATGG TTGTC GTCAG CTCGT GTCGT GAGAT GTT.

[0139] PCR buffer was added to the mycoplasma DNA sample and incubated with the prepared sensor. Denatured at 98°C for 5 min to break the hydrogen bonds of the mycoplasma double-stranded DNA (dsDNA), dissociate the double strands to form single strands and denature into single-stranded DNA (ssDNA), and then gradually cooled to 55°C for 5 min. In the presence of Mg2+ in the PCR buffer, the UGF on the sensor captured the ssDNA, and then incubated with ESC-AuNS-SCP containing PCR buffer at 55°C for 5 min to specifically identify and detect mycoplasma DNA through the sandwich DNA hybridization method, and the electrochemical signal on the sensor was detected using the differential pulse method. The hydrogen bonds of the sandwich DNA hybridization were destroyed using NaOH solution, so that the electrode returned to the initial state of the sensor, and the detection of mycoplasma at different concentrations was repeated. A standard curve was made based on the mycoplasma concentration and electrochemical signal. The electrochemical signal of the GAPDH DNA fragment was detected using the above method to verify the anti-interference ability of the sensor.

[0140] Example 7: Detection of multiple mycoplasmas

[0141] 1. Preparation of Mycoplasma Samples

[0142] Amplify mycoplasma according to mycoplasma. Amplify by PCR: the total reaction volume is 50 μL, add sterile ddH2O, forward and reverse primer pairs, Q5® High Fidelity DNA Polymerase, and infected samples. Amplification conditions are 98 ℃ 1 min initial denaturation, 98 ℃ 30s, 55 ℃ 30s, 72 ℃ 1 min, 30 cycles, 72 ℃ extension for 5 min.

[0143] The purity of the sample was verified by running the gel at 120 V for 30 min using 0.5% agarose gel electrophoresis. The purified sample was then recovered using an agarose gel DNA recovery kit and the nucleic acid concentration was detected by a micro-spectrophotometer. The obtained sample was sequenced commercially. Further, the specific mycoplasma type was obtained based on the obtained sample sequence through NCBI analysis. Multiple specific mycoplasma sequences were designed based on primer-BLAST.

[0144] 2. Preparation of the sensor

[0145] The gold electrode was physically polished to obtain a mirror morphology; chemical polishing was performed to remove surface impurities; and electrochemical polishing was performed to activate the electrode. The activated electrode was immersed in a zinc oxide and potassium chloride solution, supersaturated with oxygen, and zinc oxide nanorods were prepared using a chronopotentiometry method at 80°C and a fixed current density. Thiopheneacetic acid (TAA) and tetrabutylammonium perchlorate were dissolved in anhydrous acetonitrile, and N2 was introduced to remove air from the solution. The conductive polymer was electrochemically polymerized using cyclic voltammetry (CV) to obtain a PTAA-modified electrode. The electrode modified with the conductive polymer nanorod was placed in hydrochloric acid, and the zinc oxide template was removed to obtain a hollow conductive polymer. The morphology and quality of the surface conductive polymer deposit were adjusted by controlling the deposition conditions; scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to observe gold with different morphologies (the modified gold with different morphologies was peeled off from the electrode). In this embodiment, the electrode was prepared using the deposition potential of 0.5 mA / cm2, the deposition time of 600 s, and the deposition environment of 80°C.

[0146] The modified electrode was immersed in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS) to activate the carboxyl groups on the electrode surface, and then immersed in a solution containing specific primers to fix the primers through amide reaction. After blocking with BSA, the current and impedance on the electrode surface were measured using the ternary electrode method to reveal the electrochemical properties of the electrode under different modification conditions.

[0147] 3. Design of highly sensitive gold nanostar-electrochemical signal primers

[0148] Gold nanostars were prepared using the underpotential deposition method. Mix tetrachloroauric acid (HAuCl4) and silver nitrate (AgNO3), add ascorbic acid (AA), and shake rapidly. Au3+ is first reduced to gold nanoparticles by AA. Since the work function of Ag is smaller than that of Au, silver ions can be underpotentially deposited on the surface of gold nanoparticles, reduced to Ag, and further grow as seeds. The distribution of Au surface atoms is changed by underpotential deposition, and the surface of gold nanoparticles is modified, and finally the gold nanostar structure is obtained.

[0149] Carboxyferrocene was activated in 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing [1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride] / N-hydroxysuccinimide (EDC / NHS), and amino-modified by adding cysteamine and thiol reducing agent TCEP (Tris(2-carboxyethyl)phosphine), and then added to gold nanostars AuNS to connect the electrochemical signal through the S-Au bond. Subsequently, 3-mercaptopropionic acid and TCEP were added to carboxylate AuNS-ECS, and the carboxyl group was further activated by MES solution of EDC / NHS, and the primer was bound to obtain SCP-AuNS-ECS.

[0150] 4. Mycoplasma sample testing

[0151] The sensor modified with the universal gene fragment UGF was used to capture pure mycoplasma samples respectively, and then different electrochemical signals ECS were connected to different mycoplasma primers SCP, and bound to nanostars to construct ECS-AuNS-SCP. Since different mycoplasmas can capture specific confirmation primers SCP and show electrochemical signals ECS with different oxidation peaks, the concentration of the corresponding mycoplasma is calculated by the size of the different peak current values, and the simultaneous and spatial detection of different mycoplasmas is achieved. NaOH solution is used to destroy the hydrogen bonds of DNA hybridization and return the electrode to the initial state of the sensor. Repeat the detection of mycoplasma at different concentrations. A standard curve is made based on the mycoplasma concentration and electrochemical signal. The electrochemical signal of the GAPDH DNA fragment is detected using the above method to verify the anti-interference ability of the sensor.

[0152] Example 8: Sensor Accuracy and Stability Testing

[0153] By using the methods of the above Examples 1 to 7, the mycoplasma with unknown concentration in clinical samples or experimental cell samples is detected. The clinical samples are randomly grouped, and electrochemical, mycoplasma culture and PCR detections are carried out simultaneously to confirm the mycoplasma type and concentration. Subsequently, the blinding is lifted, and the anti-interference ability, recovery rate and specificity of the sensor in clinical samples are compared. And through a large number of clinical samples, the accuracy and stability of the sensor are verified. The experimental results prove that the method of the embodiments of the present invention has high accuracy and stability.

[0154] In summary, the present invention prepares an electrode modified with hollow conductive polymer nanorods, captures mycoplasma single-stranded ssDNA through a common mycoplasma fragment, further designs and combines primers containing an electrochemical indicator amplified by plasmonic nanostars, and realizes the quantitative detection of trace mycoplasma through the sandwich DNA hybridization method. And on this basis, different mycoplasma primers are bound to different electrochemical signals to realize the simultaneous quantitative detection of different mycoplasmas. Finally, the early high-specific diagnosis of Mycoplasma pneumoniae infection, urogenital tract infection and laboratory mycoplasma contamination is realized. The research of the present invention will also provide a new way for the accurate diagnosis of related mycoplasma infection diseases including Mycoplasma pneumoniae infection.

[0155] The embodiments of the present invention have been described in detail above with reference to the drawings, but the present invention is not limited to the above embodiments. Various changes can be made without departing from the spirit of the present invention within the knowledge scope of those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Sequence Listing <110> Shanghai Tenth People's Hospital <120> An Electrochemical Biosensor for Detecting Mycoplasma and a Method for Detecting Mycoplasma <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <400> 1 tggtgcatgg ttgtcgtcag ctcgtgtcgt gagatgtt 38 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 actccatgtg gagcggtaaa 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 ctcacgacac gagctgacg 19 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 gtaaacctag agtgtagtag ggagt 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 acatctcacg acacgagctg a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 cggaattcca tgtgaagcgg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 catctcacga cacgagctga 20 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 tatcagtcta gagtgtggta gggag 25 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <400> 9 aacatctcac gacacgagct ga 22 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <400> 10 ttaatctaga gtgtggtagg gagt 24 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <400> 11 aacatctcac gacacgagc 19

Claims

1. An electrochemical biosensor for mycoplasma detection, comprising: A nanorod electrode and a plasmonic gold nanostar material, wherein a nucleic acid sequence such as the first sequence shown in SEQ ID NO.1 is connected to the surface of the nanorod electrode, and an electrochemical indicator and a second sequence are connected to the plasmonic gold nanostar material; Wherein, the second sequence is a specific primer for the designed product of Mycoplasma; Wherein, the plasmonic gold nanostar material is prepared by the following method: Mix chloroauric acid with silver nitrate, add ascorbic acid for reduction to obtain plasmonic gold nanosphere particles; The plasmonic gold nanosphere particles are modified with cysteamine to obtain amino-functionalized gold nanospheres, and then connected to the activated electrochemical indicator through an amide reaction. Then, the gold nanospheres - electrochemical indicator are carboxylated with 3-mercaptopropionic acid, and after activation, they are connected to the second sequence to obtain the final plasmonic gold nanostar material.

2. The electrochemical biosensor according to claim 1, characterized in that, The nanorod electrode has a hollow conductive polymer material, and is connected to the first sequence through the hollow conductive polymer material.

3. The electrochemical biosensor according to claim 2, characterized in that, The nanorod electrode is prepared by the following method: A gold electrode is used to prepare zinc oxide nanorods by chronopotentiometry in a zinc oxide solution; The zinc oxide nanorods are polymerized and deposited with a conductive polymer by cyclic voltammetry to obtain an electrode modified with polymer nanorods; The electrode modified with polymer nanorods is placed in hydrochloric acid to remove the zinc oxide template to obtain a hollow conductive polymer modified electrode; The carboxyl groups on the surface of the hollow conductive polymer modified electrode are activated and then connected to the first sequence through an amide reaction to obtain the final nanorod electrode.

4. The electrochemical biosensor according to claim 1, wherein, The electrochemical indicator includes at least one of ferrocene, methylene blue, anthraquinone, methyl viologen, and nile blue.

5. The electrochemical biosensor according to claim 1, characterized in that, The nucleic acid sequence of the specific primer includes at least one group among i to v: i. SEQ ID NO.2 and SEQ ID NO.3; ii. SEQ ID NO.4 and SEQ ID NO.5; iii. SEQ ID NO.6 and SEQ ID NO.7; iv. SEQ ID NO.8 and SEQ ID NO.9; v. SEQ ID NO.10 and SEQ ID NO.

11.

6. The electrochemical biosensor according to claim 1, wherein The Mycoplasma includes at least one of Mycoplasma pneumoniae, Mycoplasma hyorhinis, Ureaplasma urealyticum, Mycoplasma hominis, and Mycoplasma genitalium.

Citation Information

Patent Citations

  • DNA sensor for detecting staphylococcus aureus as well as preparation method and application of DNA sensor

    CN104630869A

  • Carbon fiber cloth / poly (3, 4-ethylenedioxythiophene) nanotube composite material and preparation method thereof

    CN111627717A

  • High-sensitivity biosensor as well as manufacturing method and application thereof

    CN112362715A