KASP molecular marker, detection method and application of wheat powdery mildew resistance gene PmYF267

Abstract

The invention discloses a KASP molecular marker, a detection method and an application of a wheat powdery mildew resistance gene PmYF267, and belongs to the field of molecular breeding technology. The KASP molecular markers tightly linked to the wheat powdery mildew resistance gene PmYF267 are 7AK-685 and 7AK-697, and the above two molecular markers are co-localized with the wheat powdery mildew resistance gene PmYF267 on the long arm of wheat chromosome 7A, and are co-separated with PmYF267. Compared with conventional molecular markers, the molecular markers provided by the present invention can not only efficiently, accurately and high-throughput detect the genetic mapping population of PmYF267, but also be applied to the positioning and cloning of PmYF267, as well as high-throughput molecular marker-assisted selection, so as to realize high-throughput screening of the disease resistance gene PmYF267 in a large breeding population in a short time, and can effectively improve the efficiency of molecular breeding of wheat powdery mildew resistance.

Description

Technical Field

[0001] The present invention belongs to the field of wheat molecular biotechnology and breeding applications, and specifically relates to a KASP molecular marker for detecting wheat powdery mildew resistance gene PmYF267, a detection method and an application thereof. The present invention can provide a new gene resource for wheat powdery mildew resistance breeding; the KASP molecular marker tightly linked to PmYF267 can be used for molecular marker-assisted selection breeding of powdery mildew resistance genes. Background Art

[0002] Wheat is one of the three major grain crops in my country. High-quality, green and high-yield wheat has great practical and strategic significance for ensuring national food security and sustainable agricultural development. Wheat powdery mildew is a fungal disease caused by Blumeria graminis f.sp.tritici (Bgt) of the Poaceae family. It can cause wheat leaves to wilt, easy lodging, insufficient grain filling and quality deterioration. It has become the main disease in my country's wheat production. With the changes in cultivation patterns such as high nitrogen and dense planting, as well as high temperature and rainy climate changes, the degree of damage caused by wheat powdery mildew has intensified. Practice has proved that the selection and use of disease-resistant varieties is an economical and effective way to prevent and control wheat powdery mildew.

[0003] Mining and identifying disease-resistant genes is the key to breeding powdery mildew-resistant varieties. Although there are many reported wheat powdery mildew resistance gene loci, there are few resistance sources that can actually be used for disease-resistant breeding. On the one hand, many disease-resistant genes come from closely related species of wheat. When disease-resistant genes are introduced into the wheat background, they will carry some exogenous redundant genes, which often have an adverse effect on wheat agronomic and quality traits. On the other hand, most disease-resistant genes are specialized resistance to physiological subspecies of pathogens. Long-term and large-scale use of a single resistance source will accelerate the variation of the dominant subspecies of pathogens, leading to the loss of resistance of disease-resistant genes. In my country, genes such as Pm2, Pm4, and Pm8 have different degrees of resistance loss in major wheat regions, especially the loss of resistance of Pm8, which has led to another round of wheat powdery mildew outbreaks. In the wheat regions of the middle and lower reaches of the Yangtze River and the southwestern wheat regions, the number of disease-resistant varieties bred using Pm21 has increased sharply, and there is a risk of over-use. Therefore, continuously mining new disease-resistant genes and analyzing their mechanisms of action are of great significance for the rational use of resistance sources and broadening the genetic basis of wheat.

[0004] Thanks to the rapid development of wheat genomics, genome sequencing of wheat crops such as common wheat, Urartu wheat, Aegilops tauschii, wild emmer wheat, and durum wheat has been completed one after another. At the same time, it has also promoted the development of wheat SNP (Singlenucleotide polymorphism) chip high-throughput sequencing technology, which has greatly promoted the mining of wheat functional genes. The rich SNP site information has greatly promoted the efficiency of DNA variation detection and molecular marker development, especially the third-generation KASP (Kompetitive Allele Specific PCR, KASP) molecular marker based on SNP. KASP technology is a method based on the specific matching of primer end bases in the PCR process to achieve SNP / Indel (Insertion-deletion) typing. It can accurately perform double allele typing, avoid the cumbersome screening process of traditional molecular markers, and has the advantages of high efficiency and high throughput, which provides great convenience for gene mining, cloning and molecular marker-assisted breeding.

[0005] 'Yang YF267' is a high-quality, high-yield, multi-resistant new wheat variety bred by the Lixiahe Agricultural Science Research Institute in Jiangsu Province. It is immune to local mixed powdery mildew strains throughout its growth period. 'Yang 09DPBZ-2', which is highly susceptible to powdery mildew, is also a high-quality strong-gluten wheat variety bred by the Lixiahe Agricultural Science Research Institute in Jiangsu Province. A large-scale genetic segregation population was constructed by hybridizing Yang 09DPBZ-2 and Yang YF267. Through exon capture sequencing analysis of extremely resistant and susceptible mixed pools, a major powdery mildew resistance gene was detected on chromosome 7A, named "PmYF267". This locus originated from the powdery mildew resistant parent Yang YF267. Therefore, the development of tightly linked markers for PmYF267 is of great significance to improve the selection efficiency of this gene in wheat powdery mildew resistance breeding. Summary of the invention

[0006] The purpose of the present invention is to provide a powdery mildew resistance gene PmYF267 from the common wheat line 'Yang YF267', which can provide a new gene resource for wheat powdery mildew resistance breeding.

[0007] Another object of the present invention is to provide a KASP molecular marker that is tightly linked to PmYF267.

[0008] The third aspect of the present invention is to provide the application of the KASP molecular marker tightly linked to the wheat powdery mildew resistance gene PmYF267.

[0009] The purpose of the present invention is achieved by the following technical solutions:

[0010] The wheat powdery mildew resistance gene PmYF267 comes from the powdery mildew resistant common wheat line 'Yang YF267'. The gene is located on the long arm of wheat chromosome 7A. The physical position of the Chinese Spring reference genome V2.0 is 685-697Mb. The localization interval is a chromosome recombination inhibition region. The resistance of PmYF267 to wheat powdery mildew is immunity throughout the growth period. The present invention provides the use of the wheat powdery mildew resistance gene PmYF267 in wheat powdery mildew resistance breeding.

[0011] The invention provides molecular markers tightly linked to the wheat powdery mildew resistance gene PmYF267, which are 7AK-685 and 7AK-697. The two molecular markers are co-localized with the wheat powdery mildew resistance gene PmYF267 on the long arm of wheat chromosome 7A and co-segregated with PmYF267.

[0012] The molecular marker 7AID-667 provided by the invention and closely linked to the wheat powdery mildew resistance gene PmYF267 has a polymorphism of C / T, and the polymorphism of 7AK-697 has a polymorphism of G / A.

[0013] The molecular marker 7AK-685 tightly linked to the wheat powdery mildew resistance gene PmYF267 provided by the present invention is obtained by PCR amplification of three primers with nucleotide sequences as shown in SEQ ID NOs. 1 to 3. The three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are respectively modified with different fluorescent groups; the nucleotide sequences of the three primers are respectively shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 (the underlined part is the sequence of the fluorescent group):

[0014] SEQ ID NO.1: GAAGGTGACCAAGTTCATGCT GCTTGTCTGCATCTCTCGATT

[0015] SEQ ID NO.2: GAAGGTCGGAGTCAACGGATT GCTTGTCTGCATCTCTCGATC

[0016] SEQ ID NO.3: CTTTGGGGCGCGTGCAAT

[0017] The present invention provides a KASP molecular marker 7AK-697 closely linked to the wheat powdery mildew resistance gene PmYF267, which is obtained by PCR amplification of three primers with nucleotide sequences as shown in SEQ ID NOs. 3 to 5. The three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are respectively modified with different fluorescent groups; the nucleotide sequences of the three primers are respectively shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6 (the underlined part is the sequence of the fluorescent group):

[0018] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCT TCTCAGAATTTTGGCCATCTCAG

[0019] SEQ ID NO.5: GAAGGTCGGAGTCAACGGATT TCTCAGAATTTTGGCCATCTCAA

[0020] SEQ ID NO.6: GCTTGACCATGCGTGTTTGA

[0021] The specific primer combination provided by the invention for detecting the KASP molecular marker 7AK-685 tightly linked to the wheat powdery mildew resistance gene PmYF267 comprises primers with nucleotide sequences as shown in SEQ ID NOs. 1-3.

[0022] The specific primer combination provided by the present invention for detecting the molecular marker 7AK-697 tightly linked to the wheat powdery mildew resistance gene PmYF267 contains primers with nucleotide sequences as shown in SEQ ID NOs. 4-6.

[0023] The use of the above-mentioned KASP molecular marker or the above-mentioned specific primer combination in at least one of (1) to (3):

[0024] (1) Detect, locate and clone the wheat powdery mildew resistance gene PmYF267;

[0025] (2) Molecular marker-assisted selection breeding for the powdery mildew resistance gene PmYF267 in wheat;

[0026] (3) Identify or breed wheat varieties resistant to powdery mildew.

[0027] A method for detecting the wheat powdery mildew resistance gene PmYF267, using the above molecular markers, or the above specific primer combination to determine the genotype of the wheat sample to be tested:

[0028] ① If the allele of KASP molecular marker 7AK-685 is CC, it is a disease-resistant genotype carrying homozygous PmYF267. If the allele is C / T, it is a disease-resistant genotype carrying heterozygous PmYF267. If the allele is TT, it is a disease-susceptible genotype not carrying PmYF267.

[0029] ② If the allele of KASP molecular marker 7AK-697 is AA, it is a disease-resistant genotype carrying homozygous PmYF267. If the allele is A / G, it is a disease-resistant genotype carrying heterozygous PmYF267. If the allele is GG, it is a disease-susceptible genotype not carrying PmYF267.

[0030] The above method for detecting the wheat powdery mildew resistance gene PmYF267 specifically comprises the following steps:

[0031] (1) extracting genomic DNA from wheat leaves to be tested as a template;

[0032] (2) using the specific primer combinations of the KASP molecular markers 7AK-685 and 7AK-697 to perform PCR amplification on the genomic DNA of the sample to be tested to obtain amplification products;

[0033] (3) Centrifuge the amplified product and observe the bottom of the PCR reaction plate to ensure that there are no bubbles;

[0034] (4) Scan the genotype of the PCR amplification product using a fluorescent quantitative PCR instrument (ABI Vii) and read the fluorescent signal at 35°C.

[0035] (5) Data genotype analysis of the scan results was performed using TaqManGenotyper v1.3.1;

[0036] (6) Determine the genotype of the wheat sample to be tested according to the genotyping of polymorphic loci.

[0037] In the above step (2), the amplification reaction system includes: 10-20 ng / μL DNA 1.0 μL, HiGeno 2×Probe Mix 5 μL, primer mixture 0.112 μL, ddH2O 3.89 μL, and the total system is 10 μL.

[0038] The method for preparing the specific primer combination into a primer mixture is to mix the upstream primer 1, the upstream primer 2, and the downstream primer, all of which have a primer concentration of 100 μM, with ddH2O in a volume ratio of 12:12:30:46 to obtain a primer mixture.

[0039] The PCR amplification program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, gradient annealing at 65°C and extension for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 1°C in each cycle; denaturation at 95°C for 20 s, annealing at 57°C and extension for 60 s, for a total of 33 cycles.

[0040] A method for identifying or breeding wheat varieties resistant to powdery mildew, characterized in that the above-mentioned molecular markers or the above-mentioned specific primer combination are used to determine the genotype of the wheat sample to be tested, and the disease-resistant wheat variety carrying the gene PmYF267 is selected:

[0041] ① If the allele of KASP molecular marker 7AK-685 is CC, it is a disease-resistant genotype carrying homozygous PmYF267. If the allele is C / T, it is a disease-resistant genotype carrying heterozygous PmYF267. If the allele is TT, it is a disease-susceptible genotype not carrying PmYF267.

[0042] ② If the allele of KASP molecular marker 7AK-697 is AA, it is a disease-resistant genotype carrying homozygous PmYF267. If the allele is A / G, it is a disease-resistant genotype carrying heterozygous PmYF267. If the allele is GG, it is a disease-susceptible genotype not carrying PmYF267.

[0043] Beneficial effects of the present invention:

[0044] (1) Good resistance to powdery mildew: The present invention discloses for the first time a powdery mildew resistance gene PmYF267 from a new common wheat line 'Yang YF267', which is located on the long arm of wheat chromosome 7A. PmYF267 is immune to wheat powdery mildew throughout the growth period. This gene has a high utilization value in wheat powdery mildew resistance breeding.

[0045] (2) High accuracy: The present invention discloses molecular markers 7AID-667 and 7AK-697 linked to the wheat powdery mildew resistance gene. The above two molecular markers are flanking markers of the disease resistance gene PmYF267 and are closely linked. In the breeding process, PCR amplification is performed using a specific primer combination of the above markers, and the accuracy of molecular marker-assisted selection of the powdery mildew resistance gene PmYF267 is high.

[0046] (3) High detection throughput: The linked molecular marker disclosed in the present invention is a KASP marker, which can get rid of the limitation of gel electrophoresis and has a high detection throughput. In molecular marker-assisted breeding, disease-resistant plants can be quickly screened out, thereby improving breeding efficiency.

[0047] (4) Co-dominant markers: The linked molecular markers disclosed in the present invention are co-dominant markers that can distinguish between homozygous and heterozygous disease resistance loci with high resolution, and are more accurate in fine positioning, map-based cloning, and molecular marker-assisted breeding of the wheat powdery mildew resistance gene PmYF267. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is the powdery mildew resistance performance of Yang YF267 and Yang 09DPBZ-2 at the seedling and adult plant stages.

[0049] Figure 2 The figure shows the location of the wheat powdery mildew resistance gene PmYF267 on chromosome 7AL in Example 1.

[0050] Figure 3 This is the physical map of the wheat powdery mildew resistance gene PmYF267 in Example 2.

[0051] Figure 4 The genotyping diagram of wheat samples detected by KASP molecular markers 7AK-685 and 7AK-697 in Example 3;

[0052] Among them, A is the genotyping map of wheat samples detected by KASP molecular marker 7AK-685; B is the genotyping map of wheat samples detected by KASP molecular marker 7AK-697. DETAILED DESCRIPTION

[0053] In order to make the purpose, technical scheme and excellent effect of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. Without departing from the spirit and essence of the present invention, the modification or replacement of the method, steps or conditions of the present invention all belong to the scope of the present invention. If not specifically indicated, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0054] The biological material sources in the present invention are:

[0055] ① Both Yang YF267 and Yang 09DPBZ-2 are new high-yield and high-quality wheat lines bred by the Lixiahe Agricultural Science Research Institute in Jiangsu Province. Yang YF267 has a broad spectrum of resistance to wheat powdery mildew throughout the growth period, while Yang 09DPBZ-2 is highly susceptible to wheat powdery mildew ( Figure 1 ). Yang YF267 and Yang 09DPBZ-2 were sent to the Yangzhou Branch of the National Wheat Improvement Center for disease resistance identification in the 2021-2022 growing season. The wheat varieties and identification results have been published on the website of the Yangzhou Branch of the National Wheat Improvement Center (http: / / www.wheat.org.cn / fzx / index.asp). A large-scale genetic segregation population was constructed by hybridizing Yang YF267 and Yang 09DPBZ-2.

[0056] ② Wheat exon capture: The latest wheat reference genome (IWGSC RefSeq v2.1) and annotation information (IWGSC Annotation v2.1) are used, which has high probe design and capture accuracy. 10Gb data volume was used for sequencing analysis, the average sequencing depth reached more than 32x, 98% of the target regions had a uniformity greater than 10%, and the actual detection CDS coverage was greater than 97%. It has been tested and verified on major wheat varieties, and the test results are stable and fully compatible with SNP / Indel-rich hexaploid wheat varieties. Exon capture sequencing analysis in this study was completed by Boredi Biotechnology Co., Ltd.

[0057] Example 1 Discovery of the Powdery Flake Resistance Gene PmYF267 in Poppy YF267

[0058] 1. Identification of wheat powdery mildew resistance

[0059] Powdery mildew resistance was identified by artificial inoculation indoors, with the highly susceptible wheat variety Yangmai 15 as the susceptible control. The F2 population of "Yang YF267×Yang 09DPBZ-2" was inoculated with powdery mildew at the seedling stage and the adult stage. When the susceptible control Yangmai 15 was fully diseased, the disease resistance phenotype of the test material was recorded. The leaves without visible powdery mildew spores were recorded as resistant (R), and the leaves with powdery mildew spores were recorded as susceptible (S).

[0060] 2. Genome-wide disease resistance site scanning

[0061] According to the powdery mildew resistance identification results of the "Yang YF267×Yang 09DPBZ-2" F2 population, 100 extremely resistant plants and 400 extremely susceptible plants were selected to construct resistant and susceptible mixed pools, respectively, and exon capture sequencing was performed in combination with resistant and susceptible parents. According to the frequency of the resistant parent genotype in the resistant and susceptible mixed pools, the ΔSNP-index of the whole genome SNP loci was calculated. The chromosome position of the SNP with a ΔSNP-index greater than 0.8 was selected as the candidate interval for disease resistance, and finally a significantly enriched region ( Figure 2 ).

[0062] Example 2 Encryption of genetic map and acquisition of tightly linked molecular markers

[0063] 1. Development of KASP molecular markers

[0064] In order to encrypt the physical map and obtain molecular markers closely linked to the powdery mildew resistance gene PmYF267, the online platform PolyMaker website (http: / / polymarker.info / ) was used to design KASP for candidate SNPs based on the SNP information obtained by exon capture sequencing in the PmYF267 positioning interval, and then chromosome-specific markers were selected from them. For the designed KASP marker sequence, a FAM or HEX fluorescent linker sequence was added to the 5' end of the two upstream primers, where the FAM fluorescent linker sequence was 5'-GAAGGTGACCAAGTTCATGCT-3', and the HEX fluorescent linker sequence was 5'-GAAGGTCGGAGTCAACGGATT-3'. All primers in this example were synthesized by Nanjing Qingke Biological Co., Ltd.

[0065] 2. Polymorphism screening of KASP molecular markers

[0066] The extremely disease-resistant and extremely susceptible families from the parental Yang YF267, Yang 09DPBZ-2, and the "Yang YF267×Yang 09DPBZ-2" F2 population were selected for polymorphic molecular marker screening.

[0067] 3. Acquisition of tightly linked molecular markers 7AK-685 and 7AK-697

[0068] The polymorphic KASP molecular markers obtained by screening were used to perform genotyping on the F2 population of "Yang YF267×Yang 09DPBZ-2". Combined with the powdery mildew phenotypic identification data of the F2 population, the encrypted physical map of the powdery mildew resistance gene PmYF267 was obtained. The gene PmYF267 was further located between KASP markers 7AK-685 and 7AK-697, and the physical position of the Chinese Spring reference genome V2.0 version was 685–697Mb ( Figure 3 ).

[0069] Example 3 Application of KASP molecular markers 7AK-685 and 7AK-697 in selecting powdery mildew resistance gene PmYF267

[0070] 1. Based on the phenotypic data of powdery mildew resistance identification, 40 extremely resistant families and 40 extremely susceptible families were selected from the "Yang YF267×Yang 09DPBZ-2" RIL population.

[0071] 2. KASP molecular marker amplification was performed on the DNA of the selected 80 families, the two parents Yang YF267 and Yang 09DPBZ-2, and Yang YF267 / Yang 09DPBZ-2F1. The specific method was as follows:

[0072] (1) extracting genomic DNA from the above materials as a template;

[0073] (2) using the specific primer combinations of KASP molecular markers 7AK-685 and 7AK-697 to perform PCR amplification on the genomic DNA of the sample to be tested to obtain amplification products;

[0074] The specific primer combination for detecting the KASP molecular marker 7AK-685 closely linked to the wheat powdery mildew resistance gene PmYF267 contains primers with nucleotide sequences as shown in SEQ ID NO.1 to 3:

[0075] SEQ ID NO.1: GAAGGTGACCAAGTTCATGCT GCTTGTCTGCATCTCTCGATT

[0076] SEQ ID NO.2: GAAGGTCGGAGTCAACGGATT GCTTGTCTGCATCTCTCGATC

[0077] SEQ ID NO.3: CTTTGGGGCGCGTGCAAT

[0078] The specific primer combination for detecting the molecular marker 7AK-697 closely linked to the wheat powdery mildew resistance gene PmYF267 contains primers with nucleotide sequences as shown in SEQ ID NOs. 4 to 6:

[0079] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCT TCTCAGAATTTTGGCCATCTCAG

[0080] SEQ ID NO.5: GAAGGTCGGAGTCAACGGATT TCTCAGAATTTTGGCCATCTCAA

[0081] SEQ ID NO.6: GCTTGACCATGCGTGTTTGA

[0082] (3) The specific primer combination in the above step (2) is prepared into a primer mixture according to the following method: the upstream primer 1, the upstream primer 2, and the downstream primer, all of which have a primer concentration of 100 μM, are mixed with ddH2O in a volume ratio of 12:12:30:46 to obtain a primer mixture.

[0083] (4) The amplification reaction system for PCR amplification is: 10-20 ng / μL DNA 1.0 μL, HiGeno 2×Probe Mix 5 μL, primer mixture 0.112 μL, ddH2O 3.89 μl, the total system is 10 μl.

[0084] (5) The PCR amplification program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, gradient annealing and extension at 65°C for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 1°C in each cycle; denaturation at 95°C for 20 s, annealing and extension at 57°C for 60 s, for a total of 33 cycles.

[0085] (6) Centrifuge the amplified product and observe the bottom of the PCR reaction plate to ensure that there are no bubbles;

[0086] (7) Scan the genotype of the PCR amplification product using a fluorescent quantitative PCR detector (ABI Vii) and detect the fluorescence signal at 35°C;

[0087] (8) Data genotype analysis of the scan results was performed using TaqManGenotyper v1.3.1;

[0088] (9) According to the polymorphic site genotyping, the genotype of the sample to be tested is determined. The genotyping results are shown in Figure 4 :

[0089] ① If the allele of KASP molecular marker 7AK-685 is CC, it is a disease-resistant genotype carrying homozygous PmYF267. If the allele is C / T, it is a disease-resistant genotype carrying heterozygous PmYF267. If the allele is TT, it is a disease-susceptible genotype not carrying PmYF267.

[0090] ② If the allele of KASP molecular marker 7AK-697 is AA, it is a disease-resistant genotype carrying homozygous PmYF267. If the allele is A / G, it is a disease-resistant genotype carrying heterozygous PmYF267. If the allele is GG, it is a disease-susceptible genotype not carrying PmYF267.

[0091] Table 2 Correspondence between genotypes and powdery mildew resistance phenotypes of 80 wheat samples

[0092]

[0093]

[0094]

[0095] The experimental results show that among the 80 samples, the genotypes and disease resistance performances correspond one to one (Table 2), that is, the markers 7AK-685 amplified as CC genotypes and 7AK-697 amplified as AA genotypes are all disease-resistant phenotypes (R), and the markers 7AK-685 amplified as TT genotypes and 7AK-697 amplified as GG genotypes are all susceptible phenotypes (S). The above results show that the KASP molecular markers 7AK-685 and 7AK-697 of the wheat powdery mildew resistance gene of the present invention can be used to track the powdery mildew resistance gene PmYF267, and have high detection throughput and are easy to realize automation, which is conducive to improving the efficiency of breeding work for powdery mildew resistance.

[0096] The above embodiments are only preferred embodiments of the present invention and are not intended to limit the present invention. Any non-substantial modifications or changes made to the above embodiments by those skilled in the art without violating the spirit and scope of the present invention shall fall within the scope of protection claimed by the present invention.

Claims

1. Genes related to wheat resistance to powdery mildew PmYF267 The tightly linked KASP molecular marker is characterized by: The KASP molecule is labeled 7AK-685 and 7AK-697 , the KASP molecular marker 7AK-685 and 7AK-697 and genes PmYF267 Colocalized on the long arm of wheat chromosome 7A and PmYF267 co-isolation; The KASP molecular marker 7AK-685 The polymorphism of is C / T; the KASP molecular marker 7AK-697 The polymorphism is G / A; The KASP molecular marker 7AK-685 It is obtained by amplification using the following three primers, wherein the three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are modified with different fluorescent groups respectively; the nucleotide sequences of the three primers are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively; The KASP molecular marker 7AK-697 It was obtained by amplification with the following three primers, wherein the three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are modified with different fluorescent groups respectively; the nucleotide sequences of the three primers are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 respectively.

2. The specific primer combination of KASP molecular marker according to claim 1, characterized in that: 7AK-685 The nucleotide sequences of the primers are as shown in SEQ ID NO. 1 to 3; 7AK-697 The nucleotide sequences of the primers are shown in SEQ ID NOs. 4 to 6.

3. Use of the KASP molecular marker according to claim 1 or the specific primer combination according to claim 2 in at least one of (1) to (3): (1) Detection, localization and cloning of wheat powdery mildew resistance genes PmYF267 ; (2) Used for assisted selection breeding of wheat powdery mildew resistance traits; (3) Identify or breed wheat varieties resistant to powdery mildew.

4. A method for detecting wheat powdery mildew resistance genes PmYF267 The method is characterized in that The KASP molecular marker described in claim 1 or the specific primer combination described in claim 2 is used to determine the genotype of the wheat sample to be tested: ①KASP molecular marker 7AK-685 If the allele is CC, then the carrier is homozygous PmYF267 Disease resistance genotype, if the allele is C / T, it is heterozygous PmYF267 If the allele is TT, then the genotype is not resistant. PmYF267 susceptible genotype; ②KASP molecular marker 7AK-697 If the allele is AA, then it is homozygous. PmYF267 Disease resistance genotype, if the allele is A / G, it is heterozygous PmYF267 If the allele is GG, then it does not carry the disease-resistant genotype. PmYF267 susceptible genotype.

5. The method according to claim 4, characterized in that The following steps are involved: (1) Extract genomic DNA from wheat leaves to be tested as a template; (2) Using the KASP molecular marker 7AK-685 and 7AK-697 PCR amplification is performed on the genomic DNA of the sample to be tested using the specific primer combination to obtain the amplified product; (3) Centrifuge the amplified product and observe the bottom of the PCR reaction plate to ensure there are no bubbles; (4) Scan the genotype of the PCR amplification product using a fluorescent quantitative PCR instrument and read the fluorescent signal at 35°C; (5) Data genotype analysis of the scanning results was performed using TaqManGenotyper v1.3.1; (6) Determine the genotype of the wheat sample according to the genotyping of polymorphic loci.

6. A method for identifying or breeding wheat varieties resistant to powdery mildew, characterized in that: The KASP molecular marker according to claim 1 or the specific primer combination according to claim 2 is used to determine the genotype of the wheat sample to be tested, and the wheat sample carrying PmYF267 Disease-resistant wheat samples: ①KASP molecular marker 7AK-685 If the allele is CC, then the carrier is homozygous PmYF267 Disease resistance genotype, if the allele is C / T, it is heterozygous PmYF267 If the allele is TT, then the genotype is not resistant. PmYF267 susceptible genotype; ②KASP molecular marker 7AK-697 If the allele is AA, then it is homozygous. PmYF267 Disease resistance genotype, if the allele is A / G, it is heterozygous PmYF267 If the allele is GG, then it does not carry the disease-resistant genotype. PmYF267 susceptible genotype.

Images