A method for creating a temperature-sensitive female sterile rice material

Abstract

The application discloses a kind of creation methods of temperature-sensitive female sterility rice materials, it is related to the technical field of germplasm resource creation, comprising the following steps: S1, using map-based cloning technology, the mutant gene of temperature-sensitive female sterility rice is cloned, and the mutant gene is rice AGO7 gene, and the mutation position of rice AGO7 gene is at the Link2 domain of AGO7 protein;S2, using CRISPR gene editing technology, the target site is designed in the Link2 domain of this gene;S3, using the target sequence of target site to construct vector, the vector is transformed into the gene of rice variety Minghui 63 and Nipponbare rice, and the gene is edited;S4, screening temperature-sensitive female sterile plant, i.e. the temperature-sensitive female sterility rice material created by the present application.The creation method of the temperature-sensitive female sterility rice material has important scientific significance for the reproductive development of rice, female sterility mechanism research, and also has very important practical significance in promoting the development of rice hybrid seed production technology.

Description

Technical Field

[0001] This invention relates to the field of germplasm resource creation technology, specifically to a method for creating temperature-sensitive female-sterile rice materials. Background Technology

[0002] Since the 1970s, hybrid rice has been rapidly and widely promoted in my country, playing a significant role in increasing grain production. In recent years, the annual planting area of ​​hybrid rice has reached approximately 15.5 million hectares. 2 Hybrid rice accounts for about 50% of the total rice planting area and 60% of the total rice yield, playing a significant role in increasing grain production. Hybrid rice is mainly divided into three-line and two-line hybrids, both utilizing the cross between male-sterile lines and restorer lines for seed production. my country's hybrid rice seed production technology has reached full maturity after more than 40 years of research and development; however, due to the self-pollination of restorer lines during seed production, the parent lines of existing hybrid rice (three-line or two-line) hybrid combinations are difficult to mechanize for seed production, resulting in problems such as high labor intensity, low seed production efficiency, difficulty in controlling seed quality, and unstable seed yield. Furthermore, with the large-scale migration of young and middle-aged laborers from rural areas, the elderly and women are generally unable to adequately undertake seed production tasks, leading to a reduction of more than 300,000 mu (approximately 20,000 hectares) of hybrid seed production area nationwide in recent years. Therefore, further improving hybrid rice seed production technology and achieving full mechanization of hybrid rice seed production is the only way to improve hybrid rice seed production efficiency.

[0003] In the early 1990s, Maruyama et al. (1991) first proposed the idea of ​​using male- and female-sterile parent lines for mixed seed production. However, due to the limitations of technology and experimental materials at the time, the idea of ​​using female-sterile lines for mechanized seed production was not realized. Although many female-sterile rice lines have been discovered in the past thirty years, the application of female-sterile materials in mixed seed production has stagnated due to the difficulty in obtaining female-sterile offspring seeds. In recent years, breeders have used transgenic methods to maintain female-sterile materials and have carried out small-scale mixed seed production, achieving a yield increase of more than 40% (Zhang Dewen et al., 2007; Cao Mengliang et al., 2014). Compared with other mechanized technologies, mechanized seed production using female-sterile lines has the advantages of lower cost, higher seed yield, and higher purity. Once female-sterile restorer lines are developed, large-scale mixed sowing and harvesting can be achieved, enabling the production of hybrid rice seeds to shift from labor-intensive to technology-intensive, combining agricultural machinery and agronomy. Therefore, further research on female sterile rice materials, especially photoperiod- and temperature-sensitive female sterile materials, is not only of great scientific significance in revealing the mechanism of rice fertility regulation, but also has great application prospects in hybrid rice seed production.

[0004] Similar to male sterility in rice, female sterility is widespread (Yokoo, 1984; Ling et al., 1991), mainly caused by abnormal development of tissues and organs such as the ovary, embryo sac, and embryo. Based on different mutation sites, rice female sterility can be divided into three categories. The first category is female sterility caused by incomplete pistils or the complete absence of a pistil (Ling et al., 1991). The second category is female sterility caused by the obstruction of ovule or megaspore development, resulting in the absence of a normal embryo sac in the pistil, i.e., embryo sac abortion (Rim et al., 1998). The last category of female sterility involves a complete pistil and embryo sac, but the embryo fails to develop normally after pollination (Bouharmont et al., 1985; Li et al., 2006). Female sterility in rice was discovered as early as the 1950s (Oka, 1957), but due to its limitations in production, research on female sterility in rice is still in its early stages. Especially in the study of molecular mechanisms, due to factors such as the difficulty in observing female sterility, the scarcity of pure female sterility mutant materials, and the complexity of the causes of female sterility, research on female sterility in rice lags far behind that on male sterility in rice.

[0005] Early research on rice female-sterile mutants mainly focused on mutant isolation and cytological observation. With the refinement of the rice whole genome sequence and the rapid development of gene localization and cloning methods, reports on the localization, cloning, and functional analysis of rice female-sterile genes have increased, laying a foundation for the preliminary elucidation of the mechanism of rice female sterility (Guan Wenxiang et al., 2017). Rice female sterility was first discovered in hybrids of indica and japonica rice or between cultivated and wild rice (Ikehashi and Araki, 1984). For example, gene cloning and localization of the hybrid offspring of indica rice IR24 and japonica rice Asominori revealed that three genes, located on different parents, control the fertility of the hybrid offspring, and that epistasis determines the occurrence of female sterility (Kubo and Yoshimura, 2005). To date, 18 loci associated with female sterility in rice hybrids have been identified, and most of these loci contain multiple alleles. Only the genes of the S5 and S7 loci have been cloned (Chen et al., 2008; Yang et al., 2012; Yu et al., 2016), indicating that our research on the mechanism of female sterility caused by hybridization has only just begun.

[0006] Mutations in many genes related to pistil development can cause female sterility (Shi and Yang, 2011). For example, mutations in the zinc finger protein gene OsJAG can lead to the differentiation of stamens into pistils, while mutations in the rice FON1 and FON2 genes regulate pistil development through the same pathway, resulting in enlarged floral meristems and an increased number of floral organs (Suzaki et al., 2006; Duan et al., 2010). Ovules, located inside the ovary, are the female reproductive organs of rice, and the embryo sac is the core structure within the ovule. Abnormal development of the ovule and embryo sac is a major cause of female sterility. Studies on sfs1 female-sterile materials have found that their sterility is caused by abnormally proliferating cells blocking the micropyle, preventing fertilization. A gene encoding the DL (Drooping Leaf) protein was cloned using map-based cloning technology. In the mutant, the 26th amino acid residue of this protein was changed from Val to Ala, leading to female sterility (Qu et al., 2012). Analysis of the rice T-DNA insertion mutant osmads13 showed that OsMADS13 is a gene specifically expressed in ovules and plays an important regulatory role in the development of flower meristems and ovule formation (Dreni et al., 2007; Yamaki et al., 2011). Meiosis and mitosis of the female gametophyte, which affect embryo sac development, can lead to abnormal embryo sac development. For example, the OsPAIR gene affects meiosis in male and female gametes by influencing chromosome pairing and synapsis, resulting in sterility in both sexes (Nonomura et al., 2004). The OsAPC6 gene encodes an APC6 protein. Loss of its function may inactivate the holoenzyme involved in the transition from metaphase to anaphase of mitosis, leading to a reduction in dividing cells and ultimately causing partial female sterility (Awasthi et al., 2012). OsDEES1 belongs to the WAK-RLKs (cell wall-associated kinase-receptor kinase) class of genes in rice and is expressed in the nucellar region. RNA interference with this gene does not affect the formation of functional megaspores, but after formation, normal mitosis occurs, resulting in embryo sac degeneration or the formation of empty embryo sacs, leading to female sterility (Wang et al., 2012). Furthermore, the inability of pollen tubes to reach the embryo sac after germination on the pistil can also cause female sterility. Li et al. (2006) discovered a mutant, fs-202R, in the indica rice 202R population. While its pollen grains and octetal embryo sac developed normally, abnormal pollen tube elongation prevented pollen from entering the embryo sac, hindering double fertilization and leading to spikelet sterility. This demonstrates that genes regulating the development of various parts of the rice pistil and at different developmental stages have been successively located and cloned, laying the foundation for elucidating the mechanism of female sterility.

[0007] Male-sterile lines are the core of hybrid rice, with "two-line" hybrid rice, centered on photoperiod- and temperature-sensitive male-sterile lines, marking a new stage in the development of hybrid rice in my country. The cloning of photoperiod- and temperature-sensitive male-sterile genes further solidified the leading position of male sterility mechanism research in hybrid rice (Ding et al., 2012; Zhou et al., 2012). However, unlike these lines, the female-sterile rice lines we have discovered to date are not photoperiod- and temperature-sensitive female-sterile lines. Furthermore, obtaining homozygous sterile seeds from these lines is extremely difficult, making it challenging to use them for fully mechanized seed production. Therefore, further research into photoperiod- and temperature-sensitive female-sterile rice materials and their mechanisms of action is particularly urgent and important.

[0008] To this end, the inventors of this application obtained a rice sterile material from the field (which is a naturally mutated rice plant (thermothermally sensitive female sterile rice), the mutation manifests as female sterility and is sensitive to temperature; low-temperature treatment can partially restore its fertility (it has been patented in China with publication number CN108967181A)). Using cold irrigation cultivation technology, they further discovered that this germplasm belongs to a thermosensitive male sterile rice germplasm (e.g., Figure 1 (As shown); its self-pollinated offspring were all sterile plants, belonging to homozygotes; when it was crossed with normal indica rice material (wild type), no F1 seeds were produced when it was used as the female parent, but F1 seeds were produced when it was used as the male parent, and the pollen fertility and stigma fertility of the F1 generation were normal. The F2 generation showed a segregation ratio of female sterile plants to normal fertile plants of 1:3. It is speculated that this temperature-sensitive female sterility trait is controlled by a single recessive nuclear gene (named OsTFS1).

[0009] Therefore, the present invention aims to provide a method for creating temperature-sensitive female-sterile rice materials, in order to solve the problem that in the prior art, it is very difficult to obtain homozygous sterile seeds of offspring from female-sterile lines, making it difficult to achieve fully mechanized seed production. Summary of the Invention

[0010] The purpose of this invention is to solve the above-mentioned problems and provide a method for creating temperature-sensitive female-sterile rice materials.

[0011] To achieve the above objectives, the technical solution of the present invention is as follows: A method for creating temperature-sensitive female-sterile rice materials, comprising the following steps:

[0012] S1. Using map-based cloning technology, locate and clone the mutant gene of temperature-sensitive female sterile rice. The mutant gene is the rice AGO7 gene, and the mutation site of the rice AGO7 gene is located in the Link2 domain between the PAZ domain and the MID domain of the AGO7 protein.

[0013] S2. Using CRISPR gene editing technology, target sites were designed in the Link2 domain of the rice AGO7 gene;

[0014] S3. Construct a vector using the target sequence of the target site described in step S2, and transform the constructed vector into the genes of rice varieties Minghui 63 and Nipponbare rice to edit their genes;

[0015] S4. Based on step S3, screen for temperature-sensitive female sterile plants, which are the created temperature-sensitive female sterile rice materials.

[0016] Furthermore, in step S1, the C at the 1087th base of the rice AGO7 gene coding sequence is changed to A, causing the codon at that position to change from CTT to ATT, and the leucine at position 603 of the AGO7 protein sequence to be changed to isoleucine.

[0017] Furthermore, the temperature-sensitive female sterile strains screened in step S4 are mutant strains with isoleucine mutation at position 603 of the AGO7 protein or strains with serine deletion at position 605 of the AGO7 protein.

[0018] Compared with existing technologies, the beneficial effects of this solution are:

[0019] 1. Based on the characteristics of the thermosensitive female sterility trait single recessive nuclear gene (tfs1 mutant gene), the method of the present invention cloned the thermosensitive female sterility gene using map-based cloning technology, designed a target site in the Link2 domain of the gene using gene editing technology, constructed a vector using the target sequence of the target site, and then transferred the vector into varieties such as Minghui 63 and Nipponbare for gene editing, and isolated the edited non-transgenic materials, successfully creating thermosensitive female sterile rice materials, which facilitates the provision of thermosensitive female sterile restorer lines for the realization of fully mechanized seed production;

[0020] 2. The method of this invention can not only successfully create temperature-sensitive female sterile rice materials, but also has important scientific significance for the study of rice reproductive development and female sterility mechanism. At the same time, it has very important practical significance in promoting the development of rice hybrid seed production technology. Attached Figure Description

[0021] Figure 1 It is a thermosensitive female sterile rice (a is a wild-type rice 4266 panicle, b is a thermosensitive female sterile rice mutant that recovers some fertility under low temperature, and c is a thermosensitive female sterile rice mutant that is completely sterile under high temperature).

[0022] Figure 2 This is the AGO7 protein sequence in the embodiments of the present invention;

[0023] Figure 3This is the functional domain of the AGO7 protein in the embodiments of the present invention;

[0024] Figure 4 This refers to the AGO7 gene sequence and CRISPR target site selection in this embodiment of the invention;

[0025] Figure 5 In this embodiment of the invention, gene editing of Minghui 63 rice was used to create a temperature-sensitive female sterile material;

[0026] Figure 6 The gene-edited Nipponbare rice used in this invention creates a temperature-sensitive female-sterile material. Detailed Implementation

[0027] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be described in further detail below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.

[0028] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0029] Example:

[0030] like Figures 1 to 6 As shown, a method for creating a temperature-sensitive female-sterile rice material includes the following steps:

[0031] Step 1: Using map-based cloning technology, locate and clone the mutant gene of temperature-sensitive female-sterile rice. The mutant gene is the rice AGO7 gene, and the mutation site of the rice AGO7 gene is located in the Link2 domain (e.g., between the PAZ domain and the MID domain of the AGO7 protein). Figure 3 (As shown); the C is changed to A at the 1087th base of the coding sequence of the rice AGO7 gene, resulting in the codon at that position changing from CTT to ATT, and the leucine (Leu) at position 603 of the AGO7 protein sequence is changed to isoleucine (Ile) (as shown). Figure 2 As shown, this is the sequence of the AGO7 protein. The gray box represents the Link2 domain of the AGO7 protein. The L in the box represents leucine at position 603, and the first S from left to right in the box represents serine at position 605.

[0032] Step 2: Using CRISPR gene editing technology, design target sites in the Link2 domain of the rice AGO7 gene; for example... Figure 3As shown, it is the functional domain of the AGO7 protein, the gray arrow indicates the location of the mutated amino acid, and L2 is the Link2 domain.

[0033] Step 3: Utilize the target sequence of the target site described in Step 2 (target sequence such as...) Figure 4 As shown, Figure 4 To select the AGO7 gene sequence and CRISPR target sites (underlined parts indicate target site sequences, with bolded 'c' indicating the mutation location of the thermosensitive female sterile plant), a vector was constructed and transformed into the genes of rice varieties Minghui 63 and Nipponbare rice. The genes were then edited (PCR amplification and sequencing were used to detect whether editing had occurred). A mutant with a leucine mutation at position 603 of the AGO7 protein was obtained using Minghui 63 as the background. This mutant also exhibited female sterility, and low-temperature culture partially restored its fertility. This indicates that this gene editing method successfully created a thermosensitive female sterile mutant in Minghui 63. Figure 5 As shown, this is a temperature-sensitive female-sterile material created through gene editing in the Minghui 63 rice variety. Figure 5 Figure a shows the rice ears of Minghui 63. Figure 5 b represents the ear of a temperature-sensitive female-sterile mutant strain of Minghui 63 edited by CRISPR. Figure 5 c represents the ears of partially restored fertility of the Minghui 63 thermosensitive female sterile plant after low-temperature culture.

[0034] Step 4: Based on Step 3, screen for temperature-sensitive female-sterile plants, which are the created temperature-sensitive female-sterile rice materials. The screened temperature-sensitive female-sterile plants are either mutants of the AGO7 protein with a leucine mutation at position 603 (isoleucine) or mutants with a serine deletion at position 605 of the AGO7 protein.

[0035] In this embodiment, two mutation types were screened through gene editing of Nipponbare rice. The first is the isoleucine mutation at position 603, which is the same as that in Minghui 63, and also exhibits temperature-sensitive female sterility. Figure 6 (ac). Another type of mutation is the deletion of serine residue 605 in the AGO7 protein; this deletion also leads to the female infertility phenotype. For example... Figure 6 As shown, this is a temperature-sensitive female-sterile material created through gene editing of Nipponbare rice. Figure 6 Image a: Japanese rice ears (from Japan) Figure 6 b represents the CRISPR-edited, temperature-sensitive, female-sterile mutant strain of *Spiritia alata* from *Nipponbare*. Figure 6 c represents the ears of partially restored fertility from Nipponbare temperature-sensitive female sterile plants after low-temperature culture. Figure 6 d represents the female-sterile mutant strain of Nipponbare AGO7 protein with serine deletion at position 605.

[0036] In this embodiment, the specific method for editing the rice AGO7 gene and constructing the vector using CRISPR / Cas9 technology is as follows:

[0037] 1. Target site selection

[0038] Design target sequences according to the website: https: / / crispr.dbcls.jp / , and it is best to select target points at the ORF-5' end or functional structural domain. Design target points for AGO7:

[0039] Target sequence + PAM: aaattaaagcttggcagcagtgg

[0040] 2. Target connector design

[0041] Rice was designed using the OsU6a promoter. If the first 'G' in the upstream sequence of NGG is G, it is a conventional target, and G is removed, resulting in a 19nt SG sequence + ...; if the first 'G' in the upstream sequence of NGG is not G, it is an unconventional target, and no deletion or reduction is performed, resulting in a 20nt SG sequence + ...

[0042] The gRT#+T1# primer is:

[0043] Target sequence +gttttagagctagaaat

[0044] The OsU6aT#-T# primer is:

[0045] Target sequence reverse complementary strand +CGGCAGCCAAGCCAGCA;

[0046] Based on the above principles, the AGO7 target adapter primers were designed as follows (the 3' end of the target primer pairs with the U6a promoter and sgRNA):

[0047] gRT#+AGO7# primer:

[0048] aaattaaagcttggcagcaggttttagagctagaaat

[0049] OsU6aT#-AGO7# primer:

[0050] CTGCTGCCAAGCTTTAATTTCGGCAGCCAAGCCAGCA;

[0051] 3. Knockout vector construction

[0052] 1) First round of PCR

[0053] Use 2-5 ng of OsU6a (ampicillin resistance) plasmid as a template. Four primers are used in one reaction:

[0054] UF and gRT#+AGO7, 0.2 μM each;

[0055] OsU6aT#-AGO7# and gR-R, 0.1 μM each.

[0056] The annealing temperature was 58℃. During amplification, UF / U#T#- amplified the U#-T# sequence, and gR-R / gRT#+ amplified the T#-sgRNA sequence. The primer sequences for UF and gR-R are as follows:

[0057] UF:CTCCGTTTTACCTGTGGAATCG

[0058] gR-R:CGGAGGAAAATTCCATCCAC

[0059] After amplification, take 10 μL for electrophoresis and run on a gel to determine the band size. Take another 1 μL of the first-round PCR product, dilute it 10-fold, and use it as the template for the second-round PCR.

[0060] 2) Second round of PCR

[0061] Using the PCR product diluted 10-fold from the first round as a template, add 2 μL of U-GAL and Pgs-GAR primers to a 50 μL amplification system. Anneal at 58°C, perform electrophoresis, and then recover the product from the gel. The sequences of the U-GAL and Pgs-GAR primers are as follows:

[0062] U-GA:

[0063] ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGGCAGCAAAGG

[0064] Pgs-GAR:

[0065] TAGCTCCGAGAGGCGCCAATGATACCGACGCGTATCCATCCACTCCAAGTCTTG.

[0066] 3) Vector enzyme digestion and ligation

[0067] Add 1 μL of 5000U BsaI enzyme and approximately 2 μg of Cas9 plasmid to a 50 μL digestion system. Digest at 37°C for 30 min, run on a gel electrophoresis gel, and recover the plasmid. Ligate the purified product from the second round of PCR with the digestion product using homologous recombination.

[0068] 4) Transformation using recombination and knockout vectors

[0069] (1) Take 10 μL of the ligation product and add it to DH5α Escherichia coli competent cells and incubate on ice for 30 min.

[0070] (2) Heat shock at 42℃ for 45 seconds, then immediately ice bath for 2-3 minutes.

[0071] (3) Add 800 μL of LB liquid medium without resistance, and incubate at 37°C and 220 rpm for 30 min.

[0072] (4) Centrifuge at 5000 rpm for 5 min, discard part of the supernatant, keep 100 μL of culture medium to resuspend the bacteria, spread the bacterial solution evenly on kanamycin resistant (Kan) solid medium, and incubate at 37°C inverted for 12–16 h.

[0073] 5) PCR identification of bacterial culture

[0074] (1) Pick several single clones, add 200ul kanamycin-resistant liquid culture medium, and incubate at 37℃ and 230rpm until the bacterial solution becomes turbid.

[0075] Take 2 μL of bacterial culture as a template, add U-GAL and Pgs-GAR as primers, anneal at 58℃ for 27 cycles, and perform bacterial culture PCR identification. The band size is 629 bp. Select positive clones, perform sequencing, and if the sequencing is correct, shake the culture to preserve it and extract plasmids.

[0076] In the above embodiments of the present invention, the method of the present invention cloned the temperature-sensitive female sterility gene using map-based cloning technology, designed a target site in the Link2 domain of the gene using gene editing technology, constructed a vector using the target sequence of the target site, and then transferred the constructed vector containing the TFs1 mutant gene into excellent restorer lines such as Minghui 63 and Nipponbare for gene editing, and isolated the edited non-transgenic material, successfully creating temperature-sensitive female sterile rice material, which facilitates the provision of temperature-sensitive female sterile restorer lines for the realization of fully mechanized seed production.

[0077] The above specific embodiments are merely explanations of the present invention and are not intended to limit the present invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. A method for creating a temperature-sensitive female-sterile rice material, characterized by: Includes the following steps: S1. Using map-based cloning technology, locate and clone the mutant gene of temperature-sensitive female sterile rice, wherein the mutant gene is the rice AGO7 gene, and the sequence of the rice AGO7 gene is SEQ ID No.2, and the mutation position of the rice AGO7 gene is located in the Link2 domain between the PAZ domain and the MID domain of the AGO7 protein. S2. Using CRISPR gene editing technology, target sites were designed in the Link2 domain of the rice AGO7 gene; S3. Construct a vector using the target sequence of the target site described in step S2, and transform the constructed vector into the genes of rice varieties Minghui 63 and Nipponbare to edit the genes; the gene editing is to change C to A at the 1087th base of the coding sequence of the rice AGO7 gene, causing the codon at that position to change from CTT to ATT, and to change leucine at position 603 of the AGO7 protein sequence to isoleucine; S4. According to step S3, screen for temperature-sensitive female sterile plants, which are the created temperature-sensitive female sterile rice materials; the screened temperature-sensitive female sterile plants are mutants of isoleucine at position 603 of the AGO7 protein.

Images