A gene silencing method for endoparasitic wasps

Abstract

The present invention discloses a method for gene silencing of tiny endoparasitic wasps by a nano-drip method of piercing the pupa with a needle and dripping the dsRNA inside the shell. The method of the present invention cleverly uses the pupa shell, the protective cover of the insect before it is about to emerge, to drip dsRNA by piercing the pupa shell, and then penetrate into the insect body with the help of nanomaterials, thereby providing a gene interference method for a class of insects that are tiny, internally parasitic, and cannot be effectively injected, and also provides a new way for other insects to carry out related technical research.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a gene silencing method for endoparasitic wasps. Background Art

[0002] RNA interference (RNAi) refers to the introduction of specific homologous double-stranded RNA (dsRNA) into cells to silence the expression of target genes or reduce their expression levels. Caenorhabditis elegans After the existence of RNAi was discovered and confirmed in humans, RNAi technology began to be widely used in the functional research of key genes in different research fields such as medicine and agriculture.

[0003] RNAi has been used as a method to regulate gene expression in many organisms and has achieved excellent results. Drosophila melanogaster(Ledford H. Fly library boosts gene toolsupply. Nature, 2007,448: 115; Grosjean et al., A glial amino-acid transportercontrols synapse strength and courtship in Drosophila. Nature Neuroscience, 2007,11: 54-61) and many non-model insects (Soberón et al., Engineering modified Bttoxins to counter insect resistance. Science, 2007, 318: 1640-1642; Xu et al., Synergistic action of the gut microbiota in environmental RNA interference in a leaf beetle. Microbiome, 2021, 9: 98; Ma et al., Nitric oxide synthase is required for the pea aphid's defense against bacterial infection. InsectMolecular Biology, 2022, doi: 10.1111 / imb.12823), the application of RNAi technology is effective and specific. Although gene editing technology has been developed, there are still some insect species that cannot be edited for various reasons such as small size and difficulty in operation. Therefore, RNAi technology is still an important method used for reverse genetics in most studies.

[0004] Insect RNAi interference technology is a technology for studying the functions of important candidate genes in insects. The key to successfully achieving insect RNAi efficiency is to select appropriate dsRNA introduction methods according to different insect species. In insect RNAi research, commonly used methods include microinjection, feeding, and immersion. Spodoptera litura (Zou et al., Glutathione S-transferase SlGSTE1 in Spodoptera lituramay be associated with feeding adaptation of host plants. Insect Biochem. Mol. Biol., 2016, 70: 32-43), Helicoverpa armigera Helicoverpa armigera (Sivakumar et al., Knockdown of aminopeptidase-N from Helicoverpa armigera larvae and in transfected Sf21 cells by RNA interference reveals its functional interaction with Bacillus thuringiensis insecticidal protein Cry1Ac. Journal of Biological Chemistry, 2007, 282: 7317-7319), Plutella xylostella Plutella xylostella (Li et al., Silencing β-1,3-glucan binding protein enhances the susceptibility of Plutella xylostellato entomopathogenic fungus Isaria cicadae. Pest Manag. Sci., 2022, 78(7): 3117-3127) and other insects that have successfully established a system for inducing RNAi by injecting dsRNA. However, for insects with smaller individuals, the injection method requires high operating skills and is difficult (Zhu et al., Mechanisms, applications, and challenges of insect RNA interference. Annu. Rev. Entomol., 2020, 65: 293-311), which is usually difficult to achieve. The immersion method is a method of inducing RNAi by directly immersing the test material in a dsRNA solution of the candidate gene. This method is also called extracellular RNAi. Obviously, insects are not suitable for the immersion method. The feeding method usually mixes dsRNA with insect feed and achieves the purpose of RNA interference through the insects' active feeding, digestion and absorption. The feeding method for insect RNA interference has the advantages of saving labor, time and operation (Tian et al., Transgenic cotton plants expressing double-stranded RNAs target HMG-CoAreductase(HMGR) gene inhibits the growth, development and survival of cotton bollworms.Int. J. Biol. Sci., 2015, 11(11):1296-1305), and it is not easy to cause mechanical damage to relatively small insects, thereby improving the survival rate (Yang et al., MAPK-directed activation of the whitefly transcription factor CREB leads to P450-mediated imidacloprid resistance. PNAS, 2020, 117(19):10246-10253), which is also more conducive to subsequent experiments. However, it is obvious that for certain insects, the feeding method also has its shortcomings that are difficult to overcome. First, if the individual insects do not eat, the purpose of RNA interference cannot be achieved; second, each insect consumes feed according to its own hunger level and feeding needs, so the amount of dsRNA consumed is inconsistent, which will lead to huge differences in interference efficiency between individuals.

[0005] Aphid wasp Encarsia formosaBelonging to the family Aphelinidae of the order Hymenoptera, it is an endoparasitic wasp that parasitizes whitefly pests. The female wasp lays eggs in the body of the whitefly nymph, and after hatching, it feeds on the nymph, eventually causing the nymph to die. The whitefly wasp has been widely used in the prevention and control of whitefly pests in protected crops such as vegetables and flowers, and has achieved excellent control effects, becoming a global model of biological control (Liu et al., Whitefly parasitoids: distribution, life history, bionomics, and utilization. Annu. Rev. Entomol., 2015, 60: 273-292; Wang Yubo et al., The control effect of the whitefly wasp and supporting measures combined with control technology on greenhouse whiteflies. Hebei Agricultural Science, 2015, 19(2): 36-40, 55). In order to study the functions of olfactory-related genes, venom proteins, immune genes and other related genes for searching and locating hosts of the Aphididae ensiformis, it is necessary to use RNAi technology to carry out relevant research. However, the adult Aphididae ensiformis is small in size, good at flying, and cannot be fixed. Its egg and larval stages live in the nymphs of the host whitefly, which are not conducive to the implementation of its RNAi technology. Some studies have used feeding methods to perform RNA interference on insects, but the uncertainty of feeding often leads to unstable interference results. Moreover, to date, there has been no relatively mature research report on RNAi technology for the Aphididae ensiformis. Undoubtedly, this is closely related to the characteristics of the Aphididae ensiformis, such as its small size (adult body length is about 0.5 mm), fragile body wall, parasitism in the host body, and difficulty in microinjection, which has greatly hindered the in-depth study of the functional genes of this parasitic wasp. Therefore, it is extremely important to study and establish a set of RNA interference technologies and methods suitable for endoparasitic wasps, which are easy to operate and relatively stable, for studying the functions of key genes in pests. Summary of the invention

[0006] Aiming at the small individual characteristics of endoparasitic wasps, the present invention has established a set of RNA interference technology and methods suitable for endoparasitic wasps, which can be easily operated and relatively stable, and is of great significance for studying the functions of key genes of pests.

[0007] The present invention provides a method for gene silencing of an endoparasitic wasp, comprising the following steps:

[0008] (1) Preparing the drip solution: Designing and synthesizing dsRNA according to the sequence of the target gene, and using the nanomaterial solution to dilute the dsRNA of the target gene to the final concentration to obtain a dsRNA mixed solution;

[0009] (2) Selecting bee pupae: Inspect the pupae of the endoparasitic wasp under a microscope and select the pupae of the Aphididae bees with the same physiological state;

[0010] (3) Preparation of needle tube: Make the tip of the capillary glass needle tube with an inclination angle of 10-20 degrees;

[0011] (4) Absorbing the drip solution: Injecting the dsRNA mixture into the capillary glass needle;

[0012] (5) Breaking the pupa with a needle: Use a capillary glass needle to poke the pupa shell of the aphid wasp of the appropriate age.

[0013] (6) Injection into bee pupae: The dsRNA mixture is dripped into the pupa shell through a small hole pierced by a capillary glass needle.

[0014] (7) Constant temperature culture: Place the pupae of the endoparasitic wasp in an incubator and culture them until they emerge.

[0015] Preferably, in step (2), the abnormal pupae cases, such as those that are shriveled, empty, deformed, not parasitized, and those with their backs facing downward and abnormal postures, are carefully removed using a dissecting needle.

[0016] Another preferred embodiment is characterized in that the capillary glass tube in (3) is obtained by drawing using a P-97 micropipette needle puller, and the needle tip is processed using an EG-401 microgrinder needle grinder so that the needle tip has a tilt angle of 1-16 degrees.

[0017] More specifically, in step (4), a 10 ml Eppendorf Microloader pipette tip is used to absorb the dsRNA mixture and then slowly inject it into the drawn glass syringe.

[0018] Preferably, the piercing position in step (5) is the epidermis in the middle and lower part of the back of the pupa shell, and care should be taken not to pierce the insect body inside the shell.

[0019] Specifically, the amount of the dsRNA mixture injected in step (6) is such that the droplet does not submerge the body of the Aphididae, and specifically, the droplet volume for a single pupa is about 50 nL.

[0020] In a specific embodiment, the endoparasitic wasp is aphid wasp. Preferably, in (7), the endoparasitic wasp pupae are placed in an artificial climate incubator with a temperature of 26 ± 1°C, a humidity of 60 ± 5%, and a light cycle of 16 h: 8 h (L: D) and cultured until they emerge.

[0021] Based on the above experiments, the present invention has established a method for gene silencing of tiny endoparasitic wasps by a nano-drip method of piercing the pupa with a needle and dripping inside the shell. The drip solution contains nanomaterials and dsRNA of the target gene. Silencing for 48 h or 72 h at a concentration of 500 ng / mL of dsRNA drip solution can effectively reduce the gene expression, so as to conduct subsequent gene function research. The method is simple to operate, has a low mortality rate of test insects, and can save time and the number of test insects. Compared with the microinjection method, since the needle contacts the insect shell rather than the insect body, the mortality rate of the test insect can be significantly reduced; at the same time, since the drawn glass tube does not need to be pierced into the insect body, no body fluid flows in, thus avoiding a series of problems caused by needle blockage and frequent replacement of glass tubes.

[0022] The method of the present invention cleverly uses the pupa shell, the protective cover of the insect before it emerges, to puncture the pupa shell, drip dsRNA, and then use nanomaterials to penetrate into the insect body, thereby providing a gene interference method for a class of insects that are tiny, internally parasitic, and cannot be effectively injected, and also provides ideas and inspiration for other insects to carry out related technical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the RNAi technology process for the pupae of the Aphididae using the nano-drip method.

[0024] Figure 2 Electrophoresis of the full-length sequence amplification of OBP26 of Aphididae. Lane M: Mark Ⅰ; Lane 1: OBP26.

[0025] Figure 3 RNAi results of Aphididae. A is 500 ng / L dsRNA; B is 1000 ng / L dsRNA. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific embodiments, but is not intended to limit the present invention.

[0027] 1 Test materials

[0028] The Aphididae was obtained from Shandong Lubao Technology Development Co., Ltd. The nanomaterial SPC solution was kindly provided by Professor Shen Jie of China Agricultural University. RNAprep pure micro-total RNA extraction kit (DP420) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) was purchased from TaKaRa; PROMEGA dsRNA synthesis kit was purchased from Promega (Beijing) Biotechnology Co., Ltd.; FastFireqPCR PreMix (SYBR Green) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0029] 2 Primer design

[0030] Based on the sequence of the target gene OBP26 gene (GenBank accession number QDJ95969) of the Aphididae rapae obtained in previous studies, the dsRNA primers were designed. The specific steps are as follows: First, copy the aligned sequencing results to ORF Finder (https: / / www.ncbi.nlm.nih.gov / orffinder / ) to predict its ORF region, and enter the ORF region into the website http: / / www.flyrnai.org / cgi-bin / RNAi-find-primers.pl), select the product length between 300-600 bp, click Finder, Primers for these sequences to filter out a pair of primers with a lower Pair Penalty. Second, add the T7 promoter sequence TAATACGACTCACTATAGGGAGA to the 5' end of the upstream and downstream primers respectively. The primers used to synthesize the target gene dsOBP26 and the control dsEGFP are shown in Table 1.

[0031] Table 1 Primer sequences used in dsRNA synthesis and fluorescence quantitative PCR of target genes and control genes

[0032]

[0033] RNAprep pure micro total RNA extraction kit (TIANGEN) was used for total RNA extraction of Aphididae. 50-60 adult Aphididae were taken and placed in a homogenizer. The total RNA extraction kit (DP420) was used for extraction according to the instruction manual. The purity and concentration of total RNA were tested by agarose gel electrophoresis and Nanodrop 2000 UV spectrophotometer.

[0034] cDNA synthesis was performed as follows. 10 μL of mixed solution (2 μL of 5×gDNA Eraser Buffer, 1 μL of gDNA Eraser, 1 μg of total RNA from Aphididae, and finally supplemented to 10 μL with RNase Free ddH2O) was prepared in a microcentrifuge tube; the mixed solution was reacted at 42°C for 2 min, and then placed at 4°C; 1 μL of PrimeScript RTEnzyme Mix I, 4 μL of RT Primer Mix, and 4 μL of 5×PrimeScript Buffer were added to each 10 μL of the mixed reaction solution, and finally supplemented to 20 μL with RNase Free ddH2O, and the reverse transcription reaction solution was slowly mixed; incubated at 37°C for 15 min, and then placed at 85°C for 5 sec; and finally stored at 4°C.

[0035] The cDNA of the Aphididae was used as a template and amplified in the following reaction system and reaction program. The PCR reaction system: 2×Es TaqMasterMix (Dye) 25 μL, upstream primer and downstream primer (10 μmol / L) 1.25 μL each, cDNA template 2.5 μL, and ddH2O was used to make up to a total volume of 50 μL. The PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing for 30 s, 72℃ extension for 30 s, 30 cycles; and finally 72℃ extension for 30 s. After the amplification reaction was completed, 8 μL of the amplified product was taken for electrophoresis detection on 1.5% agarose gel, and the fragments with the same size as the expected target band were recovered and purified, and Beijing Qingke Biotechnology Co., Ltd. was commissioned for sequencing. After the sequence was verified, the dsRNA synthesis kit AmpliScribe™ T7-Flash™ Transcription Kit (Promega) was used for subsequent dsRNA synthesis.

[0036] Use a sterilized RNA-specific PCR tube and follow the instructions of the AmpliScribe™ T7—Flash™ Transcription Kit to add 1 μg of linear template DNA with a promoter, 2 μL of 10×Transcription Reaction Buffer, 1.8 μL of ATP / CTP / GTP / UTP (each), 2 μL of 100 mM DTT, 0.5 μL of RiboGuard RNase Inhibitor, and 2 μL of T7 RNA Polymerase, and make up to a total volume of 20 μL with RNase-free water. Incubate at 37°C for 30 min, place at room temperature for 10 min, and slowly cool to form dsRNA; then add RNase-Free DNase I and incubate at 37°C, centrifuge, rinse, etc. to synthesize dsOBP26 and dsEGFP, and use Nanodrop to measure the concentration before use.

[0037] The RNAi experiment of Aphididae was carried out by nano-drip method. The test insects used were Aphididae pupae that were expected to emerge within 24-48 hours. The drip solution was a mixture of nanomaterials (Star polycation, SPC) (Shen et al., 2021) and dsRNA. The Aphididae were divided into two groups. The treatment group was dripped with dsRNA solution, and the control group was dripped with dsEGFP solution. Three replicates were set for each treatment group, and 150-200 Aphididae were treated in each replicate.

[0038] The interference test was performed using an SZX10 microscope (Olympus, Japan) and an InjectMan 4 microinjector (Eppendorf, Hamburg, Germany). The pressure of the microinjector was set to 150 hPa, and the injection time and anti-absorption pressure were set to 0.5 s and 5 hPa, respectively. The specific operation process is as follows ( Figure 1 ).

[0039] (1) Preparation of drop solution: Design and synthesize dsRNA according to the sequence of the target gene, and use nanomaterial (Starpolycation, SPC) (Yan et al., Chronic exposure to the star polycation (SPc) nanocarrier in the larval stage adversely impairs life history traits inDrosophila melanogaster. Journal of Nanobiotechnology, 2022, 20(1):515) solution to dilute the dsRNA of the target gene to prepare final concentrations of 500 ng / mL and 1000 ng / mL, respectively.

[0040] (2) Selecting bee pupae: First, examine the pupae of the Aphididae under a microscope, select the pupae with the same physiological state, and carefully remove the abnormal pupae shells such as those that are shriveled, empty, deformed, not parasitized, and those with their backs facing down and abnormal body postures using a dissecting needle.

[0041] (3) Drawing needle tubes: Capillary glass tubes were drawn using a P-97 micropipette needle puller (Sutter Instrument, Novato, CA, USA), and the needle tip was processed using an EG-401 microgrinder (Narishige, Tokyo, Japan) to give the needle tip an inclination angle of about 15 degrees.

[0042] (4) Aspirate the drip solution: Use a 10 ml Eppendorf Microloader pipette tip to aspirate the dsRNA mixture and then slowly inject it into the prepared glass syringe.

[0043] (5) Using a needle to break the pupa: Use a drawn glass needle to carefully poke a hole in the pupa shell of the appropriate age (based on color) of the Aphididae wasp that is about to emerge. The hole should be in the epidermis in the middle and lower part of the back of the pupa shell. Be careful not to pierce the insect body inside the shell.

[0044] (6) Injection into bee pupae: Use a syringe (parameters as above) to drip the mixture of nanomaterials + dsRNA into the small hole of the pupa shell with a drawn glass needle, so that the droplets do not submerge the body of the aphid bee. The injection volume for a single pupa is about 50 nL.

[0045] (7) Constant temperature culture: After all the instillations are completed, mark them and place the pupae of the Aphididae in an artificial climate incubator with a temperature of 26 ± 1°C, a humidity of 60 ± 5%, and a light cycle of 16 h: 8 h (L: D) for culture until they emerge.

[0046] The RNA of the Aphididae was collected 48 h, 72 h and 96 h after the nano-drop method treatment, and the template RNA was quantified at 1 mg for reverse transcription, and then the fluorescence quantitative PCR (qRT-PCR) reaction was performed using the kit FastFire qPCR PreMix (SYBR Green). The reaction program was as follows: 20 μL reaction system: 2×SuperReal PreMix Plus 10 μL, 10 μmol / L upstream and downstream primers 0.5 μL each, 50×ROX Reference Dye 0.4 μL, cDNA template 1 μL, RNAse-FreeddH2O 7.6 μL. The sequences of the primers qOBP26 and the amplification primers of the internal reference genes β-action and GAPDH used in the fluorescence quantitative PCR amplification used in the experiment are shown in Table 1. The reaction program of qRT-PCR was as follows: 95℃ pre-denaturation for 2 min; followed by 95 denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s, for 40 cycles. Three biological replicates were set for each treatment, and the results were detected using QuantStudio3 fluorescence quantitative PCR instrument.

[0047] After the reaction is completed, the fluorescence quantitative PCR results are exported to the Excel program for calculation. -ΔΔCt The expression level of the target gene at different time points was calculated by the method. Interference efficiency = [(expression level of the gene in the control group - expression level of the gene in the treatment group) / expression level of the gene in the control group] × 100%.

[0048] 3. Results and Analysis

[0049] Based on the annotation results of the transcriptome of the Aphididae, the homologous sequences of OBP of other species were compared, and then the cds sequence was found by local blast in the unigene library. The cds sequence was named OBP26. Based on this sequence, specific primers (upstream primer: ATGAATCTTTATTTCGTTTTAATTGCT; downstream primer: TCATATATAAGCCAAAACCATCTGGC) were designed for gene amplification. The PCR amplification procedure was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; and finally 72℃ extension for 30 s. The amplified product was subjected to agarose gel electrophoresis. It can be seen from the figure that the primer has high amplification specificity and the amplified band is single. The sequencing results show that the size is 408 bp ( Figure 2 ).

[0050] The bees were collected 48 h, 72 h and 96 h after the nano-drip method treatment, and RNA was extracted and reverse transcribed into cDNA. Then qPCR was used to verify the efficiency of target gene silencing. The results showed that the expression of OBP26 gene was significantly reduced at each time point after interference. At a concentration of 500 ng / mL, the gene expression at the three time points decreased by 34.49%, 32.31% and 23.90%, respectively ( Figure 3 In the middle A, the silencing effect was relatively stable, while at a concentration of 1000 ng / mL, the gene expression at the three time points decreased by 20.63%, 24.78%, and 19.59%, respectively ( Figure 3 Therefore, in subsequent experiments, it is advisable to choose a 48 h or 72 h silencing at a drip concentration of 500 ng / mL.

Claims

1. A method for gene silencing of an endoparasitic wasp, comprising the following steps: (1) Preparing the drip solution: Designing and synthesizing dsRNA according to the sequence of the target gene, and using the nanomaterial solution to dilute the dsRNA of the target gene to the final concentration to obtain a dsRNA mixed solution; (2) Selecting bee pupae: First, examine the pupae of the endoparasitic wasp under a stereomicroscope and select the pupae of the Aphididae that have the same physiological state. (3) Preparation of needle tube: Make the tip of the capillary glass needle tube with an inclination angle of 10-20 degrees; (4) Absorbing the drip solution: Injecting the dsRNA mixture into the capillary glass needle; (5) Breaking the pupa with a needle: Use a capillary glass needle to poke the pupa shell of the appropriate age of the aphid wasp that is about to emerge, but do not pierce the insect body inside the shell; (6) Injection into bee pupae: The dsRNA mixture is dripped into the pupa shell through a small hole pierced by a capillary glass needle, and the droplets do not submerge the body of the aphid bee. (7) Constant temperature culture: Place the pupae of the endoparasitic wasp in an incubator and culture them at a temperature of 26 ± 1°C, a humidity of 60 ± 5%, and a light cycle of L: D of 16 h: 8 h until they emerge.

2. The method according to claim 1, characterized in that In step (2), the shriveled, empty, deformed, non-parasitized, abnormal pupae cases, and pupae cases with their backs facing downward and abnormal body postures are carefully removed using a dissecting needle.

3. The method according to claim 1, characterized in that The capillary glass tube in (3) is obtained by drawing using a P-97 micropipette needle puller, and the needle tip is processed using an EG-401 microgrinder needle grinder so that the needle tip is made into an inclined angle of 10-20 degrees.

4. The method according to claim 1, characterized in that In step (4), a 10 ml Eppendorf Microloader pipette tip is used to absorb the dsRNA mixture and then slowly inject it into the drawn glass syringe.

5. The method according to claim 1, characterized in that The incision point in step (5) is the epidermis in the middle and lower part of the back of the pupa shell.

6. The method according to any one of claims 1 to 5, characterized in that: The endoparasitic wasp is aphid wasp.

7. The method according to claim 6, characterized in that The amount of dsRNA mixture injected in step (6) is 50 nL per single pupa.

8. The method according to claim 1, characterized in that The gene expression level was further detected by fluorescence quantitative PCR to determine whether gene silencing was successful.

Images