Cloning and application of a tomato transcription factor SlBT1

By cloning the tomato transcription factor SlBT1 and editing the tomato gene using the CRISPR/Cas9 system, the tomato tolerance problem of tomatoes to salt stress was solved, and efficient growth in saline-alkali land was achieved.

CN116218866BActive Publication Date: 2025-08-29HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211424394.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-14
Publication Date
2025-08-29
Estimated Expiration
2042-11-14

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the tolerance of tomatoes to salt stress, which limits the cultivation and expansion of tomatoes in saline-alkali land.

Method used

The tomato transcription factor SlBT1 was cloned, and the tomato gene was edited through the CRISPR/Cas9 system, the CRISPR/Cas9 vector was constructed, and tomato transformation was performed to obtain plants with improved salt tolerance.

Benefits of technology

It significantly improves the tolerance of tomatoes to salt stress, can grow in saline-alkali land, and has high application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116218866B_ABST
    Figure CN116218866B_ABST
Patent Text Reader

Abstract

The present invention discloses a clone of a tomato transcription factor SlBT1 and an application thereof. The clone of the tomato transcription factor SlBT1 can be used in the cultivation of salt-tolerant tomatoes. The cloning of the tomato transcription factor SlBT1 is first performed by obtaining an sgRNA target sequence of the SlBT1 gene; then a CRISPR / Cas9 vector is constructed, including designing sgRNA amplification primers and constructing the vector according to the selected target sequence; and then tomato transformation is performed. After identification of the regenerated plants and salt tolerance determination, experimental results show that under salt stress conditions, the wild type exhibits leaf yellowing and the first to fourth leaves fall off, while the SlBT1-5-23 and SlBT1-1-3 strains exhibit greater salt tolerance. The gene editing of SlBT1 by the present invention can significantly improve the tolerance of tomatoes to salt stress, can be used to prepare saline-alkali soil-resistant tomato materials, and has high application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of salt-tolerant tomato cultivation, and particularly relates to cloning of a tomato transcription factor S1BT1 and application thereof. Background Art

[0002] Genetically modified tomatoes are commercially cultivated in many regions and countries around the world. These tomatoes exhibit traits such as storage tolerance, virus resistance, fungus resistance, insect resistance, herbicide resistance, frost tolerance, salt tolerance, improved quality, and high yield. Tomatoes are one of the most economically profitable vegetables globally. Funded by national scientific and technological projects such as the "863" Program and the "Transgenic Plant Research and Industrialization Special Project," transgenic tomato research has flourished in my country, significantly boosting the tomato industry. Virus-, fungus-, and insect-resistant tomatoes can improve the disease resistance of wild tomatoes; storage-tolerant tomatoes can reduce post-harvest economic losses and balance the supply period; and salt-tolerant tomatoes can expand the range of tomato cultivation and salt tolerance, adapt to harsh soil conditions, improve land utilization, and maintain and increase yields. Therefore, the cultivation of salt-tolerant tomatoes offers high economic benefits. Summary of the Invention

[0003] The purpose of the present invention is to provide a clone of tomato transcription factor S1BT1 and its application, to solve the problems in the prior art, aiming to improve the tolerance of tomatoes to salt stress and to prepare tomato materials resistant to saline-alkali soil.

[0004] To achieve the above object, the present invention provides the following technical solution: a cloning of a tomato transcription factor S1BT1, comprising the following steps:

[0005] 1. Obtaining the sgRNA target sequence of the SlBT1 gene;

[0006] In the Phytozome database, the nucleotide sequence information of the SlBT1 gene was retrieved according to the accession number Solyc03g111710.2, i.e., sequence 1. Sequence 1: The gene is composed of five exons and four introns. The nucleotide sequence of SlBT1 was submitted to the CRISPR-P2.0 online target analysis database.

[0007] Two sgRNA targets in the exon region were selected: target 1: 5'-GTCGAATTCCGGCATTTCAC-3'; target 2: 5'-GCCGCAGAAGAAGCGGAGCT-3';

[0008] 2. Construction of CRISPR / Cas9 vector;

[0009] (1) Design sgRNA amplification primers based on the selected target sequence:

[0010] SlBT1-F: AATCTAACAGTGTAGTTTGGTCGAATTCCGGCATTTCACGTTTTAGAGCTAGAAATAGC;

[0011] SlBT1-R: CTATTTCTAGCTCTAAAACAGCTCCGCTTCTTCTGCGGCCAAACTACACTGTTAGATTC;

[0012] (2) Vector construction:

[0013] Using the plasmid vector CP043 as a template, the forward and backward primers SlBT1-F and SlBT1-R, and the high-fidelity enzyme 2xPhanta® Flash Master Mix were used to amplify the PCR product. The PCR product band size was detected by agarose gel electrophoresis and then purified using a gel recovery kit to obtain a sgRNA nucleotide sequence fragment with the target site. The plasmid vector CP098 was digested with the restriction endonuclease Eco31I, and the success of the digestion was detected by agarose gel electrophoresis. The successfully digested fragment was then recovered using a gel recovery kit. The amplified product and the vector linear fragment were ligated by homologous recombination. The recombinant plasmid was heat-shocked and transformed into Escherichia coli competent cells. Single colonies were picked and shaken, and the bacterial solution was sequenced. The bacterial solution with the correct sequencing results was used to extract the plasmid and transferred into Agrobacterium competent cells GV3101 by the freeze-thaw method.

[0014] 3. Tomato transformation;

[0015] Explant preparation: Before sowing, soak tomato seeds in sterile water for 30 minutes, then disinfect with 75% ethanol for 1 minute, sterilize with 50% sodium hypochlorite solution for 15 minutes, and rinse with sterile water 3-4 times. Sow seeds in 1 / 2 MS medium and culture in a tissue culture room for 7-8 days. Use a sterile scalpel to cut the cotyledons into 2-3 sections. Spread the cut cotyledons on KCMS medium and culture in the dark in a tissue culture room for 1 day.

[0016] Preparation of Agrobacterium infection medium: Inoculate Agrobacterium tumefaciens CP098-S1BT1 onto a solid plate containing LB medium (50 mg / L kanamycin and 35 mg / L rifampicin). After incubation at 28°C for 2-3 days, pick a single colony and inoculate it into liquid LB medium (50 mg / L kanamycin and 35 mg / L rifampicin). Incubate at 28°C, 220 rpm for 16 h. Resuspend the culture in 0.2 MS and dilute to an OD600 of 0.1-0.3 for later use.

[0017] Co-cultivation: Pour 0.2MS suspension into a culture dish, then suspend the cotyledons that have been cultured in the dark for one day in 0.2MS liquid medium, add about 100-300uL of Agrobacterium suspension with OD600 = 0.1-0.3, infect for 3-4 minutes, pour out the bacterial liquid, absorb the bacterial liquid on the cotyledons with sterile filter paper, and place them back on the original KCMS medium and culture in the dark for 2 days;

[0018] Screening: After 2 days of dark culture, the cotyledons were transferred to 2Z medium to produce callus and form buds, and then transferred to 0.2Z medium;

[0019] Obtaining and transplanting regenerated plants: Buds grow on 0.2Z medium to form 1 cm long shoots. At this time, shoots with complete growth points are selected and rooted on R medium. After culturing for 2 weeks, the roots grow to 5-6 cm. After acclimatization for 2 days, the seedlings are transferred to an artificial climate chamber for 1 day, and then transplanted into square pots filled with nutrient soil. After covering and moisturizing for 3-4 days, normal cultivation management is carried out; one transformed tomato seedling is obtained through tomato transformation.

[0020] The present invention also provides an application of the cloned tomato transcription factor S1BT1 for use in the cultivation of salt-tolerant tomatoes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The tomato plants prepared by the present invention were compared with wild-type tomato plants. The results showed that the wild-type showed obvious yellowing and even shedding under salt stress conditions, while the SlBT1-1-3 strain and SlBT1-5-23 prepared by the present invention showed better salt tolerance; the gene editing SlBT1 of the present invention can significantly improve the tolerance of tomatoes to salt stress, and can be used to prepare tomato materials resistant to saline-alkali land, which has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Middle: (a) Sequencing results of gene editing sites in T1 generation plant SlBT1-1-3 line; (b) Sequencing results of gene editing sites in T1 generation plant SlBT1-5-23 line; (c) Phenotypic diagram of T1 generation plants under salt stress conditions.

[0024] Figure 2 Sequence 1: Full-length sequence table of tomato SlBT1 gene. DETAILED DESCRIPTION

[0025] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0026] The experimental materials are as follows:

[0027] Tomato material: Tomato variety Micro Tom;

[0028] Vector: CP043 and CP098 origin;

[0029] Biological reagents: Rapid Plasmid DNA Miniprep Kit and Gel DNA Recovery Kit (Hangzhou Xinjing Biological Reagent Development Co., Ltd.), Escherichia coli competent DH5α and Agrobacterium competent cells GV3101 (Beijing Qingke Biotechnology Co., Ltd.), high-fidelity enzyme 2xPhanta® Flash Master Mix and homologous recombination enzyme ClonExpress Ultra One Step Cloning Kit (Nanjing Novozymes Biotechnology Co., Ltd.), restriction endonuclease Eco31I (BsaI) from Thermo Fisher Scientific, sequencing and primer synthesis were performed at Sangon Biotech (Shanghai) Co., Ltd., and plant genomic DNA was extracted using the CTAB method.

[0030] MS culture medium (including vitamins): Beijing Coolaibo Technology Co., Ltd., product number PM1011-50L;

[0031] MS culture medium (without vitamins): Beijing Coolaibo Technology Co., Ltd., product number PM1010-50L;

[0032] 1 / 2MS solid medium: Dissolve 2.2g of MS medium base salts (with vitamins) and 15g of sucrose in a small amount of distilled water, then dilute to 1L with distilled water, adjust the pH to 5.82, and add 7.4g of agar;

[0033] KCMS solid medium: MS medium base salt (including vitamins), 2,4-Dichlorophenoxyacetic Acid, 0.2 mg / L, Thiamine Hydrochloride, 1.3 mg / L, KH2PO4, 200 mg / L, Kinetin, 0.1 mg / L, Myo-inositol, 100 mg, agar 7.4 g, pH = 5.82;

[0034] 0.2MS suspension: MS culture medium basal salt (without vitamins), Myo-inositol 100 mg / L, thiamine hydrochloride 0.4 mg / L, sucrose 20 g / L, pH = 5.82, agar 7.4 g;

[0035] 2Z solid medium: MS medium basal salt (with vitamins), 3-Indoleacetic acid, 0.1 mg / L, Trans-zeatin Riboside, 2 mg / L, Kanamycin Sulfate, 100 mg / L, Timentin, 360 mg / L, sucrose 30 g, pH = 5.82, agar 7.4 g;

[0036] 0.2Z solid medium: MS medium basal salt (with vitamins), Trans-zeatin Riboside, 0.2 mg / L, Kanamycin Sulfate, 80 mg / L, Timentin, 300 mg / L, sucrose 30 g, pH = 5.82;

[0037] R rooting solid medium: MS medium base salt (containing vitamins), Indole-3-Butytric acid, 2 mg / L, Kanamycin Sulfate, 25 mg / L, Timentin, 360 mg / L, sucrose 30 g, PH=5.82, agar 7.4 g.

[0038] 1. Obtaining the sgRNA target sequence of the SlBT1 gene;

[0039] The nucleotide sequence of the SlBT1 gene was retrieved from the Phytozome database (https: / / phytozome-next.jgi.doe.gov / ) using the accession number Solyc03g111710.2. As shown in Sequence 1, the gene consists of five exons and four introns. The nucleotide sequence of SlBT1 was submitted to the CRISPR-P2.0 online target analysis database (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR). The following parameters were set: PAM sequence was designed as NGG, snoRNA promoter was set to U6, Guide Sequence Length was set to 20, and Target Genome was set to Solanum lycopersicum (SL2.50).

[0040] Finally, two sgRNA targets in the exon region were selected: target 1: 5'-GTCGAATTCCGGCATTTCAC-3'; target 2: 5'-GCCGCAGAAGAAGCGGAGCT-3';

[0041] 2. Construction of CRISPR / Cas9 vector;

[0042] (1) Design sgRNA amplification primers based on the selected target sequence:

[0043] SlBT1-F:

[0044] AATCTAACAGTGTAGTTTGGTCGAATTCCGGCATTTCACGTTTTAGAGCTAGAAATAGC;

[0045] SlBT1-R:

[0046] CTATTTCTAGCTCTAAAACAGCTCCGCTTCTTCTGCGGCCAAACTACACTGTTAGATTC;

[0047] (2) Vector construction:

[0048] Using plasmid vector CP043 as a template, PCR products were amplified using forward and backward primers (SlBT1-F and SlBT1-R) and the high-fidelity enzyme 2xPhanta® Flash Master Mix. The PCR product band size (609 bp) was determined by agarose gel electrophoresis and purified using a gel recovery kit to obtain a sgRNA nucleotide sequence fragment containing the target site. Plasmid vector CP098 was digested with restriction endonuclease Eco31I (BsaI), and successful digestion was confirmed by agarose gel electrophoresis. The digested fragment was then recovered using a gel recovery kit. The amplified product and the vector linear fragment were ligated using homologous recombination (ClonExpress Ultra One Step Cloning Kit). The recombinant plasmid was heat-shocked and transformed into competent Escherichia coli cells (DH5α). Single colonies were picked and shaken, and the culture solution was sequenced. The sequencing results were correct. The culture solution with the correct sequencing results was used to extract the plasmid and then transferred into competent Agrobacterium tumefaciens cells GV3101 by freeze-thaw method.

[0049] 3. Tomato transformation;

[0050] Explant preparation: Before sowing, soak tomato seeds in sterile water for 30 minutes, then disinfect with 75% ethanol for 1 minute, sterilize with 50% sodium hypochlorite solution (25ml sterile water + 25ml household 84 disinfectant) for 15 minutes, rinse with sterile water 3-4 times, sow on 1 / 2MS culture medium, and culture in a tissue culture room (24°C, 16h light / 8h dark) for 7-8 days; cut the cotyledons into 2-3 sections with a sterile scalpel, then spread the cut cotyledons on KCMS culture medium and culture in the dark in a tissue culture room for 1 day;

[0051] Preparation of Agrobacterium infection medium: Inoculate Agrobacterium tumefaciens CP098-S1BT1 onto a solid plate containing LB medium (50 mg / L kanamycin and 35 mg / L rifampicin). After incubation at 28°C for 2-3 days, pick a single colony and inoculate it into liquid LB medium (50 mg / L kanamycin and 35 mg / L rifampicin). Incubate at 28°C, 220 rpm for 16 h. Resuspend the culture in 0.2 MS and dilute to an OD600 of 0.1-0.3 for later use.

[0052] Co-cultivation: Pour 0.2MS suspension into a culture dish, then suspend the cotyledons that have been cultured in the dark for one day in 0.2MS liquid medium, add about 100-300uL of Agrobacterium suspension with OD600 = 0.1-0.3, infect for 3-4 minutes, pour out the bacterial liquid, absorb the bacterial liquid on the cotyledons with sterile filter paper, and place them back on the original KCMS medium and culture in the dark for 2 days;

[0053] Screening: After 2 days of dark culture, the cotyledons were transferred to 2Z medium. After about 2 weeks, a large amount of callus tissue began to form and buds were formed. Then, they were transferred to 0.2Z medium.

[0054] Obtaining and transplanting regenerated plants: When the buds grow on 0.2Z medium for about 2 weeks, young shoots about 1 cm long are formed. At this time, young shoots with complete growth points are selected and rooted on R medium. After culturing for 2 weeks, the roots grow to 5-6 cm. After acclimatization for 2 days, the seedlings are transferred to an artificial climate chamber for 1 day, and then transplanted into square pots filled with nutrient soil. After covering and moisturizing for 3-4 days, normal cultivation and management are carried out. One transformed tomato seedling is obtained through tomato transformation.

[0055] 4. Identification of regenerated plants;

[0056] Extract genomic DNA from the leaves of the regenerated plants and first test whether it contains the exogenous sequence (excluding exogenous sequences outside the tomato genome) Cas9. Then perform PCR amplification using the high-fidelity enzyme 2xPhanta® Flash Master Mix. Only strains containing the Cas9 sequence are likely to have edited the SlBT1 gene. Detection primers:

[0057] Cas9-test-F: ATGGATTACAAGGACCACGAC;

[0058] Cas9-test-R: GAGCCTAGCGGACAGGATAG;

[0059] For strains SlBT1-1 and SlBT1-5 containing the exogenous sequence Cas9, use the following amplification primers:

[0060] CRISPR-SlBT1-F: 5'-CTGTCCCCGCCTTTTGCTT';

[0061] CRISPR-SlBT1-R: 5'-GCTAATGGTCACTTTCTGCTCCA-3';

[0062] The gene-edited plants T0 generation SlBT1-1 and SlBT1-5 were planted in an artificial climate chamber, and T1 generation transgenic seeds were obtained by self-pollination; the T1 generation seeds were further planted, and the T1 strains were identified by PCR and sequencing to obtain the homozygous mutation of the SlBT1 gene without exogenous sequences, and the pure SlBT1-1-3 and SlBT1-5-23 strains were obtained.

[0063] By amplification primers:

[0064] CRISPR-SlBT1-F:5'-CTGTCCCCGCCTTTTGCTT-3';

[0065] CRISPR-SlBT1-R:5'-GCTAATGGTCACTTTCTGCTCCA-3';

[0066] Using the genomic DNA of lines 1 and 5 as templates, PCR amplification was performed with the high-fidelity enzyme 2xPhanta® Flash Master Mix to amplify the SlBT1 gene fragment. The PCR products were then sequenced and the sequencing results were compared with the wild-type tomato SlBT1 gene. It was found that the SlBT1-5-23 line had a homozygous mutation at the target sequence position, with a base T inserted. Figure 1 (a) The SlBT1-1-3 strain has a homozygous mutation at the target sequence, missing three bases GAG, see Figure 1 In (b), these two mutations lead to the loss of function of the SlBT1 protein itself and can be stably inherited to the next generation.

[0067] 5. Salt tolerance determination;

[0068] Salt stress treatment experiments were conducted on tomato gene-edited lines SlBT1-1-3 and SlBT1-5-23 and wild-type tomato MicroTom. The seedlings were planted in an artificial climate chamber at 25°C, 16h light / 8h dark conditions and cultured for 5 weeks. 40 plants of each material with consistent growth were selected and divided into two groups (control group and salt treatment group). One group (20 SlBT1-1-3 lines, 20 SlBT1-5-23 lines and 20 Micro Toms) served as the control and were watered normally. The other group was treated with salt, with 200mM Nacl treatment for the first two weeks and 100mM Nacl treatment for the third week. After three weeks, their phenotypes were observed and photographed. Figure 1 Middle (c).

[0069] The experimental results showed that after 3 weeks of salt stress treatment of SlBT1-1-3, SlBT1-5-23 and wild-type materials, it was found that the first to fourth leaves of the wild-type showed severe shedding under salt stress conditions, while the SlBT1-1-3 and SlBT1-5-23 strains had almost no shedding phenomenon, showing salt tolerance.

[0070] The above results show that gene editing SlBT1 can significantly improve the tolerance of tomatoes to salt stress and can be used to prepare tomato materials that are resistant to saline-alkali land.

[0071] Sequence 1: Figure 2 The full-length sequence of the tomato SlBT1 gene (2628 bp), including: exons (no underline), introns (single underline), and 3'UTR (double underline).

[0072] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. An application of a tomato transcription factor SIBT1, wherein the nucleotide sequence of the transcription factor is shown in Seq id no.

1. The transcription factor is mutated to lose its function and is used for the cultivation of salt-tolerant tomatoes.