A polypeptide for relieving vincristine-induced neuropathic pain and its application
By using the peptide XXW-001 injection to relieve vincristine-induced neuropathic pain, the problem of side effects of existing drugs has been solved, significant analgesic effect and safety have been achieved, and it is suitable for long-term treatment of vincristine-induced pain.
Patent Information
- Application Number
- CN202310203570.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-03
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2043-03-03
AI Technical Summary
Existing drugs for treating vincristine-induced neuropathic pain have side effects such as analgesic tolerance, dependence, respiratory depression, gastrointestinal reactions and hypersensitivity reactions, and are not suitable for long-term administration.
The polypeptide XXW-001 for relieving vincristine-induced neuropathic pain is administered by intrathecal injection. The polypeptide XXW-001 has the amino acid sequence shown in SEQ ID NO: 1 and is dissolved in physiological saline to prepare an injection for treatment.
The peptide XXW-001 significantly alleviates vincristine-induced allodynia. The analgesic effect takes effect within 1 hour and lasts for at least 8-9 hours. It has no significant side effects of depression, anxiety or addiction and is suitable for long-term administration.
Smart Images

Figure CN116253778B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of medical technology, and particularly relates to a polypeptide for alleviating vincristine-induced neuropathic pain and applications thereof. Background Art
[0002] Vincristine is a chemotherapy drug. An alkaloid extracted from Catharanthus roseus, vincristine has excellent anti-tumor effects, particularly against hematopoietic tumors. It is commonly used to treat diseases such as acute leukemia, chronic lymphocytic leukemia, malignant lymphoma, melanoma, and breast cancer. Once in the body, vincristine rapidly distributes to various tissues and selectively enters cancerous tissues, synchronizing proliferating cells and thereby exerting its anti-tumor effects. Vincristine liposomes encapsulate drug powder or solution within nanoparticles, allowing the drug to accumulate in vital organs such as the liver, lungs, and bone marrow, thereby enhancing its therapeutic efficacy and reducing both the therapeutic dose and toxicity. Although vincristine is a common and effective anti-tumor drug, it is also susceptible to neuropathic pain due to its severe neurotoxicity, particularly to peripheral nerves. In neuropathic conditions, the correlation between pain sensation and the duration and intensity of stimulation is lost, and pain sensation can occur even in the absence of stimulation (e.g., phantom limb pain). This type of pain is termed neuropathic pain.
[0003] Currently, the drugs used clinically to treat neuropathic pain caused by the chemotherapy drug vincristine mainly include calcium channel maintainers such as gabapentin and pregabalin, serotonin and norepinephrine reuptake inhibitors such as duloxetine, opioids such as morphine, and ketamine. For example, Chinese patent application CN102648915A discloses a pharmaceutical composition for treating or preventing neuropathic pain, which contains pregabalin and pentoxifylline and may further contain diclofenac or a pharmaceutically acceptable salt thereof. Chinese patent application CN1673212A discloses an interconnected prodrug of gabapentin and pregabalin and its medical use, specifically relating to an interconnected prodrug of gabapentin and pregabalin and its non-toxic pharmaceutically acceptable salt and its use in the preparation of a drug for treating epilepsy, neuropathic pain, and / or anxiety. However, these drugs have disadvantages such as analgesic tolerance, dependence, respiratory depression, gastrointestinal reactions and increased hypersensitivity reactions, which make them unsuitable for long-term administration. Summary of the Invention
[0004] In response to the shortcomings of the prior art, the present invention aims to provide a polypeptide for alleviating vincristine-induced neuropathic pain in rats and its use. The polypeptide provided herein for alleviating vincristine-induced neuropathic pain in rats has low toxic side effects; the polypeptide XXW-001 of the present invention only requires dissolution in physiological saline, resulting in minimal solvent effects on the living body; it exhibits significant analgesic effects and can be used to treat vincristine-induced allodynia; it does not cause significant side effects such as depression, anxiety, or addiction, and is suitable for long-term administration.
[0005] The technical solution of the present invention is:
[0006] A polypeptide for relieving vincristine-induced neuropathic pain, wherein the polypeptide has the amino acid sequence shown in SEQ ID NO: 1 and is named polypeptide XXW-001.
[0007] The present invention also provides a nucleic acid encoding a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, which can relieve vincristine-induced neuropathic pain.
[0008] Furthermore, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO: 2.
[0009] Another object of the present invention is to provide the use of the polypeptide for relieving vincristine-induced neuropathic pain in the preparation of a medicament for relieving vincristine-induced neuropathic pain.
[0010] Furthermore, the dosage form of the drug is an injection.
[0011] Furthermore, the injection is prepared by using the polypeptide XXW-001 as an active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.
[0012] Furthermore, the injection is an injection solution.
[0013] Furthermore, the pharmaceutically acceptable excipient or auxiliary component is physiological saline.
[0014] Furthermore, the concentration of the polypeptide XXW-001 in the injection is 0.2-1 μg / μL.
[0015] Furthermore, the concentration of the polypeptide XXW-001 in the injection is 0.5 μg / μL.
[0016] Another object of the present invention is to provide the drug for relieving vincristine-induced neuropathic pain, wherein the drug is in the form of an injection, which is prepared by using the polypeptide as an active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.
[0017] Furthermore, the injection is an injection solution, and the pharmaceutically acceptable excipient or auxiliary component is physiological saline.
[0018] Furthermore, the concentration of the polypeptide in the injection is 0.2-1 μg / μL.
[0019] Furthermore, the concentration of the polypeptide in the injection is 0.5 μg / μL.
[0020] Furthermore, the optimal dosage of the drug is 10 μL of 0.5 μg / μL for intrathecal injection, followed by 10 μL of normal saline for flushing.
[0021] Compared with the prior art, the present invention has the following advantages:
[0022] (1) The present invention is a supplement that already exists in normal rats but is significantly downregulated in rats with vincristine-induced neuropathic pain, indicating that the drug of the present invention has low toxic and side effects on individuals;
[0023] (2) The polypeptide XXW-001 of the present invention only needs to be dissolved in physiological saline, and the solvent has minimal impact on the living body;
[0024] (3) Experimental results showed that intrathecal injection of XXW-001 significantly alleviated vincristine-induced plantar allodynia, heat allodynia, or mechanical allodynia. The analgesic effect took effect within 1 hour and lasted for at least 8 to 9 hours. This indicates that the drug of the present invention has a significant analgesic effect and can be used to treat vincristine-induced allodynia.
[0025] (4) The experimental results showed that the difference in white box activity time between the pre-test and post-test in the position preference experiment between rats injected intrathecally with XXW-001 was not significantly different from that of the control group, indicating that the rats were not addicted to intrathecal injection of XXW-001.
[0026] (5) The experimental results showed that there was no significant difference between the center activity distance of rats injected intrathecally with XXW-001 in the open field and the time of activity in the open arms and the control group, indicating that intrathecal injection of XXW-001 had no effect on the anxiety level of rats.
[0027] (6) The experimental results showed that there was no significant difference between the forced swimming immobility time and the sugar water consumption percentage of rats injected intrathecally with XXW-001 and those of the control group, indicating that intrathecal injection of XXW-001 had no effect on the depression level of rats. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is the mass spectrum of the polypeptide XXW-001 prepared in Example 1 of the present invention;
[0029] Figure 2 This is a chromatogram of the polypeptide XXW-001 prepared in Example 1 of the present invention;
[0030] Figure 3 This is the result of the cold pain withdrawal reaction duration after intrathecal injection of peptide XXW-001;
[0031] Figure 4 This is the result of thermal pain withdrawal latency after intrathecal injection of peptide XXW-001;
[0032] Figure 5 This is the result of mechanical pain withdrawal threshold after intrathecal injection of peptide XXW-001;
[0033] Figure 6 This is the result of the open field test five hours after intrathecal injection of peptide XXW-001;
[0034] Figure 7 This is the result of the elevated plus maze test five hours after intrathecal injection of peptide XXW-001;
[0035] Figure 8 This is the result of the forced swimming test five hours after intrathecal injection of peptide XXW-001;
[0036] Figure 9 This is the result of the sugar water preference experiment five hours after intrathecal injection of peptide XXW-001;
[0037] Figure 10 This is the result of a position preference experiment five hours after intrathecal injection of peptide XXW-001. DETAILED DESCRIPTION
[0038] The present invention is further illustrated below by describing specific implementation methods, but this is not intended to limit the present invention. Those skilled in the art can make various modifications or improvements based on the basic ideas of the present invention, but as long as they do not deviate from the basic ideas of the present invention, they are all within the scope of the present invention.
[0039] Example 1. Preparation of polypeptide XXW-001
[0040] The level of circRNA xxw-001 was significantly reduced in the spinal cord of rats with vincristine-induced neuropathic pain. Bioinformatics analysis revealed that this circRNA (sequence: ATGAAGTGGAGGCTGAATAGTACCCAAGGAGAAATTCGAGTTGGCCCTAG CCATCAGGTAAAATAA) encodes the polypeptide XXW-001 (sequence: MKWRLNSTQGEIRVGPSHQVK). The synthesis method for the polypeptide XXW-001 of the present invention follows conventional methods in the art for peptide synthesis. The hydroxyl group of the hydroxyl-terminal amino acid of the desired peptide chain is first covalently linked to an insoluble polymer resin. The amino acid bound to the solid support is then used as the amino component, which is then deprotected and reacted with an excess of activated carboxyl components to extend the peptide chain. Repeat the operation (condensation → washing → deprotection → neutralization and washing → next round of condensation) to achieve the desired peptide chain length. Finally, the peptide chain is cleaved from the resin to obtain a crude polypeptide. The purity of the peptide chain is detected by mass spectrometry. After confirming that there is a qualified product, it is separated and purified by HPLC, and finally HPLC and MS are performed again for quality inspection.
[0041] (1) Liquid chromatography-mass spectrometry
[0042] 1) Mass spectrometry conditions:
[0043] Dissolve 0.1 mg of peptide sample in 0.5 mL of 50% acetonitrile in water, with a sample volume of 1 μL. ESI negative ion mode; nebulizer: N2 at a flow rate of 1.5 L / min; drying gas pressure: 100 kPa; detector voltage: -0.2 kV; heat block temperature: 200°C; CDL temperature: 250°C; mass spectrometer scan range: m / z 200–1900.
[0044] 2) Liquid chromatography conditions:
[0045] Mobile phase A: 0.1% trifluoroacetic acid aqueous solution
[0046] Mobile phase B: 0.1% trifluoroacetic acid in acetonitrile
[0047] Flow rate: 1.0 mL / min
[0048] Wavelength: 214nm
[0049] Column type: SHIMADZU Inertsil ODS-SP (4.6*250mm*5um)
[0050] Sample dissolution method: 0.1 mg of peptide sample was dissolved in 0.5 mL of 10% acetonitrile and 90% water.
[0051] According to the above experimental conditions, the mass spectrum of polypeptide XXW-001 was obtained ( Figure 1 ) and chromatograms ( Figure 2 ), the peak information of the chromatogram is shown in Table 1.
[0052] Table 1: Chromatogram peak information
[0053] peak# Retention time Peak area Peak height Area percentage % Height Percentage % 1 11.329 65853 9219 0.200 0.492 2 12.243 548891 46343 1.670 2.473 3 13.652 32254409 1818090 98.130 97.035 total / 32869153 1873652 100.000 100.000
[0054] From the mass spectrum ( Figure 1 ) can be used to obtain information about the synthesized polypeptide, and it can be known that the molecular weight of the synthesized polypeptide is about 2452. Figure 2 From the peak information of the chromatogram in Table 1, it can be seen that the synthesized polypeptide has three components, among which the largest peak is polypeptide, accounting for 98.13%. Therefore, it can be seen that the purity of the polypeptide synthesized by the present invention is above 98%.
[0055] Example 2: Effects of the drug of the present invention on mechanical pain, thermal pain, and cold pain sensations in rats with vincristine-induced neuropathic pain
[0056] 1. Test materials
[0057] 1.1. Animals: 78 healthy male SD rats, weighing (250±10) g.
[0058] 1.2. Drugs: 0.05 mg / mL vincristine working solution, 0.5 μg / μL XXW-001 peptide solution.
[0059] 2. Test methods
[0060] 2.1. Drug preparation:
[0061] (1) 0.05 mg / mL vincristine working solution: Add 10 mg of vincristine to 2 mL of normal saline as solvent, then aliquot into 160 μL tubes for storage. Wrap in aluminum foil and store at -20°C in the dark. Take 150 μL of the stock solution and dilute with (15 mL-150 μL) normal saline for injection (NS) before use.
[0062] (2) 0.5 μg / μL XXW-001 peptide solution: Weigh 0.0002 g of peptide powder and dissolve it in 100 μL of saline to obtain 100 μL of 2 μg / μL storage solution. Aliquot into 10 μL / tube. When using, add 30 μL of saline to dilute to a working concentration of 0.5 μg / μL and dispense 10 μL / tube.
[0063] 2.2 Grouping and Dosing
[0064] Vincristine intervention control group (VCR+NC): 0.05 mg / mL vincristine working solution was intraperitoneally injected for 10 days, followed by intrathecal injection of 20 μL normal saline;
[0065] Vincristine peptide intervention group (VCR+XXW-001): 0.05 mg / mL vincristine working solution was injected intraperitoneally 10 days later, 10 μL of 0.5 μg / μL XXW-001 peptide solution was injected intrathecally, and 10 μL of normal saline was used to flush the tube.
[0066] 3. Experimental steps:
[0067] 3.1. Establishment of a vincristine-induced neuropathic pain rat model: 0.05 mg / mL of vincristine working solution (dose 0.05 mg / kg) was intraperitoneally injected for 10 consecutive days. On the 11th day, the rats' plantar mechanical pain withdrawal threshold, heat pain withdrawal latency, and cold pain withdrawal response duration were measured.
[0068] 3.2. A total of 78 rats experiencing significant pain were randomly divided into a vincristine control group and a vincristine peptide intervention group. Each group received an intrathecal injection of 20 μL of normal saline or 10 μL of a 0.5 μg / μL XXW-001 peptide solution, followed by a 10 μL saline flush. Mechanical pain withdrawal threshold, heat pain withdrawal latency, or cold pain withdrawal duration were measured starting one hour after intrathecal injection and continued for up to 9 hours after administration.
[0069] 4. The experimental results are shown in Table 2-4, and Figure 3-5 shown.
[0070] Table 2: Results of cold pain withdrawal reaction duration in rats of each group (mean ± standard error) (VCR+XXW-001 group n=10, VCR+NC group n=8)
[0071]
[0072] Depend on Figure 3 As shown in Table 2, intrathecal injection of XXW-001 significantly alleviated vincristine-induced plantar cold allodynia, with the analgesic effect occurring within one hour and lasting for at least eight hours. This demonstrates that the drug of the present invention has a significant analgesic effect and can be used to treat vincristine-induced cold allodynia.
[0073] Table 3: Results of thermal pain withdrawal latency in rats of each group (mean ± standard error) (VCR+XXW-001 group n=17, VCR+NC group n=15)
[0074]
[0075] Depend on Figure 4As shown in Table 3, intrathecal injection of XXW-001 significantly alleviated vincristine-induced plantar thermal hyperalgesia, with the analgesic effect occurring within 1 hour and lasting for at least 8 hours. This demonstrates that the drug of the present invention has a significant analgesic effect and can be used to treat vincristine-induced thermal hyperalgesia.
[0076] Table 4: Mechanical pain withdrawal threshold test results of rats in each group (mean ± standard error) (VCR+XXW-001 group n=14, VCR+NC group n=14)
[0077]
[0078] Depend on Figure 5 As shown in Table 4, intrathecal injection of XXW-001 significantly alleviated vincristine-induced mechanical allodynia, with the analgesic effect occurring within 1 hour and lasting for at least 9 hours. This suggests that the drug of the present invention has a significant analgesic effect and can be used to treat vincristine-induced mechanical allodynia.
[0079] In summary, intrathecal injection of XXW-001 significantly alleviates vincristine-induced plantar allodynia, including cold pain, heat pain, and mechanical pain. The analgesic effect occurs within one hour and lasts for at least eight to nine hours. This demonstrates that the drug has a significant analgesic effect and can be used to treat vincristine-induced allodynia.
[0080] Example 3: Effects of the drug of the present invention on anxiety and depression levels in rats
[0081] 1. Test materials
[0082] 65 healthy SD male rats, weighing (250±10) g.
[0083] 2. Experimental methods:
[0084] (1) Open field test, elevated plus maze and forced swimming test to detect the anxiety level of rats after peptide administration:
[0085] Blank control group (NS(it)): intrathecal injection of 20 μL normal saline;
[0086] Peptide intervention group (XXW-001): 10 μL of 0.5 μg / μL XXW-001 peptide solution was injected intrathecally, and the tube was flushed with 10 μL of normal saline. Five hours later, the open field test, elevated plus maze, and forced swimming test were performed to detect whether the anxiety level of the rats changed after the peptide was administered.
[0087] (2) Sugar water preference experiment to detect the depressive level of peptides:
[0088] On the first day, at 9:00 AM, SD rats were individually caged and acclimated to two water bottles for 24 hours. Then, 50 ml of water and 50 ml of 1% sucrose solution were added, respectively, and the weights were measured. After 12 hours, the water bottles were swapped, and the bottles were removed and weighed. Rats that consumed less than 70% of their total water intake were excluded from the study. Water was then withheld for 24 hours. On the third day, five hours before the start of the experiment, rats received intrathecal injections of either normal saline or 10 μL of a 0.5 μg / μL XXW-001 peptide solution, followed by a 10 μL saline flush. At the start of the experiment, rats were given one 50 ml bottle of water and one 50 ml bottle of 1% sucrose solution. The water bottles were swapped at half an hour, the first hour, and the second hour. Sugar water consumption was measured over the three hours. Sugar water preference was calculated as the ratio of 1% sucrose solution to total water consumption (water and sucrose solution).
[0089] (3) Conditioned place preference test of the addiction level of peptides:
[0090] Acclimation phase: The control rats were acclimated to the equipment environment for 12 hours one day before the formal experiment (Day 0). On Days 1 and 2 of the experiment (Days 1 and 2), the experimental rats were placed in the middle box for acclimation and allowed to move freely between the black and white boxes for 15 minutes. One box was illuminated (the white box), as the rats would theoretically prefer to stay in the dark box (the black box).
[0091] Measure the baseline level of rats before drug administration: Recording began on Day 3. The rats to be tested were placed in the middle box for adaptation and allowed to move freely between the black and white boxes for 15 minutes. If the time spent in one box exceeded 800 seconds, the rat could not perform CPP.
[0092] Drug-matched white box stage: On the 4th and 6th days of the experiment (Day 4 and 6), rats were intrathecally injected with normal saline for 5 hours and then placed in a black box for 15 minutes; 1 hour later, normal saline / XXW-001 was intrathecally injected, and 5 hours after the intrathecal injection, the rats were placed in a white box for 15 minutes; On the 5th and 7th days of the experiment (Day 5 and 7), rats were intrathecally injected with normal saline / XXW-001 for 5 hours and then placed in a white box for 15 minutes; 1 hour later, normal saline was intrathecally injected, and 5 hours after the intrathecal injection, the rats were placed in a black box for 15 minutes.
[0093] Post-test phase: On the 8th day of the experiment (Day 8), the rats that had undergone the above training were placed into the middle box, and the activity time of the rats in each box was recorded for 15 minutes.
[0094] 3. Experimental steps:
[0095] The experimental results are shown in Table 5-9, and Figure 6-10 shown.
[0096] Table 5: Results of open field test in rats of each group (mean ± standard error) (XXW-001 group n = 7, NS (it) group n = 7)
[0097] Group Center moving distance (mm) Total moving distance (mm) NS(it) 928.97±526.04 10437.11±1544.32 XXW-001 896.83±452.59 9460.98±1731.48
[0098] Table 6: Elevated plus maze test results of rats in each group (mean ± standard error) (XXW-001 group n = 11, NS (it) group n = 11)
[0099] Group Arm opening activity time (s) NS(it) 20.69±6.22 XXW-001 20.72±10.15
[0100] From Table 5-6 and Figure 6-7 It can be seen that there is no significant difference in the central activity distance of rats injected intrathecally with XXW-001 in the open field and the activity time in the open arms compared with the control group, indicating that intrathecal injection of XXW-001 has no effect on the anxiety level of rats.
[0101] Table 7: Results of forced swimming test in rats of each group (mean ± standard error) (XXW-001 group n = 5, NS (it) group n = 5)
[0102] Group Immobility time (s) NS(it) 37.50±6.27 XXW-001 42.19±9.01
[0103] Table 8: Results of the sugar water preference test for rats in each group (mean ± standard error) (XXW-001 group n = 5, NS (it) group n = 4)
[0104] Group Sugar water consumption percentage (%) NS(it) 86%±6% XXW-001 74%±9.00%
[0105] From Table 7-8 and Figure 8-9 It can be seen that there is no significant difference between the forced swimming immobility time and the sugar water consumption percentage of rats injected intrathecally with XXW-001 and those of the control group, indicating that intrathecal injection of XXW-001 has no effect on the depression level of rats.
[0106] Table 9: Results of the position preference test of rats in each group (mean ± standard error) (XXW-001 group n = 5, NS (it) group n = 5)
[0107] Group White box activity time change (s) NS(it) -66.09±129.62 XXW-001 -72.99±159.19
[0108] From Table 9 and Figure 10 It can be seen that the difference in white box activity time between pre-test and post-test in the position preference experiment of rats injected intrathecally with XXW-001 was not significantly different from that of the control group, indicating that the rats were not addicted to intrathecal injection of XXW-001.
[0109] Those skilled in the art should recognize that the above embodiments are only used to illustrate the present invention and are not intended to limit the invention. As long as they are within the spirit of the present invention, any changes or modifications to the above embodiments will fall within the scope of the claims of the present invention.
Claims
1. A polypeptide for alleviating vincristine-induced neuropathic pain, characterized in that: The polypeptide is a polypeptide with an amino acid sequence shown in SEQ ID NO: 1, and is named polypeptide XXW-001.
2. The nucleic acid encoding the polypeptide for alleviating vincristine-induced neuropathic pain according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid is shown in SEQ ID NO:
2.
3. Use of the polypeptide for relieving vincristine-induced neuropathic pain as claimed in claim 1 in the preparation of a medicament for relieving vincristine-induced neuropathic pain.
4. The use according to claim 3, characterized in that The dosage form of the drug is an injection; the injection is prepared with polypeptide XXW-001 as the active ingredient and pharmaceutically acceptable excipients added.
5. The use according to claim 4, characterized in that The injection is an injection solution.
6. The use according to claim 4, characterized in that The pharmaceutically acceptable excipient is physiological saline.
7. The use according to claim 5, characterized in that The concentration of the polypeptide XXW-001 in the injection is 0.2-1 μg / μL.
8. A drug for relieving vincristine-induced neuropathic pain, characterized in that: The dosage form of the drug is an injection, which is prepared by using the polypeptide according to claim 1 as an active ingredient and adding pharmaceutically acceptable excipients.
9. The drug for relieving vincristine-induced neuropathic pain according to claim 8, wherein The injection is an injection solution, and the pharmaceutically acceptable excipient is physiological saline.
10. The drug for relieving vincristine-induced neuropathic pain according to claim 9, characterized in that: The concentration of the polypeptide in the injection is 0.2-1 μg / μL.
Citation Information
Patent Citations
Medicinal composition for treating or preventing neuropathic pain
CN102648915A
Interconnected medicine precursor of gabapentin and pregabalin and its medicinal use
CN1673212A
Novel application of conotoxin annuojisi peptide in pharmacy
CN104013952A
Group of peptides having analgesic effect, and pharmaceutical composition and use thereof
WO2018108185A1