Compositions, kits, methods and uses thereof for detecting SARS-CoV-2 mutations

Abstract

The present invention belongs to the field of molecular biological detection; specifically, it relates to the detection of SARS-CoV-2; more specifically, it relates to the detection of SARS-CoV-2 mutations. At the same time, a kit comprising the composition of the present invention, the use of the composition, and a method for detecting the main mutation sites of SARS-CoV-2 variants are also provided. Using the composition of the present invention, the main mutation sites of alpha variants, delta variants, and lambda variants can be identified, so that strains with different mutation sites can be treated differently, thereby making treatment and prevention more efficient. The composition of the present invention has low cost and high throughput. And it is easy to operate. The whole detection process is carried out under closed conditions, avoiding false positives and environmental pollution caused by crossover between samples.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection; specifically, it relates to the detection of SARS-CoV-2; more specifically, it relates to the detection of SARS-CoV-2 mutations. Background Art

[0002] As an RNA virus, one of the biggest characteristics of the new coronavirus is its easy mutation. From the mutant strain Alpha (Alpha B.1.1.7) to Beta (Beta B.1.351), to Gamma (Gamma P.1) and Delta (DeltaB.1.617.2), with each mutation, the new coronavirus carries a stronger ability to spread.

[0003] Based on the global SARS-CoV-2 genome sequencing analysis report, its mutations mainly occur in 5 genes, namely the S gene, N gene, ORF8 gene, ORF3a gene and ORF1ab gene, among which the mutation on the S gene has the greatest impact on the virus's ability to spread and cause disease. Currently, the most widely spread variants include B.1.1.7, B.1.351, B.1.617.1, B.1.617.2, B.1.617.3, B.1.525, P.1, P.2, C.37, etc. The main mutation sites are E484Q, E484K, L452R, P681R, T487K, D950N, F490S, Del247-253, T76I, L452Q, etc. These sites may lead to immune escape or increased infectivity. In particular, the emergence of Delta and Lambda strains, these variants are spreading rapidly and gradually replacing other types of the new coronavirus. Some of these mutations may produce resistance to antibodies induced by the current SARS-CoV-2 vaccine, affecting the effectiveness of detection reagents and vaccines, so clarifying the mutation sites of the virus is of great significance to the epidemiological analysis and clinical diagnosis and treatment of the virus.

[0004] The field needs a reagent that can accurately identify different mutations of the new coronavirus so that targeted prevention and treatment measures can be taken to make the response more efficient. At the same time, the detection time is short and the sensitivity is high. Summary of the invention

[0005] In view of this, in a first aspect, the present invention provides a composition capable of detecting the main mutation sites of SARS-CoV-2 variants, the composition also comprising:

[0006] First nucleic acid composition:

[0007] The mutant L452R upstream primer as shown in SEQ ID NO: 1, the mutant L452R downstream primer as shown in SEQ ID NO: 2, and the mutant L452R probe as shown in SEQ ID NO: 3;

[0008] The mutant E484Q upstream primer as shown in SEQ ID NO:4, the mutant E484Q downstream primer as shown in SEQ ID NO:5, and the mutant E484Q probe as shown in SEQ ID NO:6;

[0009] Second nucleic acid composition:

[0010] The mutant P681R upstream primer as shown in SEQ ID NO:7, the mutant P681R downstream primer as shown in SEQ ID NO:8, and the mutant P681R probe as shown in SEQ ID NO:9;

[0011] The mutant E484K upstream primer as shown in SEQ ID NO: 10, the mutant E484K downstream primer as shown in SEQ ID NO: 11, and the mutant E484K probe as shown in SEQ ID NO: 12;

[0012] The third nucleic acid composition:

[0013] A mutant L452Q upstream primer as shown in SEQ ID NO: 13, a mutant L452Q downstream primer as shown in SEQ ID NO: 14, and a mutant L452Q probe as shown in SEQ ID NO: 15;

[0014] a mutant T76I upstream primer as shown in SEQ ID NO: 16, a mutant T76I downstream primer as shown in SEQ ID NO: 17, and a mutant T76I probe as shown in SEQ ID NO: 18;

[0015] The fourth nucleic acid composition:

[0016] The mutant F490S upstream primer as shown in SEQ ID NO: 19, the mutant F490S downstream primer as shown in SEQ ID NO: 20, and the mutant F490S probe as shown in SEQ ID NO: 21;

[0017] The mutant Del247-253 upstream primer as shown in SEQ ID NO:22, the mutant Del247-253 downstream primer as shown in SEQ ID NO:23, and the mutant Del247-253 probe as shown in SEQ ID NO:24; and

[0018] Fifth nucleic acid composition:

[0019] a mutant T487K upstream primer as shown in SEQ ID NO:25, a mutant T487K downstream primer as shown in SEQ ID NO:26, and a mutant T487K probe as shown in SEQ ID NO:27;

[0020] The mutant D950N upstream primer is shown as SEQ ID NO:28, the mutant D950N downstream primer is shown as SEQ ID NO:29, and the mutant D950N probe is shown as SEQ ID NO:30.

[0021] The composition of the present invention can be used to identify the main mutation sites of alpha mutation, delta mutation and lambda mutation, so that strains with different mutation sites can be treated differently, thereby making treatment and prevention more efficient. The composition of the present invention, combined with the fluorescent probe method, can detect 10 targets at the same time, with low cost, high throughput, simple operation and short time.

[0022] Further, in some embodiments, the composition of the present invention may include one or more pairs of the above primers and probes. In the present invention, a "pair" refers to upstream and downstream primers and probes that match each other for detecting a mutation.

[0023] For example, only the first nucleic acid composition may be included; only the second nucleic acid composition may be included; only the third nucleic acid composition may be included; only the fourth nucleic acid composition may be included; and only the fifth nucleic acid composition may be included.

[0024] For example, only some primer and probe pairs of different nucleic acid compositions may be included, for example, a mutant L452R upstream primer as shown in SEQ ID NO: 1, a mutant L452R downstream primer as shown in SEQ ID NO: 2, and a mutant L452R probe as shown in SEQ ID NO: 3, a mutant P681R upstream primer as shown in SEQ ID NO: 7, a mutant P681R downstream primer as shown in SEQ ID NO: 8, and a mutant P681R probe as shown in SEQ ID NO: 9, a mutant L452Q upstream primer as shown in SEQ ID NO: 13, a mutant L452Q downstream primer as shown in SEQ ID NO: 14, and a mutant L452Q probe as shown in SEQ ID NO: 15, a mutant F490S upstream primer as shown in SEQ ID NO: 19, a mutant F490S downstream primer as shown in SEQ ID NO: 20, and a mutant F490S probe as shown in SEQ ID NO: 21, a mutant T487K upstream primer as shown in SEQ ID NO: 25, a mutant T487K downstream primer as shown in SEQ ID NO: 26, and a mutant T487K upstream primer as shown in SEQ ID NO: 27. The mutant T487K downstream primer is shown in NO:26, and the mutant T487K probe is shown in SEQ ID NO:27.

[0025] Furthermore, the fluorescent groups of the probes in each group of the first, second, third, fourth and fifth nucleic acid compositions are different from each other and do not interfere with each other.

[0026] In this article, "different from each other and not interfering with each other" means that the fluorescent groups used in each probe in the composition are different and will not affect each other's detection, that is, different channels can be used for detection. For example, FAM, HEX, ROX and CY5 can be used. The absorbance values ​​of these groups are not close, and different channels can be selected, so they will not interfere with each other.

[0027] In a specific embodiment, the L452R-P, P681R-P, L452Q-P, F490S-P, and T478K-P probes are labeled with FAM channels, and the E484Q-P, E484K-P, T76I-P, Del247-253-P, and D950N-P probes are labeled with HEX channels.

[0028] Furthermore, the composition also includes: an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for monitoring, which can be in any one or several nucleic acid compositions.

[0029] Furthermore, the internal standard includes a human genome internal standard.

[0030] In a specific embodiment, the composition further includes: a human genome internal standard upstream primer as shown in SEQ ID NO:31, a human genome internal standard downstream primer as shown in SEQ ID NO:32, and a human genome internal standard probe as shown in SEQ ID NO:33.

[0031] Furthermore, the internal standard includes the new crown internal standard.

[0032] In a specific embodiment, the composition also includes: a new crown internal standard upstream primer as shown in SEQ ID NO:34, a new crown internal standard downstream primer as shown in SEQ ID NO:35, and a new crown internal standard probe as shown in SEQ ID NO:36.

[0033] Furthermore, the internal standard includes a human genome internal standard and a new coronavirus internal standard.

[0034] In a specific embodiment, the composition also includes: a human genome internal standard upstream primer as shown in SEQ ID NO:31, a human genome internal standard downstream primer as shown in SEQ ID NO:32, and a human genome internal standard probe as shown in SEQ ID NO:33; and a new crown internal standard upstream primer as shown in SEQ ID NO:34, a new crown internal standard downstream primer as shown in SEQ ID NO:35, and a new crown internal standard probe as shown in SEQ ID NO:36.

[0035] Furthermore, the fluorescent groups of the internal standard and the probes in each group of the first, second, third, fourth and fifth nucleic acid compositions are different from each other and do not interfere with each other.

[0036] In a specific embodiment, the COVID-19 internal standard NP probe is labeled with the ROX channel, and the human gene internal standard IC-P probe is labeled with the CY5 channel.

[0037] Furthermore, the 3' end of the probe also has a quenching group, such as BHQ1 or BHQ2.

[0038] In a specific embodiment, the 3' end of the probe is BHQ1.

[0039] Furthermore, the amount of the primer in the composition is 0.1-0.3 μM; the amount of the probe in the composition is 0.15-0.25 μM.

[0040] In a specific embodiment, each nucleic acid composition of the composition of the present invention is present in a separate package.

[0041] Furthermore, the components in each nucleic acid composition of the composition of the present invention are present in a mixed form.

[0042] In a second aspect, the present invention provides the use of the above-mentioned composition of the present invention in the preparation of a kit for detecting major mutation sites of SARS-CoV-2 variants.

[0043] In a third aspect, the present invention provides a kit for detecting major mutation sites of SARS-CoV-2 variants, the kit comprising the composition of the present invention as described above.

[0044] Furthermore, the kit also includes a negative quality control product and a positive quality control product.

[0045] In a specific embodiment, the negative control product is at least one of DEPC H2O, physiological saline, and internal reference gene pseudovirus. The positive control product is at least one of the target fragment plasmid containing the new coronavirus N target gene, each mutation site of the new coronavirus, and the internal reference gene, fragment RNA, and pseudovirus.

[0046] Furthermore, the kit also includes: a nucleic acid release system and a nucleic acid amplification system.

[0047] Furthermore, the kit also includes dNTPs, PCR buffer and Mg 2+ At least one of .

[0048] Furthermore, the kit also includes: at least one of a nucleic acid releaser, a nucleic acid extraction reagent, a reverse transcriptase, a uracil glycosylase and a DNA polymerase.

[0049] Furthermore, the kit also includes a nucleic acid release reagent, a nucleic acid extraction reagent, dNTP, reverse transcriptase, uracil glycosylase, DNA polymerase, PCR buffer and Mg 2+ At least one of .

[0050] Furthermore, the concentration of the reverse transcriptase is 5U / reaction to 15U / reaction, for example, the reverse transcriptase may be mouse leukemia reverse transcriptase (MMLV) or Tth enzyme; the concentration of the DNA polymerase is 3U / reaction to 15U / reaction, for example, the DNA polymerase may be Taq enzyme.

[0051] In a specific embodiment, the kit of the present invention comprises: reverse transcriptase, Taq enzyme, uracil glycosylase, Mg 2+ , Mn 2+ , Rnasin, dNTPs, primers, probes and PCR buffer.

[0052] Common PCR buffers are composed of Tris-HCl, MgCl2, KCl, Triton X-100, etc. The total volume in a single PCR reaction tube is generally 20 to 100 μl.

[0053] In a specific embodiment, the kit of the present invention is compatible with a digital PCR amplification system, that is, it can be directly used for amplification on a digital PCR instrument.

[0054] In a fourth aspect, a method for detecting major mutation sites of SARS-CoV-2 variants is provided, the method comprising the following steps:

[0055] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0056] 2) using the composition of the present invention or the kit of the present invention as described above to perform fluorescent quantitative PCR analysis on the nucleic acid obtained in step 1);

[0057] 3) Obtain and analyze the results.

[0058] In the present invention, the sample used for detection can be a throat swab, an oropharyngeal swab, a nasopharyngeal swab, sputum, alveolar lavage fluid, blood, etc., but is not limited thereto.

[0059] Furthermore, the reaction conditions of the fluorescent quantitative PCR are:

[0060] Reverse transcription, temperature is 50℃~60℃, time is 5~30 minutes, 1 cycle; cDNA pre-denaturation, temperature is 95℃, time is 1~10 minutes, 1 cycle; denaturation, temperature is 95℃, time is 5~20 seconds, annealing, temperature is 55~60℃, time is 20~60 seconds, 40~50 cycles, and fluorescence is collected.

[0061] In a specific embodiment, the reaction conditions of the fluorescent quantitative PCR are: reverse transcription, temperature is 50°C, time is 10 minutes, 1 cycle; cDNA pre-denaturation, temperature is 95°C, time is 1 minute, 1 cycle; denaturation, temperature is 95°C, time is 10 seconds, annealing, temperature is 60°C, time is 20 seconds, 45 cycles, and fluorescence collection.

[0062] In a specific embodiment, a method for detecting major mutation sites of SARS-CoV-2 variants for non-diagnostic purposes is provided, the method comprising the following steps:

[0063] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0064] 2) using the composition of the present invention or the kit of the present invention as described above to perform fluorescent quantitative PCR analysis on the nucleic acid obtained in step 1);

[0065] 3) Obtain and analyze the results.

[0066] Furthermore, the reaction conditions of the fluorescent quantitative PCR are:

[0067] Reverse transcription, temperature is 50℃~60℃, time is 5~30 minutes, 1 cycle; cDNA pre-denaturation, temperature is 95℃, time is 1~10 minutes, 1 cycle; denaturation, temperature is 95℃, time is 5~20 seconds, annealing, temperature is 55~60℃, time is 20~60 seconds, 40~50 cycles, and fluorescence is collected.

[0068] In a specific embodiment, the reaction conditions of the fluorescent quantitative PCR are: reverse transcription, temperature is 50°C, time is 10 minutes, 1 cycle; cDNA pre-denaturation, temperature is 95°C, time is 1 minute, 1 cycle; denaturation, temperature is 95°C, time is 10 seconds, annealing, temperature is 60°C, time is 20 seconds, 45 cycles, and fluorescence collection.

[0069] In this article, the term "non-diagnostic purpose" means that the purpose is not to obtain information on whether an individual is infected with a SARS-CoV-2 variant and suffers from pneumonia. For example, the method can detect the presence of a SARS-CoV-2 variant in a test culture in an experiment for scientific research purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figures 1 to 7 The test results of the samples tested for the composition of the present invention (N gene, E484K, P681R, L452R and E484Q, T478K and D950N, L452Q and T76I, F490S and Del247-253);

[0071] Figures 8-9 The test results of the composition of the present invention for samples (L452R, E484Q) of different concentrations;

[0072] Fig.10 is the specific detection result of the composition of the present invention;

[0073] Figures 11-12 It is the precision test result of the composition (L452R, E484Q) of the present invention;

[0074] Figures 13-15 These are the test results of the test samples of the comparative example compositions (L452R, E484Q, E484K) of the present invention. DETAILED DESCRIPTION

[0075] In the present invention, the expressions "first", "second", "third", "fourth" and "fifth" etc. are used only for descriptive purposes to distinguish the defined substances but not to limit the order or priority in any way.

[0076] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0077] Example 1: Primers and probes used in the present invention

[0078] The primers and probes used in the present invention are shown in Table 1 below:

[0079] Table 1

[0080]

[0081]

[0082] Among them, L452R-P, P681R-P, L452Q-P, F490S-P, and T478K-P probes are labeled with FAM channels, E484Q-P, E484K-P, T76I-P, Del247-253-P, and D950N-P probes are labeled with HEX channels, the new crown internal standard NP probe is labeled with ROX channel, and the human gene internal standard IC-P probe is labeled with CY5 channel.

[0083] Example 2: Method for detecting mutations of novel coronavirus

[0084] The samples tested in the present invention are pharyngeal swabs, sputum, alveolar lavage fluid, and blood. The viral nucleic acid is extracted by magnetic bead method (Shengxiang Biotechnology Company kit), and the following operations are performed in the sample processing room:

[0085] 2.1 Take a number of 1.5mL centrifuge tubes according to the number of samples to be tested, and add 300μL of sample to each tube;

[0086] 2.2 Add 500 μL of extraction solution 1 and 50 μL of proteinase K-magnetic bead mixture; cover the tube, shake and mix for 30 seconds, and heat at 60℃ for 10 minutes.

[0087] 2.3 Let stand at room temperature for 1 minute, centrifuge at low speed, place the centrifuge tube on the magnetic separator, and slowly aspirate and discard the waste liquid after 5 minutes (*Be careful not to touch the magnetic beads adsorbed on the inner side of the tube wall);

[0088] 2.4 Add 200 μL of washing solution 1 and 600 μL of washing solution 2, shake and mix for 30 seconds, centrifuge at low speed, and place the centrifuge tube in a magnetic separator. Magnetic suction for 3 minutes, completely aspirate and discard the liquid.

[0089] 2.5 Place the centrifuge tube in a centrifuge and centrifuge it at a low speed for a short time. Place the centrifuge tube in the magnetic separator again and magnetically absorb it for 3 minutes to completely absorb the liquid at the bottom of the tube.

[0090] 2.6 Add 30-100 μL of elution buffer S (80 μL is recommended), shake and mix for 30 seconds to elute the magnetic beads on the wall of the centrifuge tube to the bottom of the tube, and let it stand at room temperature for 3 minutes; centrifuge at a low speed, place the centrifuge tube on the magnetic separator again for 3 minutes, and then transfer the eluted nucleic acid to a clean 1.5 mL centrifuge tube.

[0091] 2.7 Pipette 20 μL of the above-treated samples, SARS-CoV-2-MT-positive control and SARS-CoV-2-MT-negative control and add them to the corresponding 0.2 mL PCR reaction tubes, add 30 μL of PCR mixture to each tube and cover the tube.

[0092] The real-time fluorescence PCR reaction system was configured as follows:

[0093]

[0094]

[0095] The PCR amplification program was set up as follows:

[0096]

[0097] Result analysis:

[0098] 1) The target detection signal is FAM, HEX (or VIC), the new crown internal standard N gene detection signal is ROX, and the human gene internal standard detection signal is CY5;

[0099] 2) Baseline setting: Baseline is generally set to 3-15 cycles, which can be adjusted according to actual conditions. The adjustment principle is: select the area where the fluorescence signal is relatively stable before exponential amplification, avoid the signal fluctuation at the beginning of fluorescence acquisition at the starting point (Start), and reduce the Ct of the sample with the earliest exponential amplification by 1-2 cycles at the end point (End). Threshold setting: The setting principle is that the threshold line just exceeds the highest point of the normal negative control;

[0100] 3) Interpretation of results:

[0101]

[0102]

[0103] Example 3. Test results of the positive control of the composition of the present invention

[0104] Using the composition of Table 1 of the present invention, according to the method described in Example 2, 1 case of the whole-field transcribed RNA of the new coronavirus wild type, alpha variant, delta variant, and lambda variant was detected, and PCR detection was performed on a Macrostone fluorescent quantitative PCR instrument. The results are as follows Figures 1 to 7 As shown in the figure, it can be seen that the corresponding targets can be detected, proving that the composition of the present invention can detect the mutation of the new coronavirus.

[0105] Example 4: Sensitivity test of the composition of the present invention

[0106] Using the composition of Table 1 of the present invention, according to the method described in Example 2, five concentrations of 500000, 50000, 5000, 500, and 50 copies / ml of each target pseudovirus were tested. Multiplex PCR detection was performed on a Macrostone fluorescent quantitative PCR instrument. The results are as follows: Figures 8-9 As shown in the figure, it can be seen that the corresponding target can still be detected at a concentration as low as 500 copies / ml, proving that the sensitivity of the composition of the present invention is 500 copies / ml.

[0107] Example 5: Specificity test of the composition of the present invention

[0108] Using the composition of Table 1 of the present invention, according to the method described in Example 2, multiple PCR detection was performed on the Macrostone fluorescent quantitative PCR instrument for pathogens with homology in nucleic acid sequence and easily causing the same or similar clinical symptoms (such as Candida glabrata, Streptococcus pneumoniae, Serratia marcescens, Escherichia coli, Staphylococcus epidermidis, Acinetobacter baumannii, Klebsiella pneumoniae, Candida tropicalis, Candida krusei, Enterococcus faecalis, Haemophilus influenzae, Staphylococcus aureus, Butyric acid bacteria, Enterobacter cloacae, Pseudomonas aeruginosa, Legionella pneumophila, Clostridium botulinum, Micrococcus luteus, Rhodococcus equi, Listeria monocytogenes, Acinetobacter junii, Haemophilus parainfluenzae, influenza A virus, influenza B virus, Neisseria meningitidis, etc.), and the results were as follows. Fig.10 As shown in the figure, it can be seen that the detection is all negative, and only the standard gene in the human genome is amplified, which proves that the composition of the present invention has good specificity.

[0109] Example 6: Precision test of the composition of the present invention

[0110] Using the composition of Table 1 of the present invention, according to the method described in Example 2, two concentration levels of strong positive and weak positive (100000 copies / ml and 2000 copies / ml, respectively) of quality control samples were selected for intra-batch precision and inter-batch precision determination, and each sample was repeated 10 times. The results showed that the detection rates of the strong positive and weak positive reference samples were both 100%, and the coefficient of variation (CV) of the intra-batch and inter-batch detection Ct values ​​was less than 5%. Figure 11-12 This indicates that this kit has good detection precision both within and between batches.

[0111] Comparative Example 1: Other primers and probes designed by the present invention that have poor effects

[0112] Due to the principle of complementary base pairing, dimers will form between primers and (or) probes, but this probability is very small and can be ruled out at the beginning of the design. However, when multiple pathogens are detected together, there are many primers and probes, and dimers are likely to occur between primers and primers, probes and probes, or primers and probes. In order to ensure the conservatism of the design (conservatism is crucial to the accuracy of the detection), and to consider the mutual interference between different primers and probes, the primers and probes need to be carefully designed.

[0113] Therefore, the inventors also designed some other primers and probes (sequences not shown) to form different detection systems 1, 2 and 3, which are also used to detect new coronavirus mutations. The specific test results are as follows Figures 13-15 As shown in the figure, it can be seen that the detection effect is not good. Sequence Listing <110> Shengxiang Biotechnology Co., Ltd. <120> Composition, kit, method and use thereof for detecting mutations of SARS-CoV-2 mutant strains <160> 36 <170> PatentIn version 3.5 <210> 1 <211> 27 <212> DNA <213> Artificial sequence <400> 1 tgatctctgc tttaactaatg tctatgc 27 <210> 2 <211> 30 <212> DNA <213> Artificial sequence <400> 2 tgagattaga cttcctaaac aatctatacc 30 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence <400> 3 tcagacaaat cgctccaggg caa 23 <210> 4 <211> twenty three <212> DNA <213> Artificial sequence <400> 4 tagcamacct tgtaatggtg ttc 23 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence <400> 5 gtgcatgtag aagttcaaaa gaaa 24 <210> 6 <211> 28 <212> DNA <213> Artificial sequence <400> 6 tggtaaccaa caccattagt gggttgga 28 <210> 7 <211> 27 <212> DNA <213> Artificial sequence <400> 7 tagttatcag actcagacta attctcg 27 <210> 8 <211> twenty four <212> DNA <213> Artificial sequence <400> 8 gtgggtatgg caatagagtt atta 24 <210> 9 <211> 25 <212> DNA <213> Artificial sequence <400> 9 cgggcacgta gtgtagctag tcaat 25 <210> 10 <211> twenty four <212> DNA <213> Artificial sequence <400> 10 gtagcamacc ttgtaatggt gtta <210> 11 <211> 23 <212> DNA <213> The snowstorm <400> 11 tgcatgtaga agttcaaaag aaa <210> 12 <211> 30 <212> DNA <213> The snowstorm <400> 12 tggtacca caccattagt gggttggaa <210> 13 <211> 28 <212> DNA <213> The snowstorm <400> 13 ctaaggttgg tggtaattat attack <210> 14 <211> 24 <212> DNA <213> The snowstorm <400> 14 gttggaacc atatgattgt aaag <210> 15 <211> 28 <212> DNA <213> The snowstorm <400> 15 ctgaatcta tcaggccggt agcamacc <210> 16 <211> 26 <212> DNA <213> The snowstorm <400> 16 attackgtct ctgggaccaa tgttat <210> 17 <211> 25 <212> DNA <213> Artificial sequence <400> 17 aacaataagt agggactggg tcttc 25 <210> 18 <211> 32 <212> DNA <213> Artificial sequence <400> 18 tgtcctacca tttaatgatg gtgtttattt tg 32 <210> 19 <211> 26 <212> DNA <213> Artificial sequence <400> 19 acaatcttga ttctaaggtt ggtggt 26 <210> 20 <211> 26 <212> DNA <213> Artificial sequence <400> 20 ttggaaacca tatgattgta aaggag 26 <210> twenty one <211> 35 <212> DNA <213> Artificial sequence <400> twenty one agatatttca actgaaatct atcaggccgg tagca 35 <210> twenty two <211> 26 <212> DNA <213> Artificial sequence <400> twenty two atggaccttg aaggaaaaca gggtaa 26 <210> twenty three <211> 29 <212> DNA <213> Artificial sequence <400> twenty three gctgtccaac ctgaagaaga attatgtaa 29 <210> twenty four <211> 30 <212> DNA <213> Artificial sequence <400> twenty four cgtgatctccctcagggtttttcggcttta 30 <210> 25 <211> twenty two <212> DNA <213> Artificial sequence <400> 25 aaatctatca ggccggtagc aa 22 <210> 26 <211> twenty four <212> DNA <213> Artificial sequence <400> 26 tggtgcatgt agaagttcaa aaga 24 <210> 27 <211> 31 <212> DNA <213> Artificial sequence <400> 27 tctgtatggt tggtaaccaa caccattagt g 31 <210> 28 <211> 25 <212> DNA <213> Artificial sequence <400> 28 tacacttctg cactgttagc gggta 25 <210> 29 <211> twenty three <212> DNA <213> Artificial sequence <400> 29 tgtgcatttt ggttgaccac att 23 <210> 30 <211> 27 <212> DNA <213> Artificial sequence <400> 30 acttctggtt ggacctttgg tgcaggt 27 <210> 31 <211> 17 <212> DNA <213> Artificial sequence <400> 31 gatttggacc tgcgagc 17 <210> 32 <211> 18 <212> DNA <213> Artificial sequence <400> 32 gcggctgtct ccacaagt 18 <210> 33 <211> 18 <212> DNA <213> Artificial sequence <400> 33 gcggctgtct ccacaagt 18 <210> 34 <211> 17 <212> DNA <213> Artificial sequence <400> 34 ctggacttcc ctatggt 17 <210> 35 <211> twenty four <212> DNA <213> Artificial sequence <400> 35 tgatcttttg gtgtattcaa ggct 24 <210> 36 <211> 20 <212> DNA <213> Artificial sequence <400> 36 tgcaacccat atgatgccgt 20

Claims

1. A composition capable of detecting mutation sites of SARS-CoV-2 variants, the composition comprising a first nucleic acid composition, a second nucleic acid composition, a third nucleic acid composition, a fourth nucleic acid composition, and a fifth nucleic acid composition, wherein: The first nucleic acid composition includes upstream and downstream primers and probes for detecting mutation L452R as shown in nucleotide sequences of SEQ ID NOs: 1 to 3, and upstream and downstream primers and probes for detecting mutation E484Q as shown in nucleotide sequences of SEQ ID NOs: 4 to 6; The second nucleic acid composition includes upstream and downstream primers and probes for detecting mutation P681R whose nucleotide sequences are shown in SEQ ID NOs: 7 to 9, and upstream and downstream primers and probes for detecting mutation E484K whose nucleotide sequences are shown in SEQ ID NOs: 10 to 12; The third nucleic acid composition includes upstream and downstream primers and probes for detecting mutation L452Q whose nucleotide sequences are shown in SEQ ID NOs: 13 to 15, and upstream and downstream primers and probes for detecting mutation T76I whose nucleotide sequences are shown in SEQ ID NOs: 16 to 18; The fourth nucleic acid composition includes upstream and downstream primers and probes for detecting mutation F490S with nucleotide sequences as shown in SEQ ID NOs: 19 to 21, and upstream and downstream primers and probes for detecting mutation Del247-253 with nucleotide sequences as shown in SEQ ID NOs: 22 to 24; The fifth nucleic acid composition includes upstream and downstream primers and probes for detecting mutation T487K with nucleotide sequences as shown in SEQ ID NOs: 25 to 27, and upstream and downstream primers and probes for detecting mutation D950N with nucleotide sequences as shown in SEQ ID NOs: 28 to 30.

2. The composition according to claim 1, wherein The composition further includes upstream and downstream primers and probes for detecting the internal standard.

3. The composition according to claim 2, wherein The internal standard is at least one of a human gene internal standard or a new crown internal standard.

4. The composition according to claim 1, wherein The composition further includes upstream and downstream primers and probes for detecting human gene internal standards with nucleotide sequences as shown in SEQ ID NOs: 31 to 33, or upstream and downstream primers and probes for detecting new coronavirus internal standards with nucleotide sequences as shown in SEQ ID NOs: 34 to 36.

5. The composition according to claim 1, wherein Each nucleic acid composition of the composition is present in a separate package.

6. Use of the composition according to any one of claims 1 to 5 in the preparation of a kit for detecting mutation sites of SARS-CoV-2 variants.

7. A kit for detecting mutation sites of SARS-CoV-2 variants, the kit comprising the composition as described in any one of claims 1 to 5.

8. The kit according to claim 7, wherein The kit further comprises a nucleic acid extraction reagent, dNTP, reverse transcriptase, uracil glycosylase, DNA polymerase, PCR buffer or Mg 2+ At least one of .

9. A method for detecting SARS-CoV-2 variants for non-diagnostic purposes, the method comprising the following steps: 1) Extracting nucleic acid from the sample to be tested; 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition according to any one of claims 1 to 5; 3) Obtain and analyze the results.

Images