A pyrrolopyridine derivative and its pharmaceutical composition and application
By designing pyrrolopyridine derivatives to bind to the Oct4 protein structure and regulate mirRNA, the tumorigenicity and high cost issues caused by viral vectors were solved, achieving safe and simple Oct4 expression regulation and highly selective activation, thus improving the safety and efficiency of reprogramming.
Patent Information
- Application Number
- CN202211614474.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-15
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2042-12-15
AI Technical Summary
Existing reprogramming methods mostly overexpress Oct4 through viral vectors, which poses risks of tumorigenesis and is costly. Furthermore, the complexity of the vectors increases regulatory complexity, making it difficult to achieve safe and convenient Oct4 regulation.
A pyrrolopyridine derivative was designed that can bind to the Oct4 protein structure and regulate the negative regulatory mirRNA, thereby achieving chemical activation of Oct4 and avoiding the use of viral vectors. This achieves highly selective activation of Oct4 through small chemical molecules.
This approach enables safe and simple Oct4 expression regulation, reducing tumorigenic risk and cost, and improving the safety and efficiency of reprogramming.
Smart Images

Figure CN116283964B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medicine, and in particular to a pyrrolopyridine derivative and a pharmaceutical composition thereof, and applications thereof in regulating Oct4 and Oct4-associated genes. Background Art
[0002] Regenerative medicine refers to an emerging science that utilizes a variety of new technologies and disciplines to rebuild aging or dysfunctional tissues and organs, and to treat related diseases through a variety of medical methods. Important research directions in regenerative medicine include the mechanisms of normal tissue characteristics and functions, the biological basis of post-traumatic repair, the regeneration mechanisms of tissues and organs, and the differentiation mechanisms of various stem cells, ultimately leading to effective biological treatments. Among them, embryonic stem cells (ESCs, abbreviated as ES, EK, or ESC cells) are the most popular cell type in early regenerative medicine research. However, the acquisition and use of these cells are subject to significant ethical controversy, as embryonic stem cell research requires the destruction of embryos, which are the life form of a person in the uterus before they are formed. This ethical controversy has greatly hindered the advancement and application of regenerative medicine.
[0003] In 2006, Shinya Yamanaka's team proposed a "cocktail" method consisting of four transcription factors: Oct4, Sox2, KlF4, and c-Myc. This method can successfully reprogram terminally differentiated skin fibroblasts into stem cells with differentiation pluripotency. These stem cells are called induced pluripotent stem cells (induced pluripotent stem cells) (Takahashi K, et al., Cell, 2006, 126 (4) pp. 663-676; Takahashi K and Yamanaka S, Cell, 2007, 131 (5) pp. 861-872). These stem cells have differentiation potential similar to embryonic stem cells and can form the three most basic germ layers of human development: ectoderm, mesoderm, and endoderm, and ultimately form a variety of adult cells. The introduction of this method broke through the ethical restrictions on the use of human embryonic stem cells in medicine and greatly expanded the application potential of stem cell technology in clinical medicine.
[0004] In the study of induced pluripotent stem cells and embryonic stem cells, Oct4 has been shown to be a major regulatory gene for reprogramming and inducing cell plasticity (Malik, V et al., Nat. Commun. 2019, 10, 3477). The protein encoded by the Oct4 gene plays a key role in embryonic development and stem cell pluripotency, and alternative splicing leads to multiple transcript variants. The protein encoded by Oct4 belongs to the POU domain family of transcription factors and is located at Chromosome 17:35,825,200-35,829,401. The hallmark feature of the POU transcription factor family is the POU domain, which consists of two structurally independent subdomains: a POU-specific (POU) region consisting of highly conserved 75 amino acids and a 60-amino acid carboxyl-terminal homology domain (POUh). The expression of Oct4 is regulated by cis-acting elements and chromatin structure methylation upstream of the Oct4 gene at the transcriptional level (Klemm JD, et al., Cell, 1994, 77: 21-32; Brehm A, et al., Mol Cell Biol 1997, 17: 154-62). Yeom et al. analyzed the expression of LacZ reporter genes under the control of an 18Kb fragment from the Oct4 genomic locus and identified two elements, which they named as proximal enhancers (PE) and distal enhancers (DE) that may need to be regulated. They determined the precise binding sites of transcription factors in these two enhancers (Yeom Y, et al. Integrated Ann Indexes 1996; 122: 881-94). POU domain transcription factors bind to specific octamer DNA and regulate cell type-specific differentiation pathways. Among them, during the formation of iPSCs, Oct4 containing a POU domain and Sox2 containing an HMG domain are transcription factors that are crucial for maintaining the pluripotency of pluripotent cells (Nichols, J., et al., Cell, 1998, 95, 379-391; Avilion, A., et al., 2003, Genes Dev. 17, 126-140). They drive the transcription of target genes in pluripotent cells through a synergistic interaction between the two (Tomioka, M., et al. Nucleic Acids Res. 2002; 30, 3202-3213). These findings indicate that developmental transitions can be controlled by Oct4.Currently, the most widely used reprogramming methods overexpress Oct4 through viruses or other types of vectors (Takahashi K, et al., Cell, 2006, 126(4): 663-676; Takahashi K and Yamanaka S, Cell, 2007, 131(5): 861-872); Yu J, et al. Science. 2007; 318: 1917–1920). Such methods have potential clinical risks in the clinical use of induced pluripotent stem cells (iPSCs), such as the potential tumorigenicity risks associated with the use of viral vectors. In addition, the complex GMP production process of the vectors also complicates the clinical regulation of induced pluripotent stem cells. Furthermore, the use of vectors can lead to high costs for such products. Summary of the Invention
[0005] At present, compounds that bind to target proteins can be predicted based on protein structure prediction tools, and compounds that upregulate target proteins can be obtained through functional screening. At the same time, a variety of microRNAs (mirRNAs) have been found to downregulate Oct4 and show a high correlation with the regulation of the complex formed by Sox2 and Nanog. For example, mir-134, mir-145, mir-470 and mir-200c all show negative regulatory characteristics on Oct4, Sox2 and Nanog complexes (Esther E. Creemers 1, Anke J. Tijsen, Yigal M. Pinto, Circ Res, 2012 Feb 3; 110(3): 483-95). Therefore, inhibitory compounds can also be designed based on the structure of such regulatory microRNAs (mirRNAs) to inhibit such microRNAs (mirRNAs), thereby achieving positive regulation of Oct4 and Nanog complexes.
[0006] Based on the above reasons, the present invention designs pyrrolopyridine derivatives that can simultaneously bind to the Oct4 protein structure and the negative regulatory mirRNA structure that binds to the Oct4 complex. Pyrrolopyridine derivatives can chemically activate Oct4 and regulate the expression of its downstream genes. This avoids the use of viruses or other vectors to regulate Oct4, further realizing a safe and simple chemical small molecule to enhance biological expression function.
[0007] The present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, a pharmaceutical composition comprising the compound of formula (I) and its use as a highly selective Oct4 activator for cell reprogramming.
[0008] The present invention provides a compound of formula (I):
[0009]
[0010] in:
[0011] m1 and m2 are 0 or 1 respectively;
[0012] A2 is C1-C6 alkylene, C2-C6 alkenylene, -O(CH2)q-, -NR1-, -SO2-, -(CH2) V NHS(O)2- or a bond, wherein q is 1 or 2 or 3 or 4, V is 0 or 1 or 2, and R1 is selected from H or C1-C4 alkyl;
[0013] A3 is C1-C6 alkyl; C2-C6 alkenyl; C4-C6 cycloalkyl, one of the carbon atoms of which may be substituted by a N, O, or S heteroatom; Z and Z1 are independently N or CR2, R2 is selected from H, halogen, C1-C4 alkyl or cyano; Z3 is N, O, S or C=O, when the bond between Z4 and Z5 is a single bond, Z4 is N or CH, Z5 is CH2 or C=O, when the bond between Z4 and Z5 is a double bond, Z4 is C, Z5 is CH; or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof.
[0014] In some embodiments: A2 is -CH2-, -CH=CH-, -C(CH3)=CH-, -O(CH2)-, -O(CH2)2-, -NH-, -N(CH3)-, -SO2-, -NHS(O)2-, -(CH2)2NHS(O)2-, or a bond.
[0015] In some embodiments: A3 is -CH3, butenyl,
[0016] In some embodiments: m1 is 0, m2 is 1; A2 is -N(CH3)-; A3 is
[0017] In some embodiments: m1 is 1, m2 is 0; A2 is -CH2-, -SO2-, -(CH2)2NHS(O)2-, or a bond; A3 is -CH3,
[0018] In some embodiments: m1 is 1, m2 is 1; A2 is -CH2-, -NH-, -C(CH3)=CH-, or a bond; A3 is -CH3, -C(CH3)=CH-CH3,
[0019] In some embodiments: m1 is 0, m2 is 0; A2 is -CH2-, -CH=CH-, -O(CH2)-, -O(CH2)2-, or a bond;
[0020]
[0021] In some embodiments, the compound is selected from:
[0022]
[0023] The present invention relates to a pharmaceutical composition comprising any one of the compounds described above, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof, and at least one pharmaceutically acceptable carrier or excipient.
[0024] The present invention relates to the use of any one of the above compounds, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof in the preparation of a highly selective Oct4 activator for induced pluripotent stem cells.
[0025] The present invention relates to a compound according to any one of the above items, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof, for use in preparing a highly selective Oct4 activator for inducing pluripotent stem cells, wherein the diseases treated by the Oct4 highly selective activator for inducing pluripotent stem cells include at least one of cancer, heart disease, stroke, diabetes, obesity, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, myocardial infarction, muscular dystrophy, CMT-1A, spinal cord injury, traumatic brain injury, tooth loss, wound healing, bone marrow transplantation, osteoarthritis, rheumatoid arthritis, hair loss, blindness, deafness, Crohn's disease, genetic diseases and other similar diseases.
[0026] The present invention relates to a method for obtaining induced pluripotent stem cells in a subject suffering from a disease, comprising administering to the subject a therapeutically effective amount of any one of the above-mentioned compounds, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof.
[0027] In the methods of the present invention, the subject suffering from the disease refers to humans suffering from cancer, heart disease, stroke, diabetes, obesity, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, myocardial infarction, muscular dystrophy, CMT-1A, spinal cord injury, traumatic brain injury, tooth loss, wound healing, bone marrow transplantation, osteoarthritis, rheumatoid arthritis, hair loss, blindness, deafness, Crohn's disease, genetic diseases and other similar diseases.
[0028] The present invention relates to a method for activating Oct4, comprising contacting any one of the above compounds, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof with an Oct4 target protein. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 The results show the effect of pyrrolopyridine derivative small molecules on the expression of its downstream gene Nanog (CK is the control group);
[0030] Figure 2 Shown are the results of the effects of pyrrolopyridine derivative small molecules on the basal expression of Oct4 (CK is the control group);
[0031] Figure 3 The upper part shows the change of the corrected heat rate (Corrected Heat Rate, in μJ / s) of the solution in the sample pool over time (Time, in s); the pulse curve a shows the change of the heat release of the combination of miR-145 and A-3-6 in the sample pool over time (i.e., as the titration proceeds); the pulse curve b shows the change of the heat release of the combination of deionized water and A-3-6 in the sample pool over time (i.e., as the titration proceeds). Figure 3 Curve c in the lower half shows the change in the reaction binding enthalpy (Enthalpy) when each droplet enters the sample cell when the A-3-6 solution is used to titrate DEPC water (i.e., ultrapure water) that does not contain the nucleic acid miR-145 (expressed as ΔH, in kJ / mol). The change curve is fitted (Fit) according to the Multiple Sites model, which is used to exclude false positives caused by small molecule dilution exotherm when titrating A-3-6; Curve d shows the change in the reaction binding enthalpy (ΔH, in kJ / mol) when each droplet enters the sample cell as the molar ratio (Mole Ratio) of A-3-6 to miR-145 in the titration cell changes. The change curve is fitted according to the Multiple Sites model. DETAILED DESCRIPTION
[0032] In the present invention, the following definitions are applicable:
[0033] The term "alkyl" herein refers to a straight or branched chain saturated hydrocarbon containing 1 to 12 carbon atoms. Examples of (C1-C6) alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, pentyl, hexyl, isopropyl, isobutyl, sec-butyl, tert-butyl, isopentyl, neopentyl, and isohexyl.
[0034] The term "alkenyl" refers to a straight or branched chain unsaturated hydrocarbon containing 2 to 12 carbon atoms and containing at least one C=C double bond in the chain. Examples of alkenyl include ethenyl, propenyl, n-butenyl, isobutenyl, pentenyl or hexenyl.
[0035] The term "alkylene" refers to a divalent alkyl group. Any of the monovalent alkyl groups can be converted to an alkylene group by removing the second hydrogen atom from the alkyl group. As defined herein, an alkylene group can also be a C1-C6 alkylene group. An alkylene group can further be a C1-C4 alkylene group. Typical alkylene groups include, but are not limited to, -CH2-, -CH(CH3)-, -C(CH3)2-, -CH2CH2-, -CH2CH(CH3)-, -CH2C(CH3)2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, and the like.
[0036] The term "alkenylene" refers to a divalent alkenyl group. Any of the monovalent alkenyl groups can be converted to an alkenyl group by abstracting the second hydrogen atom from the alkenyl group. As defined herein, an alkenyl group can further be a C2-C6 alkenyl group. Typical alkenyl groups include, but are not limited to, -CH=CH-, -CH=C(CH3)-, -CH=CHCH2-, -CH=CHCH2CH2-, -CH=CHCH2CH2CH2-, -CH=CHCH2CH2CH2-, and the like.
[0037] The term "cycloalkyl" refers to a monocyclic saturated carbocyclic ring containing 3 to 18 carbon atoms. The cycloalkyl group may further be a C4-C6 cycloalkyl group. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like.
[0038] The term "halogen" refers to fluorine, chlorine, bromine or iodine.
[0039] The term "cyano" refers to a substituent having a carbon atom connected to a nitrogen atom by a triple bond (ie, C≡N).
[0040] The term "substituted" as used herein refers to the replacement of any one or more hydrogen atoms on a designated atom or group with a group selected from the designated range, provided that the normal valence of the designated atom is not exceeded.
[0041] In certain embodiments described herein, provided herein are compounds of formula (I), wherein when A2 is a "bond," the structure of the compound of formula (I) is:
[0042] The compounds described herein include, but are not limited to, their optical isomers, racemates, and other mixtures. In these cases, individual enantiomers or diastereomers, i.e., optically active configurations, can be obtained by asymmetric synthesis or by resolving the racemates or diastereomeric mixtures. Resolving the racemates or diastereomeric mixtures can be accomplished by conventional methods, such as crystallization in the presence of a resolving agent or chromatography using, for example, a chiral high pressure liquid chromatography (HPLC) column. In addition, these compounds include R- and S-configurations of compounds having chiral centers. These compounds also include crystalline forms, including polymorphs and inclusion compounds. Similarly, the term "salt" also includes all isomers, racemates, other mixtures, R- and S-configurations, tautomers, and crystalline forms of the salts of the compounds.
[0043] "Pharmaceutically acceptable salts" refer to salts of free acids or bases of compounds represented by Formula (I), Formula (II) or Formula (III) that are non-toxic, biologically tolerable, or otherwise biologically suitable for administration to a subject. See generally: SM Berge, et al., "Pharmaceutical Salts", J. Pharm. Sci., 1977, 66: 1-19, and Handbook of Pharmaceutical Salts, Properties, Selection, and Use, Stahl and Wermuth, Eds., Wiley-VCH and VHCA, Zurich, 2002. Preferably, pharmaceutically acceptable salts are those that are pharmacologically effective and suitable for contact with patient tissues without undue toxicity, irritation, or allergic reaction. Compounds of Formula (I), Formula (II) or Formula (III) may have sufficient acidic groups, sufficient basic groups, or both types of functional groups, and react accordingly with some inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, hydrochloride, hydrobromide, hydroiodide, acetate, propionate, decanoate, octanoate, acrylate, formate, isobutyrate, hexanoate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, gamma-hydroxybutyrate, glycolate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, and mandelate.
[0044] "Solvates" such as "hydrates" are formed by the interaction of a solvent with a compound. The term "compound" includes solvates of the compound, including hydrates. Similarly, "salt" includes solvates of the salt, such as hydrates. Suitable solvates are pharmaceutically acceptable solvates, such as hydrates, including monohydrates and hemihydrates.
[0045] "Prodrug" may refer to a precursor of a given compound that, after administration to a subject, undergoes chemical or physiological processes (e.g., solvolysis, enzymatic decomposition) or under physiological conditions (e.g., conversion of the prodrug to a compound of Formula (I) at physiological pH) in vivo to yield the compound. A "pharmaceutically acceptable prodrug" is a prodrug that is non-toxic, biologically tolerated, or otherwise biologically suitable for administration to a subject. Exemplary procedures for selecting and preparing suitable prodrug derivatives are described, for example, in "Design of Prodrugs," edited by H. Bundgaard, Elsevier, 1985.
[0046] "Active metabolites" refer to pharmaceutically active products metabolized in vivo by compounds of formula (I), (II) or (III) or their salts. Prodrugs and active metabolites of compounds can be determined using conventional techniques known or available in the art. See, for example, Bertolini et al., J. Med. Chem. 1997, 40, 2011-2016; Shan et al., J. Pharm. Sci. 1997, 86(7), 765-767; Bagshawe, Drug Dev. Res. 1995, 34, 220-230; Bodor, Adv. Drug Res. 1984, 13, 224-331; Bundgaard, Design of Prodrugs (Elsevier Press, 1985); and Larsen, Design and Application of Prodrugs, Drug Design and Development (Krogsgaard-Larsen et al., eds., Harwood Academic Publishers, 1991).
[0047] A "therapeutically effective amount" refers to an amount of a compound disclosed herein that is sufficient, when administered to a mammal, preferably a human, to effect treatment (as defined below) of a disease or condition in the mammal, preferably a human. The amount of a disclosed compound that constitutes a "therapeutically effective amount" will vary with the compound, the condition and its severity, and the age of the mammal being treated, but can be routinely determined by one of ordinary skill in the art based on his or her knowledge and the disclosure herein.
[0048] The term "treating" refers to administering to an individual a compound as described herein, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, or a combination thereof, preferably at least one compound as described herein and / or at least one pharmaceutically acceptable salt thereof, to slow (reduce) an undesirable physiological change or disease, such as the development or spread of inflammation or cancer. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in severity of disease, stabilization (i.e., non-worsening) of the disease state, delay or slow progression of disease, improvement or palliation of the condition, and alleviation (whether partial or complete) of the disease, whether detected or undetectable. "Treatment" also means that survival can be prolonged compared to the expected survival if not receiving treatment. Individuals in need of treatment include individuals who have symptoms of or are suffering from these diseases.
[0049] Pharmaceutical composition
[0050] The present invention provides a pharmaceutical composition comprising a compound described herein, or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, or prodrug thereof, or a combination thereof as an active ingredient, preferably one or more compounds described herein or a pharmaceutically acceptable salt or ester thereof as an active ingredient; and one or more pharmaceutically acceptable excipients, carriers, including inert solid diluents and fillers, diluents, including sterile aqueous solutions and various organic solvents, penetration enhancers, solubilizers, and adjuvants. The pharmaceutical composition can be administered alone or in combination with other therapeutic agents. Such compositions are prepared in a manner well known in the pharmaceutical art.
[0051] The pharmaceutical compositions can be administered in single or multiple doses by any of the acceptable modes of administration for similarly used pharmaceutical agents, such as those described in the patents and patent applications incorporated herein by reference, including rectal, buccal, intranasal and transdermal routes, by intraarterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, orally, topically, as an inhalant, or by implanted or coated devices such as stents, for example, or arterial insertion of pillar polymers.
[0052] The present invention also provides a kit comprising a pharmaceutical composition comprising the compound of the present invention or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier.
[0053] "Pharmaceutically acceptable carrier or excipient" refers to a non-toxic, biologically tolerable, and other biologically suitable substance for administration to an individual, such as an inert substance, which is added to a pharmacological composition or used as a vehicle, carrier, or diluent to facilitate administration of the active ingredient and is compatible therewith. Examples of excipients include calcium carbonate, calcium phosphate, various types of sugars or starches, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.
[0054] “Combination thereof”: It should be understood that “combination thereof” refers to a combination of two or more of a compound, a pharmaceutically acceptable salt thereof, a pharmaceutically acceptable solvate thereof, a pharmaceutically acceptable active metabolite thereof, a pharmaceutically acceptable polymorph thereof, a pharmaceutically acceptable ester thereof, a pharmaceutically acceptable optical isomer thereof, and a pharmaceutically acceptable prodrug thereof.
[0055] Uses of compounds and compositions thereof
[0056] The present invention provides a compound and a composition thereof, which are mainly used as highly selective Oct4 activators for activating Oct4 function, and regulating the expression of its downstream genes through chemical regulation of the Oct4 promoter, thereby inducing pluripotent stem cells in subjects suffering from diseases, thereby achieving the purpose of treating the diseases. The diseases include cancer, heart disease, stroke, diabetes, obesity, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, myocardial infarction, muscular dystrophy, CMT-1A, spinal cord injury, traumatic brain injury, tooth loss, wound healing, bone marrow transplantation, osteoarthritis, rheumatoid arthritis, hair loss, blindness, deafness, Crohn's disease, genetic diseases and other similar diseases.
[0057] List of abbreviations used in the following examples and elsewhere herein:
[0058] CH2Cl2: dichloromethane; Cs2CO3: cesium carbonate; Cu2SO4: cuprous sulfate; DCM: dichloromethane; DMAC: N,N-dimethylacetamide; DMF: N,N-dimethylformamide; DIEA: N,N-diisopropylethylamine; DIOX: 1,4-dioxane; EA: acetic acid; Et3N: triethylamine; ETOH: ethanol; EtOAc: ethyl acetate; FA: formic acid; g: gram; h: hour; HATU: 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate; HBr: hydrobromic acid; (Hbim)BF4: 1-butylimidazole tetrafluoroborate; H2O: water; H Ac: acetic acid; H2O2: hydrogen peroxide; H2SO4: fuming sulfuric acid; KCN: potassium cyanide; K2CO3: potassium carbonate; MCA: chloroacetic acid; MeCN: acetonitrile; MeOH: methanol; mg: milligram; mL: milliliter; mmol: millimole; mol: mole; mol / L: mole / liter; m / z: mass-to-charge ratio; N2: nitrogen; NaBH3CN: sodium cyanoborohydride; NaNO2: sodium nitrite; NaOH: sodium hydroxide; Na2SO4: sodium sulfate; pH: pH; TBN: tert-butyl nitrosoate; TEA: triethanolamine; THF: tetrahydrofuran; TLC: thin-layer chromatography; μL: microliter; Xylene: xylene.
[0059] The following, along with the accompanying drawings and examples of the present invention, further illustrates the technical means employed by the present invention to achieve its intended objectives. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The raw materials, reagents, and other materials used in the following examples, unless otherwise specified, are commercially available products.
[0060] Universal synthesis
[0061] The general synthetic routes described in this application can be varied by replacing the starting materials with other raw materials having similar structures, thereby obtaining different products accordingly. The following synthetic route descriptions give multiple examples of how the starting materials can be varied to obtain the corresponding products.
[0062] General Method A-1-n
[0063]
[0064] Where R is wherein q is 1 or 2 or 3 or 4, Z and Z1 are N or CR2, and R2 is selected from H, halogen, C1-C4 alkyl or cyano.
[0065] General Method A-3-n
[0066]
[0067] wherein R is a C2-C6 alkenyl group; Wherein, q is 0 or 1 or 2 or 3 or 4, Z and Z1 are N or CR2 respectively, R2 is selected from H, halogen, C1-C4 alkyl or cyano, R1 is selected from H or C1-C4 alkyl, and Z3 is N, O, S or C=O.
[0068] General Method A-4-n
[0069]
[0070] Where R is wherein q is 0 or 1 or 2 or 3 or 4, Z and Z1 are N or CR2 respectively, and R2 is selected from H, halogen, C1-C4 alkyl or cyano.
[0071] General Method A-6-n
[0072]
[0073] Wherein R is a C4-C6 cycloalkyl group, one of the carbon atoms of which may be substituted by a heteroatom such as N, O, or S; or R=O is wherein q is 0 or 1 or 2 or 3 or 4, Z and Z1 are N or CR2 respectively, and R2 is selected from H, halogen, C1-C4 alkyl or cyano.
[0074] Intermediate synthesis
[0075] Intermediate Ⅰ-3: 1H-pyrrolo[2,3-c]pyridin-5-ol
[0076] Synthesis route:
[0077]
[0078] Step 1: Intermediate 1H-pyrrolo[2,3-c]pyridine-5-diazo Ⅰ-2
[0079] To 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (66.6 mg, 0.5 mmol) was added water (2 mL) and 20% H2SO4 aqueous solution (1 mL). Under ice cooling, a sodium nitrite aqueous solution (42 mg, 0.6 mmol) solution (0.5 mL) and acetonitrile (2 mL) were added to the mixture, and the mixture was stirred for 30 minutes. To the obtained reaction mixture was added a solution of Cu2SO4 (67 mg, 0.3 mmol) in a 20% HBr aqueous solution (0.5 mL) at room temperature, and the mixture was stirred at 80 ° C for 30 minutes. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, rinsed with brine, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol=50:1) to give 1H-pyrrolo[2,3-c]pyridine-5-diazonium Ⅰ-2-hydrogen sulfate (94 mg, 78%), liquid chromatography-mass spectrometry m / z=145.1[M]+.
[0080] Step 2: Intermediate 1H-pyrrolo[2,3-c]pyridin-5-ol Ⅰ-3
[0081] A solution (1 mL) of the hydrogen sulfate salt of the above-mentioned 1H-pyrrolo[2,3-c]pyridine-5-diazonium I-2 (48 mg, 0.2 mmol) was added dropwise to a 40% aqueous sulfuric acid solution (5 mL) at 100°C, and the mixture was stirred for 10 minutes. NaOH was added to the resulting reaction mixture until the pH reached approximately 3. Ethyl acetate was added to the reaction mixture, and the organic layer was separated, washed with brine, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 50:1) to afford 1H-pyrrolo[2,3-c]pyridin-5-ol I-3 (20 mg, 77%). The liquid chromatography mass spectrum indicated m / z = 135.1 [M+H]+.
[0082] Example 1: ((1H-pyrrolo[2,3-c]pyridin-5-yl)oxy)methyl)benzonitrile A-1-1
[0083]
[0084] Steps: 1H-pyrrolo[2,3-c]pyridin-5-ol I-3 (10 mg, 0.07 mmol) was mixed with 3-(bromomethyl)benzonitrile (20 mg, 0.1 mmol) and K2CO3 (138 mg, 1 mmol), acetonitrile (2 mL) was added, and the mixture was heated to 40°C and stirred for 10 minutes. Ethyl acetate and water were added to the reaction mixture, the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:methanol=40:1) to give 3-((1H-pyrrolo[2,3-c]pyridin-5-yl)oxy)methyl)benzonitrile A-1-1 (11 mg, 63%), liquid chromatography mass spectrum m / z=250.1 [M+H]+
[0085] Example 2: 5-phenylethoxy-1H-pyrrolo[2,3-c]pyridine A-1-2
[0086]
[0087] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-ol I-3 (10 mg, 0.07 mmol) was mixed with (2-bromoethyl)benzene (22 mg, 0.12 mmol) and K2CO3 (138 mg, 1 mmol). Acetonitrile (2 mL) was added and the mixture was heated to 40°C and stirred for 10 minutes. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:methanol = 40:1) to afford 5-phenylethoxy-1H-pyrrolo[2,3-c]pyridine A-1-2 (13 mg, 78%). LC-MS / MS: m / z = 239.1 [M+H]+.
[0088] Example 3: (1H-pyrrolo[2,3-c]pyridin-5-yl)isoindol-1-one A-2
[0089]
[0090] Synthesis route:
[0091]
[0092] Procedure: Combine 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) and 2-formylbenzoic acid (18 mg, 0.12 mmol). Add formic acid (0.2 mL), triethylamine (1 mL), and ethanol (1 mL). Heat the mixture to 80°C and stir for 60 minutes. Add ethyl acetate and water to the reaction mixture, separate the organic layer, dry it over sodium sulfate, and concentrate under reduced pressure. The residue is purified by silica gel column chromatography (dichloromethane:ethyl acetate = 20:1) to afford (1H-pyrrolo[2,3-c]pyridin-5-yl)isoindol-1-one A-2 (15 mg, 60%). LC-MS / MS: m / z = 250.3 [M+H].
[0093] Example 4: (1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-3-carboxamide A-3-1
[0094]
[0095] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with thiophene-2-carboxylic acid (15 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7) to afford N-(1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-3-carboxamide A-3-1 (10 mg, 41%), with a liquid chromatography mass spectrum of m / z = 244.1 [M+H].
[0096] Example 5: (E)-2-methyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)but-2-enamide A-3-2
[0097]
[0098] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with (E)-2-methyl-2-enoic acid (12 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane=3:7) to give (E)-2-methyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)but-2-enamide A-3-2 (11 mg, 51%), liquid chromatography-mass spectrometry m / z=216.1 [M+H]+.
[0099] Example 6: N-(1H-pyrrolo[2,3-c]pyridin-5-yl)-2,3-dihydrobenzofuran-2-carboxamide A-3-3
[0100]
[0101] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with benzofuran-2-carboxylic acid (19 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3:7) to give N-(1H-pyrrolo[2,3-c]pyridin-5-yl)-2,3-dihydrobenzofuran-2-carboxamide A-3-3 (13 mg, 46%), liquid chromatography-mass spectrum m / z = 280.1 [M+H] +.
[0102] Example 7: 3,4-dichloro-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzamide A-3-4
[0103]
[0104] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with 3,4-dichlorobenzoic acid (23 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3:7) to give 3,4-dichloro-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzamide A-3-4 (13 mg, 43%), LC-MS m / z = 306.0 [M+H] +.
[0105] Example 8: N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzothiophene-2-carboxamide A-3-5
[0106]
[0107] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with benzothiophene-2-carboxylic acid (21 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3:7) to give N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzothiophene-2-carboxamide A-3-5 (14 mg, 48%), liquid chromatography-mass spectrometry m / z = 294.1 [M+H] +.
[0108] Example 9: 2-phenyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)acetamide A-3-6
[0109]
[0110] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with 2-phenylacetic acid (16 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7) to afford 2-phenyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)acetamide A-3-6 (12 mg, 48%), with a liquid chromatography mass spectrum of m / z = 252.1 [M+H].
[0111] Example 10: 1-(1H-pyrrolo[2,3-c]pyridin-5-yl)-3-(p-tolyl)urea A-4-1
[0112]
[0113] Step 1: p-Nitrophenyl p-tolueneaminocarbonate I-9-1
[0114]
[0115] p-Toluidine (21 mg, 0.2 mmol) was mixed with 4-nitrophenylcarbonyl chloride (48 mg, 0.24 mmol), and triethanolamine (0.2 mL), dichloromethane (1 mL), and tetrahydrofuran (2 mL) were added. The mixture was stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:hexane = 5:1) to afford p-nitrophenyl p-toluenecarboxamidocarbonate I-9-1 (42 mg, 77%). LC-MS / MS: m / z = 273.1 [M+H]+.
[0116] Step 2: 1-(1H-pyrrolo[2,3-c]pyridin-5-yl)-3-(p-tolyl)urea A-4-1
[0117] The above-mentioned p-nitrophenyl p-toluenecarbamate I-9-1 (27 mg, 0.1 mmol) was mixed with 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (16 mg, 0.12 mmol) and K2CO3 (0.2 g, 1.45 mmol), acetonitrile (3 mL) was added and heated to 40 ° C. and stirred for 4 hours. After the reaction was completed (monitored by TLC), the reaction mixture was separated and concentrated in vacuo. The crude reaction mixture thus obtained was washed with dichloromethane, then with EtOAc, and finally with MeOH (1 mL each). Finally, the reaction product was recrystallized using EtOAc (under warm conditions) to obtain pure 1-(1H-pyrrolo[2,3-c]pyridin-5-yl)-3-(p-tolyl)urea A-4-1 (22 mg, 83%), liquid phase mass spectrum m / z=267.1[M+H]+.
[0118] Example 11: 1-(3-bromophenyl)-3-(1H-pyrrolo[2,3-c]pyridin-5-yl)urea A-4-2
[0119]
[0120] Step 1: 4-nitrophenyl (3-bromophenyl) aminocarbonate I-9-2
[0121]
[0122] 3-Bromoaniline (34 mg, 0.2 mmol) was mixed with 4-nitrophenylcarbonyl chloride (48 mg, 0.24 mmol), and triethanolamine (0.2 mL), dichloromethane (1 mL), and tetrahydrofuran (2 mL) were added. The mixture was stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:hexane = 5:1) to afford 4-nitrophenyl (3-bromophenyl)carbamate I-9-2 (46 mg, 68%). LC-MS / MS: m / z = 338.1 [M+H]+.
[0123] Step 2: 1-(3-bromophenyl)-3-(1H-pyrrolo[2,3-c]pyridin-5-yl)urea A-4-2
[0124] The above-mentioned 4-nitrophenyl (3-bromophenyl) aminocarbonate I-9-2 (34 mg, 0.1 mmol) was mixed with 1H-pyrrolo [2,3-c] pyridine -5- amine I-1 (16 mg, 0.12 mmol) and K2CO3 (0.2 g, 1.45 mmol), acetonitrile (3 mL) was added and heated to 40 ° C and stirred for 4 hours. After the reaction was completed (monitored by TLC), the reaction mixture was separated and concentrated in a vacuum. The crude reaction mixture thus obtained was washed with dichloromethane, then washed with EtOAc, and finally washed with MeOH (each 1 mL). Finally, the reaction product was recrystallized using EtOAc (under warm conditions) to obtain pure 1- (3-bromophenyl) -3- (1H-pyrrolo [2,3-c] pyridine -5- bases) urea A-4-2 (25 mg, 75%), liquid phase mass spectrum m / z = 331.2 [M + H] +.
[0125] Example 12: N-methyl-N-phenyl-1H-pyrrolo[2,3-c]pyridine-5-carboxamide A-5
[0126]
[0127] Synthesis line:
[0128]
[0129] Step 1: 5-Nitro-1H-pyrrolo[2,3-c]pyridine Ⅰ-10
[0130]
[0131] To a solution of H₂O₂ (240 mg, 2.2 mmol) in fuming sulfuric acid (500 μL) was added dropwise a solution of 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (40 mg, 0.3 mmol) in concentrated sulfuric acid (100 μL), maintaining the reaction temperature at 0°C. After stirring at 10-25°C for 3 h, the reaction mixture was brought to pH 11-12 by the addition of 40% aqueous NaOH at 0-5°C. The resulting mixture was extracted with ethyl acetate. The combined organic layers were washed with saturated aqueous sodium chloride, dried over Na₂SO₄, and filtered. The solvent was removed by distillation under reduced pressure to yield the desired 5-nitro-1H-pyrrolo[2,3-c]pyridine I-10 (39 mg, 80%), LC-MS m / z = 164.0 [M+H]⁺.
[0132] Step 2: 1H-pyrrolo[2,3-c]pyridine-5-carboxylic acid Ⅰ-11
[0133]
[0134] The above-mentioned 5-nitro-1H-pyrrolo[2,3-c]pyridine I-10 (39 mg, 0.24 mmol) was mixed with KCN (195 mg, 3 mmol), and 1-butylimidazole tetrafluoroborate (3 mg, 0.014 mmol), EtOH (2 mL), and water (2 mL) were added. The mixture was heated to 80°C and stirred for 19 hours. Then, 10 mL of water was added, and the mixture was extracted with CH2Cl2 (3 × 5 mL) and diethyl ether (3 × 10 mL). The mixture was acidified to pH 1-2 with hydrochloric acid and extracted with diethyl ether (3 × 10 mL). Magnesium sulfate (3 g) and activated carbon (1 g) were added and stirred for 5 hours. The solid was filtered, the filtrate was evaporated, and the residue was crystallized from the corresponding solvent to obtain the desired 1H-pyrrolo[2,3-c]pyridine-5-carboxylic acid I-11 (16 mg, 41%). LC-MS m / z = 163.0 [M+H]+.
[0135] Step 3: N-Methyl-N-phenyl-1H-pyrrolo[2,3-c]pyridine-5-carboxamide A-5
[0136] The above-mentioned 1H-pyrrolo[2,3-c]pyridine-5-carboxylic acid I-11 (16 mg, 0.1 mmol) was mixed with N-methylaniline (13 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7), and the solvent was evaporated under reduced pressure to obtain N-methyl-N-phenyl-1H-pyrrolo[2,3-c]pyridine-5-carboxamide A-5 (18 mg, 72%). The liquid chromatography mass spectrum was m / z = 252.1 [M+H]+.
[0137] Example 13: N-(tetrahydro-2H-pyran-4-yl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-1
[0138]
[0139] 1H-pyrrolo[2,3-c]pyridine-5-amine I-1 (13mg, 0.1mmol) is mixed with tetrahydro-4H-pyran-4-one (12mg, 0.12mmol), methanol (2mL) is added, stirred at room temperature for 2 hours, then sodium cyanoborohydride (20mg, 0.3mmol) is added, stirred at room temperature for 2 hours. Then NaOH aqueous solution (10mL, 0.3mol / L) is added to the mixture. The resulting mixture is extracted with DCM (20mL x 3). The combined organic phase is dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5:1), and the solvent was distilled off under reduced pressure to give N-(tetrahydro-2H-pyran-4-yl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-1 (18 mg, 83%), liquid chromatography-mass spectrum m / z = 218.1 [M+H] +.
[0140] Example 14: N-(Pyridin-4-ylmethyl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-2
[0141]
[0142] 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with isonicotinaldehyde (13 mg, 0.12 mmol), methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours. Then, sodium cyanoborohydride (20 mg, 0.3 mmol) was added and stirred at room temperature for 2 hours. Aqueous NaOH (10 mL, 0.3 mol / L) was then added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to yield N-(pyridin-4-ylmethyl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-2 (16 mg, 71%), with a liquid chromatography mass spectrum of m / z = 225.1 [M+H].
[0143] Example 15: N-cyclobutyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-3
[0144]
[0145] 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with cyclobutanone (8 mg, 0.12 mmol), methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours. Then, sodium cyanoborohydride (20 mg, 0.3 mmol) was added and stirred at room temperature for 2 hours. Aqueous NaOH (10 mL, 0.3 mol / L) was then added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to yield N-cyclobutyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-3 (15 mg, 80%), with a liquid chromatography mass spectrum of m / z = 188.1 [M+H].
[0146] Example 16: 2-(1H-pyrrolo[2,3-c]pyridin-5-yl)isoindole-1,3-dione A-7
[0147]
[0148] Synthesis route:
[0149]
[0150] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with isobenzofuran-1,3-dione (18 mg, 0.12 mmol). N,N-dimethylacetamide (2 mL) was added and the mixture was stirred at room temperature for 24 hours. Xylene (1 mL) was then added and the mixture was stirred in an oil bath at 140°C for 48 hours. After completion (monitored by TLC), the insoluble catalyst was separated by filtration, washed with acetone, and dried. The organic layer was concentrated under reduced pressure to yield the desired product, which was then washed with water and recrystallized from ethanol. The crude product was purified by silica gel column chromatography (CH2Cl2 / n-hexane = 1:1). The solvent was then removed by distillation under reduced pressure to yield 2-(1H-pyrrolo[2,3-c]pyridin-5-yl)isoindole-1,3-dione A-7 (20 mg, 76%), with a liquid chromatography mass spectrum of m / z = 264.1 [M+H]+.
[0151] Example 17: N-phenyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-8
[0152]
[0153] Synthesis route:
[0154]
[0155] Steps: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with iodobenzene (24 mg, 0.12 mmol), (N,N-bipyridyl imidazole) copper dibromide (10 mg, 0.023 mmol), and cesium carbonate (100 mg, 0.3 mmol). 1,4-dioxane (5 mL) was added and stirred in an oil bath at 170 ° C for 12 hours. Then, aqueous NaOH solution (10 mL, 0.3 mol / L) was added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5:1), and the solvent was distilled off under reduced pressure to give N-phenyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-8 (19 mg, 91%), liquid chromatography-mass spectrometry m / z = 210.1 [M+H] +.
[0156] Example 18: (E)-5-phenylvinyl-1H-pyrrolo[2,3-c]pyridine A-9
[0157]
[0158] Synthesis route:
[0159]
[0160] Steps: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with styrene (13 mg, 0.12 mmol), bis(dibenzylideneacetone)-palladium (0) (5 mg, 0.0087 mmol), tert-butyl nitrosoate (0.5 mL), chloroacetic acid (0.5 mL), acetic acid (3 mL) and stirred in an oil bath at 50 ° C for 2 hours. Then, an aqueous NaOH solution (10 mL, 0.3 mol / L) was added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to give (E)-5-phenylvinyl-1H-pyrrolo[2,3-c]pyridine A-9 (15 mg, 68%), liquid chromatography-mass spectrometry m / z = 221.1 [M+H] +.
[0161] Example 19: N-(1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-2-sulfonamide A-10
[0162]
[0163] Synthesis route:
[0164]
[0165] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with thiophene-2-sulfonyl chloride (22 mg, 0.12 mmol), triethylamine (0.5 mL) and dichloromethane (3 mL) were added, and the mixture was stirred at room temperature under nitrogen for 24 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7), and the solvent was removed by distillation under reduced pressure to obtain N-(1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-2-sulfonamide A-10 (14 mg, 50%). LC-MS / MS: m / z = 280.0 [M+H]+.
[0166] Example 20: N-(2-((1H-pyrrolo[2,3-c]pyridin-5-yl)amino)ethyl)methanesulfonamide A-11
[0167]
[0168] Synthesis route:
[0169]
[0170] Step 1: N1-(1H-pyrrolo[2,3-c]pyridin-5-yl)ethane-1,2-diamine I-19
[0171]
[0172] 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (26 mg, 0.2 mmol) and 2-bromoethane-1-amine I-18 (29 mg, 0.24 mmol) were mixed, water (5 mL) was added, and the mixture was stirred in an oil bath at 95°C for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The mixture was purified by flash chromatography on silica gel (CH2Cl2methanol-ammonia water) to obtain the desired product. The solvent was removed by distillation under reduced pressure to obtain N1-(1H-pyrrolo[2,3-c]pyridin-5-yl)ethane-1,2-diamine I-19 (24 mg, 68%), with a liquid chromatography mass spectrum of m / z = 177.1 [M+H]+.
[0173] Step 2: N-(2-((1H-pyrrolo[2,3-c]pyridin-5-yl)amino)ethyl)methanesulfonamide A-11
[0174] The above-mentioned N-(1H-pyrrolo[2,3-c]pyridin-5-yl)ethane-1,2-diamine I-19 (24 mg, 0.13 mmol) was mixed with methanesulfonyl chloride I-20 (28 mg, 0.16 mmol), dichloromethane (5 mL) was added, and the mixture was stirred in an ice-water bath for 24 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7), and the solvent was evaporated under reduced pressure to obtain N-(2-((1H-pyrrolo[2,3-c]pyridin-5-yl)amino)ethyl)methanesulfonamide A-11 (12 mg, 36%). The liquid chromatography-mass spectra indicated a m / z of 255.1 [M+H]+.
[0175] Small molecule binding energy prediction:
[0176] The present invention adopts two compound prediction methods to predict pyrrolopyridine derivatives, and the methods are as follows:
[0177] Method 1: Protein structure docking prediction
[0178] The pyrrolopyridine derivative molecules in Examples 1-20 were molecularly docked with the Oct4 target protein using AutoDockVina and LeDock software, respectively, to produce 10 docking conformations. The binding energy and ligand efficiency of the optimal docking result of each pyrrolopyridine molecule and the Oct4 target protein were calculated, and the docking results were comprehensively analyzed for pyrrolopyridine molecule screening. The specific docking results are shown in Table 1: The second and third columns of the table are the binding free energies (binding energy) calculated by autodockvina and LeDock molecular docking software, respectively. The more negative the value, the stronger the binding ability of the small molecule ligand to the target protein. The fourth column of the table represents the ligand efficiency (ligand efficiency) calculated by LeDock. The greater the absolute value, the stronger the potential for small molecule activity. In the present invention, the binding energy level of the compound according to the present invention is predicted based on the independent algorithms of the two softwares. The predicted values show that the binding energy of the compound in the present invention is much greater than the threshold value 3 set according to the target feature of the present invention.
[0179] Table 1. Prediction of binding energy between pyrrolopyridine derivative molecules used in the present invention and target sequences
[0180]
[0181] Method 2: mir-RNA structure docking prediction:
[0182] The affinity of miR-145 for small molecules was predicted using a new computational tool, RLDOCK software. RLDOCK is a physical deformation-based model for predicting ligand-RNA binding ability. It employs a novel global multi-step search algorithm for binding sites, optimizing search efficiency and stability, enabling the algorithm to effectively predict unknown binding sites. During the RLDOCK multi-step calculation, a comprehensive scan of possible binding sites on the miR-145 structure and the possible binding poses of small molecules at these sites is performed. All binding possibilities are then scored and ranked using the minimum Lennard-Jones potential energy scoring function. The results are shown in Table 2. The score is a negative value; the larger the absolute value, the stronger the ligand-RNA affinity. RLDOCK's final score is the sum of the values of the different energy functions it employs. Currently, the number of validated and available RNA targets is limited, and there is no mature computational system capable of distinguishing the threshold for actual interactions. This method prioritizes the validation of high-ranking molecules based on predicted binding energies.
[0183] Table 2: Prediction of binding energy of pyrrolopyridine derivatives with target mir-RNA
[0184]
[0185]
[0186] Through Oct4 protein structure docking prediction and mir-145 structure docking prediction, it was found that pyrrolopyridine derivatives showed large binding energy in both structure docking predictions. Therefore, it was speculated that pyrrolopyridine derivatives have the ability to enhance the expression of Oct4. Therefore, isothermal titration calorimetry and cytological experiments were used to verify the expression-enhancing effect of pyrrolopyridine derivatives on Oct4, thereby verifying the highly selective activation effect of pyrrolopyridine derivatives on Oct4.
[0187] Isothermal titration calorimetry was used to verify the interaction between small molecule compounds and target nucleic acids:
[0188] Isothermal titration calorimetry (ITC) utilizes the principle of power compensation to accurately measure the enthalpy change of intermolecular interactions across a wide range of concentrations using a single concentration scan. This measurement of the heat change during binding provides a comprehensive thermodynamic profile of nucleic acid-ligand interactions. Quantifying the thermodynamic characteristics and energy of complexes is the molecular basis for analyzing interactions between miR-145 and compounds. This study employed a Waters Nano-ITC titration calorimeter to validate nucleic acid-small molecule interactions in vitro.
[0189] The experimental procedure is as follows: a 300 μL, 50 μM solution of single-chain miR-145 is placed in a temperature-controlled sample cell. For example, a 50 μL, 500 μM solution of the small molecule A-3-6 (i.e., 2-phenyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)acetamide prepared in Example 9) is placed in an injector as a ligand and gradually injected (or titrated) into the sample cell. The heat change in the sample cell is measured relative to the reference cell, indicating an endothermic or exothermic peak. The instrument's built-in software fits the interaction model between the two reactants, directly calculating the reaction binding enthalpy (ΔH, kJ / mol), reaction binding entropy (ΔS, J / (mol·K)), number of binding sites (n), and binding equilibrium constant (Ka, M) between two or more molecules in solution. Kinetic data are then obtained through comprehensive calculations. Figure 3 The upper part shows the change of the corrected heat consumption power of the solution in the sample cell over time, wherein the pulse curve a shows the change curve of the heat release of the combination of miR-145 and A-3-6 in the sample cell over time (i.e., as the titration proceeds), and the pulse curve b shows the change curve of the heat release of the combination of DEPC water (blank control) and A-3-6 in the sample cell over time (i.e., as the titration proceeds). Figure 3 Curve c in the lower half shows the change in binding enthalpy (ΔH, kJ / mol) for each droplet entering the sample cell when titrating DEPC water containing no miR-145 with an A-3-6 solution. This curve is fitted using the Multiple Sites model to eliminate false positives due to small molecule dilution exotherms during A-3-6 titration. Curve d shows the change in binding enthalpy (ΔH) for each droplet entering the sample cell as the molar ratio of A-3-6 to miR-145 in the titration cell changes, fitted using the Multiple Sites model. Since the blank control does not contain a small nucleic acid molecule (miR-145), the slope of curve c only indicates that the exothermicity of the small molecule titration blank control is stable. The calculated binding sites (nSite) for A-3-6 and miR-145 solutions were n1 = 3 and n2 = 1.8, respectively, with Kd1 = 7.017E-8 and Kd2 = 7.544E-9, ΔH1 = -69.08 and ΔH2 = -137.2, ΔS1 = -9.474E1, and ΔS2 = -3.048E2. The above ITC experimental results demonstrate that the small molecule A-3-6 obtained in this invention specifically binds to the target single-stranded miR-145. Verification of the transcriptional expression differences induced by the small molecule:
[0190] The purpose of the present invention is to use highly selective activators to enhance the effect of target genes. The important function of such activators is to enhance the expression of Oct4, thereby increasing the expression abundance of Oct4 on downstream genes. Therefore, when verifying the function of the small molecules of the present invention, in addition to verifying the increase in the expression of the Oct4 gene itself, the increase in the expression of Nanog, a downstream gene of the Oct4 gene, is also an indicator of functional verification of the compounds of the present invention.
[0191] Human mesenchymal cells were cultured in T25 medium at a rate of 4 x 10 5 The cells were inoculated and cultured in serum-free Dulbecco's modified Eagle's medium (DMEM-F12 medium), to which 50 nM of the above-mentioned pyrrolopyridine derivative small molecules were added, and the culture conditions were 37°C and 5% carbon dioxide. On the 5th day, total RNA was extracted using RNeasy Mini or Micro Kit (QIAGEN), and 1 mg of RNA was synthesized into cDNA using SuperScript III First-Strand Synthesis System (Invitrogen). Quantitative PCR was labeled and reacted using SYBR Premix Ex Taq (TaKaRa) and Thermal Cycler Dice Real Time System (TaKaRa), and beta-Actin was used as an internal reference. All data were analyzed using the delta-Ct method. Three replicates were used for each experiment, and variance statistics were performed. The primer sequences used to identify the coding genes of different cell markers are shown in Table 3. The results are shown in Table 3. Figure 1 and Figure 2 As shown, compared with the control group without small molecules, the above pyrrolopyridine derivative small molecules significantly increased the basal expression of Oct4 and the expression of its downstream gene Nanog.
[0192] Table 3. QPCR primer sequences for compound-responsive genes
[0193] Oct4-F CCATGCATTCAAACTGAGGT Oct4-R CCTTTGTGTTCCCAATTCCTT Nanog-F ACCTCAGCTACAAACAGGTGAA Nanog-R AAAGGCTGGGGTAGGTAGGT βActin-F GGCCGAGGACTTTGATTGCACA βActin-R GGGCACGAAGGCTCATCATTCAA
Claims
1. Compounds of formula (I): in: m1 is 0, m2 is 1; A2 is -N(CH3)-; A3 is or a pharmaceutically acceptable salt thereof.
2. Compounds of formula (I): in: m1 is 1, m2 is 0; A2 is -CH2-, -SO2-, -(CH2)2NHS(O)2- or a bond; A3 is -CH3, or a pharmaceutically acceptable salt thereof.
3. Compounds of formula (I): m1 is 1, m2 is 1; A2 is -CH2-, -NH-, -C(CH3)=CH-, or a bond; A3-CH3、-C(CH3)=CH-CH3、 or a pharmaceutically acceptable salt thereof.
4. Compounds of formula (I): Formula (I) m1 is 0, m2 is 0; A2 is -CH2-, -CH=CH-, -O(CH2)-, -O(CH2)2-, or a bond; A3 is or a pharmaceutically acceptable salt thereof.
5. The following compound or a pharmaceutically acceptable salt thereof:
6. A pharmaceutical composition comprising a compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable excipient.
7. Use of the compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for a highly selective Oct4 activator of induced pluripotent stem cells.
Citation Information
Patent Citations
Enhancers of induced pluripotent stem cell reprogramming
US20140154805A1