Dmt06, a tetrahydrofolate-dependent dicamba monooxygenase gene, and use thereof

Abstract

The application discloses a tetrahydrofolate (THF) dependent dicamba demethylase gene dmt06 and application thereof, and a THF dependent dicamba demethylase gene amplified from a dicamba degradation enrichment liquid dmt06 , a nucleotide sequence of which is shown in SEQ ID NO. 1, and an amino acid sequence of a dicamba demethylase encoded by the gene is shown in SEQ ID NO. 2. The THF dependent dicamba demethylase gene dmt06 of the application has dicamba demethylase activity and degradation activity significantly higher than reported dicamba demethylases Dmt and Dmt50.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of dicamba monooxygenase gene, in particular to a tetrahydrofolate (THF)-dependent dicamba monooxygenase gene dmt06 and application thereof. BACKGROUND

[0002] In the past, present and future, pesticides play a major role in agricultural production, but the unscientific use of pesticides leads to excessive pesticide residues in water, soil and air, seriously endangering the natural environment and human health. The annual pesticide use in China is more than 300,000 tons (raw drug), and the utilization rate of pesticides is only 20-30%, the rest of which enters the ecological environment, leading to excessive pesticide residues in soil and agricultural products in China. Among the methods for treating residual pesticides, bioremediation, especially microbial remediation, is safe and effective, moderate in cost, and free of secondary pollution, suitable for large-area non-point source pollution remediation, and is the mainstream and development direction of soil organic pollutant remediation technology. Herbicide-resistant transgenic is an effective way to solve herbicide phytotoxicity, and the genes of herbicide-resistant transgenic are generally derived from microbial degradation genes.

[0003] Dicamba (3,6-dichloro-2-methoxybenzoic acid) is a broad-spectrum and highly effective herbicide that can kill glyphosate-resistant weeds and is a good target herbicide for herbicide-resistant transgenic. The degradation of dicamba in the environment is currently mainly microbial degradation, and a variety of dicamba-degrading strains have been screened. The initial step of microbial degradation of dicamba is demethylation to generate 3,6-dichlorosalicylate (3,6-DCSA) without herbicidal activity. Two types of dicamba demethylase have been reported: (1) dicamba monooxygenase DMO, cloned from Stenotrophomonas maltophilia DI-6, is a three-component monooxygenase dependent on NADH for reducing power. (2) Tetrahydrofolate (THF)-dependent demethylase: Yao et al. (2016) and Chen et al. (2019) cloned two THF-dependent dicamba demethylase genes Rhizorhabdus dicambivorans Ndbn-20 dmt and dmt50Dmt and Dmt50 have high demethylation activity as DMO; but compared with DMO, the significant disadvantage of Dmt and Dmt50 is that its activity is severely inhibited by the product 5-methyl-THF, which greatly limits its application value. Monsanto successfully constructed the dicamba-resistant crops by using the dicamba demethylase gene DMO from bacteria, and the planting area reached nearly 300 million mu in 2018. With the development of dicamba mixtures and the continuous deepening of the research on dicamba-resistant transgenic crops technology, the demand for dicamba will increase significantly worldwide. At present, a few western biotechnology giants dominate the property rights system of transgenic technology, and China still lacks herbicide-resistant gene (enzyme) resources with independent property rights, which seriously restricts the cultivation of new varieties of herbicide-resistant transgenic crops in China. Therefore, obtaining new high-efficiency dicamba demethylase and its gene resources has good application value in the construction of dicamba-resistant crops and the bioremediation of dicamba pollution, and has a positive significance for promoting agricultural and environmental biotechnology innovation in China.

[0004] The dicamba demethylase gene has the following effects in the treatment of pesticide residues: (1) modern microbial fermentation technology and enzyme purification technology are used to prepare enzyme preparations for in-situ soil remediation; (2) the degradation gene is introduced into crops by modern biotechnology to construct corresponding herbicide-resistant transgenic crops. In summary, the research on dicamba demethylase gene has very important theoretical and practical application value. SUMMARY

[0005] In view of the above problems, the purpose of the present application is to provide a new type of high-efficiency THF-dependent dicamba demethylase gene dmt06 to solve the problems of low activity and product inhibition of existing dicamba demethylase.

[0006] The technical solution is:

[0007] A THF-dependent dicamba demethylase gene dmt06 (THF-dependent dicamba demethylase gene dmt06 , abbreviated as dmt06 ), the nucleotide sequence of which is SEQ ID NO. 1.

[0008] Further, the dmt06A dymetate demethylase gene is cloned from the dymetate degradation enrichment liquid in two schemes: (1) degradation strain purification, screening and identification: gradient dilution is carried out on the enrichment liquid with degradation effect, and a suitable dilution gradient plate is selected, and single colonies are picked up, and a large amount of culture is carried out on the picked single bacteria, and then the degradation effect of dymetate on the single bacteria is identified. The 16S rRNA gene of the single bacteria with dymetate degradation effect is sequenced, and finally the strain with dymetate degradation effect is identified. Then the genome sketch of the degradation strain is obtained by genome sequencing, and the dymetate demethylase gene in the degradation strain is found by comparing the reported dymetate gene sequence with the newly obtained genome sketch of the dymetate degradation strain. (2) The dymetate degradation strain is not obtained finally by the way of passing, separating single colonies and identifying the degradation effect, and the conserved region of the reported dymetate demethylase gene is found by sequence comparison, and the conserved region of the dymetate demethylase gene in the enrichment liquid is amplified by using the total DNA of the dymetate degradation enrichment liquid as a template and designing a degenerate primer, and then the gene fragments before and after the conserved region are amplified by SEFA-PCR, and finally the new dymetate demethylase gene is obtained.

[0009] A dymetate demethylase Dmt06 (dymetate demethylase Dmt06 is referred to as Dmt06) is obtained. dmt06 The nucleotide sequence is encoded by the obtained.

[0010] Further, the amino acid sequence of the Dmt06 is SEQ ID NO. 2.

[0011] A high-efficiency recombinant expression vector, wherein the expression vector contains the above-mentioned dmt06 .

[0012] Preferably, the high-efficiency recombinant expression vector is obtained by dmt06 inserting between the NdeI and HindIII sites of pET-29a (+).

[0013] A genetically engineered bacterium, wherein the genetically engineered bacterium contains the above-mentioned dmt06 .

[0014] Preferably, the expression strain of the genetically engineered bacterium is Escherichia coli BL21 (DE3).

[0015] Another object of the present application is to provide dmt06 , application of Dmt06 and genetically engineered bacteria.

[0016] A THF-dependent dymetate demethylase gene dmt06Application of the application, the application scenarios include: in the construction of dicamba resistant transgenic crops, in the degradation or removal of environmental residues of dicamba.

[0017] Application of the application, the application scenarios include: in the construction of dicamba resistant transgenic crops, in the degradation or removal of environmental residues of dicamba.

[0018] Application of the application, the application scenarios include: in the construction of dicamba resistant transgenic crops, in the degradation or removal of environmental residues of dicamba.

[0019] Due to the adoption of the above technical solutions, the present application has the following advantages compared with the prior art:

[0020] (1) The present application clones a new type of THF-dependent dicamba demethylase gene dmt06 A new gene, Blastp online amino acid sequence analysis and homology comparison in NCBI (the UniProt Knowledge Base / Swiss Prot databases) found that the gene is a new gene, the full length (from the start codon to the stop codon) 1422 bp, can encode 473 amino acids.

[0021] (2) The specific enzyme activity of the dicamba demethylase Dmt06 provided by the present application can reach 165 nmol / min / mg, which is significantly higher than that of Dmt (114 nmol / min / mg) and Dmt50 (146 nmol / min / mg).

[0022] (3) The THF-dependent dicamba demethylase gene dmt06 provided by the present application can also be used to construct recombinant strains for degrading dicamba, and can be used to remove dicamba in soil and water, and has very important theoretical and application value. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is the UV scanning spectrum of the enrichment liquid degrading dicamba (the solid line represents the sample collected at 0h, the dotted line represents the sample collected at 6h, and the dashed line represents the sample collected at 12h);

[0024] Figure 2 is the HPLC detection spectrum of the enrichment liquid degrading dicamba (A: dicamba standard, B: 3,6-DCSA standard, C: sample collected at 6h, D: sample collected at 12h, E: sample collected at 18h);

[0025] Figure 3Figure for detecting THF-dependent demethylase gene amplified from total DNA of the enrichment liquid (A: amplifying fragments from total DNA of the enrichment liquid using degenerate primers, wherein, M: DNA Marker, 1: amplification product using primers dF1 and dR1; B: SEFA-PCR to obtain upstream and downstream genes of the target fragment, wherein, M: DNA marker, 1: first round PCR of the upstream gene, 2: first round PCR of the downstream gene, 3: second round PCR of the upstream gene, 4: second round PCR of the downstream gene);

[0026] Figure 4 Figure of SDS-PAGE gel of purified Dmt06 (M: protein Marker; 1: E. coli BL21 (pET29a) induced crude enzyme solution; 2: E. coli BL21 (pET29a- dmt06 ) induced crude enzyme solution; 3: purified Dmt06);

[0027] Figure 5 Figure of HPLC detection spectrum of Dmt06 degrading Lasso (A: Lasso standard, B: 3,6-DCSA standard, C: sample collected at 5 min, D: sample collected at 10 min);

[0028] Figure 6 Figure of MS spectrum of products produced in the process of Lasso conversion by Dmt06;

[0029] Figure 7 Figure of influence of pH on enzyme activity of Dmt06;

[0030] Figure 8 Figure of influence of temperature on enzyme activity of Dmt06;

[0031] Figure 9 Figure of influence of metal ions and chemical reagents on enzyme activity of Dmt06. DETAILED DESCRIPTION

[0032] In order to make the objects, technical solutions and advantages of the present application clearer, the following will combine the embodiments of the present application and specific examples, and clearly and completely describe the technical solutions of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work belong to the scope of protection of the present application. Figures 1-9

[0033] ​The microbial sources used in the following examples are as follows: Escherichia coli high expression vector pET-29a(+) purchased from Novegen Company, expression host bacteria Escherichia coli BL21(DE3) purchased from Shanghai Yingjun Biotechnology Co., Ltd.

[0034] Example 1

[0035] Cloning of dicamba demethylase gene

[0036] 1.1 Enrichment and domestication of degrading strains

[0037] The enrichment medium used to enrich dicamba-degrading strains was taken from long-term dicamba-producing Yangnong Chemical Biochemical sludge, long-term dicamba-using farmland soil, etc. 5.0 g of soil sample was added to 100 ml of low-chlorine basal salt medium, 500 mg / L of dicamba was added, 30°C, 180 r·min -1 cultured for 5 days, and inoculated into the same medium at a 5% inoculation amount for continuous transfer. Time sampling was performed to detect whether the enriched liquid after transfer had a degradation effect by using an ultraviolet scanner. The detection results showed that one of the enriched liquids could efficiently degrade dicamba. During the first transfer process, about 70% of 500 mg / L of dicamba was degraded in 11 days. With the increase in the number of transfer, the dicamba degradation capacity gradually increased. After 6 times of transfer culture, the enriched liquid could basically degrade 500 mg / L of dicamba in 12 h. The degradation of the enriched liquid was detected by ultraviolet scanning, as shown in FIG. 1.

[0038] Gradient dilution was performed on the enriched liquid with a degradation effect, and 10 -4 ~10 -7 0.1 mL of the enriched liquid with each dilution degree was spread on a solid culture medium plate added with 500 mg / L of dicamba, and cultured at 30°C for 5 days. After that, single colonies growing out were picked, further purified using the streaking method, and inoculated into low-chlorine basal salt medium containing 500 mg / L of dicamba, 30°C, 180 r·min -1 shaking bed culture for 3 days, and the degradation effect was verified by ultraviolet scanning. Through purification and screening, about 100 strains were screened. No strain capable of degrading dicamba was finally found through single-bacterial purification and degradation experiments.

[0039] The formula of the low-chlorine basal salt medium is as follows: 1.3 g, K2HPO4; 0.87 g, KH2PO4; 0.66 g, (NH4)2SO4; 0.097 g, MgSO4; 0.025 g, MnSO4·H2O; 5 mg, FeSO4·7H2O; 1.26 mg, CaSO4·6H2O, and deionized water is added to 1 L, pH 7.0; 15.0 g of agar is added to the solid culture medium.

[0040] 1.2 Degradation effect evaluation and metabolite analysis

[0041] The verification method of degradation effect: qualitative experiment, mainly using UV scanning spectrum detection, wavelength range of 200 nm-350 nm, centrifugal removal of bacterial bodies of the time sampling culture solution, supernatant was directly used for UV scanning. Quantitative detection, using high performance liquid chromatography (HPLC) detection, sample processing method: taking 1 mL of enrichment culture solution freeze-dried dry material, adding 1 mL of methanol (chromatographic pure), filtering with filter membrane (pore size 0.22 μm), using high performance liquid chromatography for detection. Liquid chromatography conditions: mobile phase is acetonitrile: methanol: water: acetic acid (31.7:7.5:58.4:2.4, V / V), Zorbax C218 ODS Spherex reversed phase column (5 μm, 4.6 mm × 250 mm, Agilent, USA), column temperature is room temperature, UV detector determination wavelength is 275 nm (detection of dicamba) and 319 nm (detection of 3,6-DCSA), injection volume is 20 μL, flow rate is 0.8 mL·min -1 . External standard method according to peak area quantification. Metabolite identification by HPLC-MS, conditions: mobile phase is acetonitrile: methanol: water: acetic acid (31.7:7.5:58.4:2.4, V / V), Agilent XDB-C 18 5cm, 0.46 cm, 1.8 mm reversed phase column, flow rate 0.25 mL·min -1 . MS analysis uses ESI mode, detector is Agilent G6410B Triple Quad Mass Spectrometer.

[0042] The high performance liquid chromatography detection results are shown in Figure 2 , the experimental results show that the enrichment solution can degrade dicamba and produce a product peak, the peak position is the same as that of 3,6-dichlorosalicylic acid (3,6-DCSA) standard, and with the extension of time, the peak of 3,6-DCSA gradually disappears. HPLC detection results show that the first step of dicamba degradation is to generate intermediate product 3,6-dichlorosalicylic acid (3,6-DCSA), and the enrichment solution can ultimately completely degrade dicamba ( Figure 2 ).

[0043] Example 2

[0044] dmt06 Cloning and functional verification of

[0045] 2.1 Verification of crude enzyme activity of dicamba high-efficiency degradation enrichment solution

[0046] The clopyralid high-efficiency degradation enrichment liquid was subcultured, and after 12 h of degradation, the bacterial cells in the enrichment liquid were collected by centrifugation at 6000 rpm, and the supernatant was discarded. The bacterial cells were washed with an appropriate amount of pre-cooled MSM medium, resuspended with 5 mL of pre-cooled PBS, and placed in ice for pre-cooling. The bacterial cells were broken by ultrasonic wave at 180 Hz for 10 min, and the whole process was carried out in ice bath. The broken liquid was centrifuged at 13000 rpm for 10 min at 4°C, and the supernatant was the crude enzyme liquid. The protein concentration in the crude enzyme liquid was detected by BCA method. The components in the 300 μL crude enzyme liquid enzyme reaction system were as follows: 100 mM PBS (pH 7.4) buffer, 2.0 mM NADH or THF, 0.5 mM clopyralid, and 50 μL crude enzyme. The reaction system was placed in a 30°C water bath for 5 min, and then heated in a 100°C water bath to terminate the reaction. The residual amount of clopyralid was detected by HPLC, and the activity was calculated. One unit (U) of enzyme activity was defined as the amount of enzyme required to convert 1 nmol of clopyralid under the conditions of pH 7.4 and 30°C for 1.0 min. The experimental results are shown in Table 1, which shows that the clopyralid demethylase in the enrichment liquid is a THF-dependent monooxygenase, but not dependent on NADH.

[0047] Table 1 Detection of clopyralid demethylase activity of the crude enzyme in the enrichment liquid

[0048]

[0049] 2.2 Cloning from clopyralid enrichment liquid dmt06

[0050] 2.2.1 Extraction of total DNA of the enrichment liquid genome

[0051] The 6th generation of clopyralid high-efficiency degradation enrichment liquid was obtained after subculture, and the bacterial cells were collected by centrifugation at 12000 rpm for 10 min. The bacterial cells were washed twice with sterile water. The total DNA of the enrichment liquid was extracted by the improved high-salt extraction method, dissolved in TE buffer (pH 8.0), and stored at -20°C. The specific method is referred to F. Osborn et al. "Compendium of Molecular Biology Experiment Guide".

[0052] 2.2.2 Cloning of dmt06

[0053] ​The known amino acid sequences of dicamba demethylases (DesA, LigM, Dmt, and Dmt50) were downloaded and sequence aligned. Degenerate primers were designed based on the conserved regions of these four reported THF-dependent demethylase genes: two forward primers and two reverse primers (as shown in Table 2). Forward primers: dF1, dF2; Reverse primers: dR1, dR2. Using dF1 and dR1, dF1 and dR2, dF2 and dR1, and dF2 and dR2 as primers, and total DNA from the enrichment solution as a template, PCR was used to amplify the conserved regions of the demethylase gene fragments from the total DNA in the enrichment solution. 。

[0054] PCR amplification system:

[0055] Primer star enzyme (5U / μl) 0.5 μl

[0056] 5× PCR Buffer II (Mg 2+ Plus) 10 μl

[0057] dNTP Mixture (2.5mM each) 2μl

[0058] Template DNA 10 ng

[0059] Forward primer (20 μM) 1 μl

[0060] Reverse primer (20 μM) 1 μl

[0061] Sterile distilled water to 50 μl

[0062] PCR amplification procedure:

[0063] a. Denaturation at 98℃ for 3 min;

[0064] b. Denaturation at 98℃ for 0.5 min, annealing at 53℃ for 0.5 min, extension at 72℃ for 1 min, for 30 cycles;

[0065] c. 72℃ for 10 minutes, then cool to room temperature.

[0066] PCR amplification experiments on the conserved region showed that a gene fragment of approximately 600 bp could be amplified using primers dF1 and dR1 (see Figure 3). This results were consistent with the theoretical predictions. The conserved fragment of the amplified target gene was purified, ligated into a T-vector via TA cloning, and then transformed into a new gene vector. E. coli DH5α was extracted, and the plasmid was sent to Sangon Biotech Co., Ltd. for sequencing. The sequence was compared with the reported dicamba demethylase sequence, and it was found that this fragment...dmt50 The sequence similarity of the 191-818 bp region reached 74.3%. The upper and lower sequences of the conserved region of the target gene were amplified by SEFA-PCR technology invented by the laboratory (Wang, S. M., He, J., Cui, Z. L., Li, S. P. Self-formed adaptor PCR: a simple and efficient method for chromosome walking. Appl. Environ. Microbiol. 2007, 73, 5048-5051.), using primers uSP1, uSP2, uSP3 to amplify the upper fragment, and primers dSP1, dSP2, dSP3 (as shown in Table 2) to amplify the lower fragment of the conserved region. The complete dicamba dealkylase gene was finally obtained by splicing, named as dmt06 (i.e. tetrahydrofolate-dependent dicamba dealkylase gene dmt06 ). dmt06 with a total length of 1422 bp, encoding 473 amino acids. The amino acid sequence was compared in NCBI, and it was found that dmt06 the sequence was most similar to the sequence of THF-dependent methyltransferase and aminomethyltransferase family protein, dmt06 the sequence similarity reached 100% with a sequence annotated as a possible aminomethyltransferase (function not verified) from Actinomadura parvosata subsp. kistnae, dmt06 and the homology with the known function proteins dicamba dealkylase Dmt50 and Dmt was 72.3% and 46.2%, respectively.

[0067] 2.2.3 dmt06 Construction of expression vector

[0068] (1) PCR amplification dmt06

[0069] The total DNA of the enrichment liquid was used as the template, 2×Phanta Master Mix and primers pET-F and pET-R (as shown in Table 2) were used to specifically amplify the THF-dependent dicamba dealkylase gene dmt06 , 4 μL of the PCR product was subjected to agarose gel electrophoresis, EB staining for 8 min, and then photographed by ultraviolet analyzer to detect the size and specificity of the fragment. dmt06 dmt06

[0070] Table 2. Primers and corresponding nucleotide sequences

[0071] Primer Nucleotide sequence dF1 5'-CTC(G)TTCG(A)ACCAGT(A)CC(G)CACCACATG-3' dF2 5'-TCGGCGACT(G)GC(G)ATCCTG(T)TAC(T)TA(G)-3' dR1 5'-GGC(A)TGGATC(G)C(G)CC(G)TACCCG(C)CTG(C)GCCG-3' dR2 5'-TC(G)AAGTTC(T)GAC(T)CAC(T)GACTTCATCGG-3' uSP1 AGTACACGATGCAGTCGCCGACCACGT uSP2 AACCCGGCGAAGGTGTTGATGCCGA uSP3 CTTTCAGGAACAGCTNNNNNNNNNGGTGGG dSP1 AGTGGAGCTGTCCGGCCCGTAC dSP2 GACACCGTACGGTCGGCCATTCTC dSP3 AGAAGTACGGAATCGNNNNNNNNNGCACCC pET-F TAAGAAGGAGATATACATATGGGAGAAGGACGGTCCCTTCA pET-R AGTGCGGCCGCAAGCTTCGGCGACCCGGCGGCCGTCGCC ​​

[0072] (2) Restriction enzyme digestion, ligation, transformation and construction of recombinant plasmid

[0073] The PCR product was purified by a gel recovery kit, and the specific method was described in the kit manual. The plasmid pET29a(+) was extracted and purified by the kit, and the purified plasmid was double-digested by the corresponding fast-cut enzyme.

[0074] Enzyme digestion system:

[0075] 10x Buffer 5 μl

[0076] Nde I 2 μl

[0077] Hind 2 μl

[0078] DNA ≤1 μg

[0079] Sterile distilled water was added to 50 μl

[0080] The reaction was carried out in a 37°C water bath for 30 min. The enzyme digestion product was subjected to 0.75% agarose gel electrophoresis and the gel was recovered.

[0081] The vector was constructed by homologous recombination using pET29a(+) as the expression vector. When designing the primers, a restriction enzyme site was added to the 5' end of the forward primer, and a restriction enzyme site was added to the 5' end of the reverse primer. Nde I enzyme digestion site, and a restriction enzyme site was added to the 5' end of the reverse primer. Hind The recovered fragment and the digested vector were ligated. Refer to the One Step Cloning kit manual.

[0082] The following reaction system (10 μL) was prepared in an ice water bath:

[0083] Linearized plasmid pET29a(+) 1.0 μL

[0084] dmt06 Gene fragment 2.0 μL

[0085] Exnase II 1.0 μL

[0086] 5x CE II Buffer 2.0 μL

[0087] ddH2O 4.0 μL

[0088] After mixing, the reaction was carried out in a 37°C water bath for 30 min. Immediately after the reaction was completed, it was placed in an ice water bath for 5 min. The homologous recombination product was transformed into the E. coli expression strain E. coliBL21(DE3) competent cells. Pick the recombinant expression strain monoclonal to 50 mg·L -1 Km 3 mL liquid LB test tube, 37℃, 180 rpm culture for 8 h, the bacterial liquid was sent to Shengong Biotechnology Co., Ltd. for sequencing, and the strain sequencing verification correct expression strain E. coli BL21-pET- dmt06 .

[0089] 2.3 Expression and purification of Dmt06 and functional verification

[0090] 2.3.1 Induction, expression and purification of Dmt06

[0091] The sequencing-verified expression strain E. coli BL21-pET- dmt06 was transferred to 5 mL of 50 mg·L - 1 Km LB test tube, 37℃, 180 rpm shaking culture to logarithmic growth phase, then inoculated into 100 mL of LB liquid medium at 1 % inoculation, 37℃, 180 rpm culture to OD 600nm 0.4~0.6, 1 mL was taken at 4℃ for preservation, ready for use. After the bacterial liquid was pre-cooled to 16℃, IPTG was added to a final concentration of 50 μmol·L -1 , induced at 16℃, 180 rpm for 10 h. 12000 rpm, centrifugal 5 min to collect the bacterial body, PBS wash the bacterial body twice, then resuspend the bacterial body with pre-cooled 10 mL 50 mM PBS (pH 7.4), ultrasonic crushing for 5~10 min under ice bath condition, the crushing liquid was centrifuged at 4℃, 12000 rpm for 30 min, and the supernatant was the crude enzyme liquid of the bacterial body. The recombinant protein Dmt06 was purified by Co 2+ affinity chromatography column, and the band singleness and protein size of the purified protein were detected by SDS-PAGE, and the detection results were as follows Figure 4 , the size of the demethylase was about 55 kDa, which was consistent with the theoretical value (52.3 kDa), and the purified protein had high content and single band. After verification by SDS-PAGE, the eluate of the purified target protein was combined and dialyzed, and the BCA method (BCA Protein Assay Kit, Shanghai Shengong Biotechnology Co., Ltd.) was used to quantify the pure enzyme concentration of Dmt06.

[0092] 2.3.2 Functional verification of recombinant expression protein Dmt06

[0093] The basic components of Dmt06 dicamba methyltransfer reaction system include 2.0 mM THF, 0.5 mM dicamba and 0.1 mg purified Dmt06, and finally use buffer to make up to 300 μL. After the enzyme reaction is terminated, the precipitate in the reaction solution is removed by using a 0.22 μm filter membrane, and high performance liquid chromatography (HPLC) is used for detection, and the enzyme activity detection result is as follows Figure 5 The expression and purification of Dmt06 can degrade dicamba, and a new metabolite is generated during the reaction process, with a retention time of 6.25 min, which is consistent with the retention time of the 3,6-DCSA standard, which is the same as the peak position of the 3,6-DCSA standard. Mass spectrometry detection shows that the product has a significant molecular ion peak at m / z 204.95 (M-H) - The fragment peak at m / z 106.95, which is consistent with 3,6-DCSA. Therefore, the product is determined to be 3,6-DCSA. The above results show that Dmt06 is a demethylase that catalyzes the conversion of dicamba to 3,6-DCSA. Under the optimal conditions, the specific activity of Dmt06 on dicamba is 165 nmol / min / mg when 0.1 mg Dmt06 is incubated for 5 min, which is significantly higher than the reported dicamba demethylase Dmt (114 nmol / min / mg, Yao, L., Yu, L. L., Zhang, J. J., Xie, X. T., Tao, Q., Yan, X., Hong, Q., Qiu, J. G., He, J., Ding, D. R. A tetrahydrofolate-dependent methyltransferase catalyzing the demethylation of dicamba in Sphingomonas sp. strain Ndbn-20. Appl. Environ. Microbiol. 2016, 82, 5621-5630.) and Dmt50 (146 nmol / min / mg, Chen, L., Yao, S. G., Chen, T., Tao, Q., Xie, X. T., Xiao, X., Ding, D. R., He, Q., He, J. Coexpression of methyltransferase gene dmt50 and methylene tetrahydrofolate reductase gene increases Arabidopsis thalianadicamba resistance. J. Agric. Food. Chem . 2019, 67, 1443-1452.)。

[0094] Example 3

[0095] Enzymatic properties of Dmt06

[0096] 3.1 Effect of pH on Dmt06 activity and stability

[0097] The pH range of Dmt06 was studied in three different buffer systems: 20 mM HAc-NaAc buffer (pH 3.6-5.8), 50 mM PBS buffer (pH 5.5 - 8.5) and 20 mM glycine-NaOH buffer (pH 8.6-10.6). Appropriate amounts of Dmt06 pure enzyme were added to different pH buffer systems, and the conversion rate of dicamba was detected by HPLC. The relative enzyme activity was calculated based on the enzyme activity under the condition of 50 mM PBS pH 7.4 as 100%. The results showed that Dmt06 had demethylation activity in the temperature range of 10-50°C, and the optimal pH value was 7.4 (Figure 2). Figure 7 。

[0098] 3.2 Effect of temperature on Dmt06 activity and stability

[0099] Different temperatures (4°C, 10°C, 20°C, 25°C, 30°C, 35°C, 40°C, 50°C, 60°C and 70°C) were set to study the temperature range of Dmt06 in 50 mM PBS buffer (pH 7.4). The enzyme activity was measured every certain time, and the relative enzyme activity at other temperatures was calculated based on the enzyme activity under the condition of 30°C as 100%. For thermal stability study, Dmt06 was pre-incubated at different temperatures (30°C-70°C) for 120 min, and then the residual activity was measured. The detection results are shown in Figure 8 Dmt06 was detected to have activity in the temperature range of 10-50°C. The optimal reaction temperature of Dmt06 was 35°C. In the thermal stability study, Dmt06 retained more than 70% activity after incubation at 50°C for 120 min, and less than 20% activity after incubation at 60°C for 120 min. The results showed that Dmt06 was stable at 50°C, but became unstable when the temperature increased to 60°C.

[0100] 3.3 Effect of metal ions and chemical reagents on Dmt06 activity

[0101] In the Dmt06 reaction system under the optimum reaction condition, various metal ions (Li + , Na + , Mg 2+ , Hg 2+ , Mn 2+ , Ni 2+ , Co 2+ , Ca 2+ , Zn 2+ , Cr 2+ , Ba 2+ , Al 3+ , Cd 2+ and Ag + ) with final concentration of 1.0 mM, 5.0 mM EDTA and SDS were added respectively. The enzyme activity under the reaction system without any metal ions and other chemical reagents was defined as 100%, and the relative enzyme activity of each test group was calculated. The experimental results are shown in Table 1. Figure 9 The activity of Dmt06 was severely inhibited by 1.0 mM Hg 2+ , Co 2+ , Zn 2+ , Cd 2 + , Ag + and 5.0 mM SDS, moderately inhibited by 1.0 mM Mn 2+ , Ni 2+ , Cu 2+ , Ba 2+ and Al 3+ , and not obviously affected by 1.0 mM Li + , Na + , K + , Mg 2+ , Ca 2+ , Fe 2+ , Fe 3+ and 5.0 mM EDTA.

[0102] 3.4 Substrate spectrum of Dmt06

[0103] In the pure enzyme reaction system of dicamba demethylase, 0.5 mM of other methyl aromatic compounds and herbicides, i.e. vanillic acid, syringic acid, isopropyl and alachlor, were added respectively, and the reaction was carried out for 30 min. HPLC was used to detect whether the added substrate was degraded. Through the enzyme degradation experiment, it was found that Dmt06 could not catalyze the methyl transfer of vanillic acid, syringic acid, isopropyl and alachlor, indicating that Dmt06 had a very narrow substrate spectrum.

[0104] The above is a further detailed description of the present application in combination with the specific embodiments, and cannot be deemed as limiting the specific embodiments of the present application; for the skilled in the art and the related technical field, the expansion, the operation method and the replacement of data made on the basis of the technical solution idea of the present application should fall within the protection scope of the present application.

Claims

1. Use of a THF-dependent dicamba demethylase gene dmt06, characterized in that The application includes: the application in constructing dicamba-resistant transgenic crops, the application in degrading or removing dicamba residues in the environment; the nucleotide sequence of the THF-dependent dicamba demethylase gene dmt06 is shown as SEQ ID NO.

1.

2. Use of a THF-dependent dioxomethylenetriflate desmethylase Dmt06, characterized in that, The application includes: the application in degrading or removing dicamba residues in the environment; the amino acid sequence of the THF-dependent dicamba demethylase dmt06 is shown as SEQ ID NO. 2.

Images