Nano-mimetic enzyme test strip containing two pairable PVY monoclonal antibodies and its application

Abstract

The present invention discloses a nano-mimetic enzyme test strip containing two pairable PVY monoclonal antibodies and its application. The two pairable PVY monoclonal antibodies are PVY-2 and PVY-5; PVY-2 is secreted by the hybridoma cell line 4F1B2G11 with a preservation number of CCTCC NO: C2022281, and PVY-5 is secreted by the hybridoma cell line 4B4D8C3 with a preservation number of CCTCC NO: C2022282; PVY-5 is used as a labeled antibody and PVY-2 is used as a coating antibody to prepare a PVY nano-mimetic enzyme test strip. The test strip has a detection sensitivity of 10 for leaves infected with potato virus Y. ‑4 (w / v, g / mL). The research and development of this product will fill the gap in the field of nano-mimic enzymes in potato plant virus detection.

Description

Technical Field

[0001] The present invention relates to the technical field of plant pathogen detection, and in particular to a nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies and applications thereof. Background Art

[0002] According to current national standards, it takes approximately four years for seed potatoes to be propagated from parent seeds to production seeds. During this time, they undergo rigorous field, warehouse, and laboratory testing to ultimately determine their quality. Therefore, unlike other field crop seed quality testing procedures, seed potato quality testing requires more specialized skills and extensive experience. Therefore, it is necessary to establish and develop rapid, accurate, and sensitive testing technologies and products to assist testers in making scientific, accurate, and timely assessments of seed potato quality.

[0003] Nanoenzymes, with their high stability, low cost, and tunable enzyme activity, show broad application prospects. Academician Yan Xiyun's team discovered that three Fe₃O₄ magnetic nanomaterials (Fe₃O₄ MNPs) with different particle sizes (30, 50, and 300 mm) all exhibit horseradish peroxidase (HRP) activity. Without surface modification of any catalytic groups, they catalyzed the oxidation of tetramethylbenzidine (TMB) to produce a blue product, diaminobenzidine (DAB) to produce a brown product, and o-phenylenediamine (OPD) to produce an orange product in the presence of hydrogen peroxide (H₂O₂). This demonstrates that Fe₃O₄ magnetic nanomaterials possess peroxidase-like properties. Their research also revealed that the catalytic activity of nanozymes is size-dependent, with smaller nanoparticles exhibiting higher activity. Since then, research on iron oxides as nanozymes has garnered significant attention among researchers. The research focus of this invention is on how to apply nano-mimic enzymes to potato virus detection, to establish a simple, rapid, sensitive, economical and accurate potato virus disease detection technology, to meet the needs of field quality testing services for potato seed potatoes, and to provide technical support for the comprehensive promotion of potato seed potato quality testing and certification work. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies; a second object of the present invention is to provide the application of the nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies in the detection of potato PVY virus.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] A nanomimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies consists of a sample pad, a conjugation pad, a water-absorbing pad, a NC membrane, and a backing plate. The sample pad, conjugation pad, and NC membrane are sequentially attached to the same surface of the backing plate from left to right and from top to bottom, with the ends of the conjugation pad and the NC membrane overlapping. The water-absorbing pad is attached to the other end of the NC membrane. The conjugation pad is coated with the monoclonal antibody PVY-5 labeled with a nanomimetic enzyme. The NC membrane is provided with a detection line and a control line, with the detection line located between the conjugation pad and the control line. The detection line is coated with the monoclonal antibody PVY-2, and the control line is coated with a secondary antibody.

[0007] The monoclonal antibodies PVY-2 and PVY-5 can be paired; the PVY-2 is secreted by the hybridoma cell line 4F1B2G11 with a preservation number of CCTCC NO: C2022281, and the PVY-5 is secreted by the hybridoma cell line 4B4D8C3 with a preservation number of CCTCC NO: C2022282.

[0008] Preferably, the amino acid sequence of the heavy chain variable region of the PVY-2 monoclonal antibody is shown in SEQ ID NO.4, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.5; the amino acid sequence of the heavy chain variable region of the PVY-5 monoclonal antibody is shown in SEQ ID NO.6, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.7; PVY-2 and PVY-5 can simultaneously produce specific immune reactions with the 30KDa coat protein of potato virus Y, and the antibody type and subclass are both IgG1, and the chain type is both Kappa light chain.

[0009] Preferably, the nano-mimetic enzyme is Fe3O4 magnetic nanoparticles.

[0010] The present invention further prefers that the method for labeling monoclonal antibody PVY-5 with nanomimetic enzyme is as follows: after washing the nanozyme with purified water, NHS and EDC are added and mixed, ultrasonicated and activated at room temperature, monoclonal antibody PVY-5 is added at a mass ratio of nanomimetic enzyme to monoclonal antibody PVY-5 of 10:1, and the antibody and nanozyme are coupled to obtain nanomimetic enzyme-labeled monoclonal antibody PVY-5.

[0011] Preferably, the control line is coated with a secondary antibody, which is goat anti-mouse IgG.

[0012] The present invention is preferred, the sensitivity of the test strip to detect leaves infected with potato virus Y is 10 - 4 g / mL.

[0013] 2. Application of the nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies in the detection of potato PVY virus.

[0014] The beneficial effects of the present invention are as follows: the present invention discloses a nano-mimetic enzyme test strip containing two pairable PVY monoclonal antibodies and its application, wherein the two pairable PVY monoclonal antibodies are PVY-2 and PVY-5; the PVY-2 is secreted by the hybridoma cell line 4F1B2G11 with a deposit number of CCTCC NO: C2022281, and the PVY-5 is secreted by the hybridoma cell line 4B4D8C3 with a deposit number of CCTCC NO: C2022282. PVY-2 and PVY-5 can simultaneously produce specific immune reactions with the 30KDa coat protein of potato virus Y, and the antibody type and subclass are both IgG1, and the chain type is both Kappa light chain; the PVY nano-mimetic enzyme test strip prepared with PVY-5 as the labeled antibody and PVY-2 as the coated antibody has a detection sensitivity of 10 for leaves infected with potato virus Y. -4 g / mL.

[0015] The development of this product will fill a gap in the field of nano-mimetic enzymes for potato plant virus detection, establishing a simple, rapid, sensitive, economical, and accurate technology for detecting potato virus diseases. This addresses the high price and sensitivity of existing commercial diagnostic reagents for rapid field diagnosis of potato virus diseases. This will help improve the quality of virus-free seed potatoes in our city, enhance potato quality and yield, and increase farmers' incomes. It will meet the needs of field seed potato quality testing services and provide technical support for the comprehensive advancement of seed potato quality testing and certification. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:

[0017] Figure 1 This is the technical route of the present invention;

[0018] Figure 2 Amplification of PVY-CP gene fragment;

[0019] Among them, M: 2K plusII marker, 1, 2: PVY-CP gene fragment (807 bp);

[0020] Figure 3 This is the result of prokaryotic expression of PVY-CP;

[0021] Wherein, M: Marker, 1: bacterial precipitate, 2: bacterial supernatant, 3: bacterial total protein;

[0022] Figure 4 This is the purification result of PVY-CP;

[0023] A: PVY-CP eluted with different concentrations of imidazole, M: marker, 1: 50 mM imidazole eluent, 2: 100 mM imidazole eluent, 3: 300 mM imidazole eluent; B: PVY-CP purification results, M: marker, 4: concentrated protein);

[0024] Figure 5 Western blot analysis of PVY monoclonal antibody specificity;

[0025] Wherein, M: protein marker, 1: healthy potato tissue culture seedlings, 2: potato tissue culture seedlings infected with PVY, 3: potato tissue culture seedlings infected with PVX;

[0026] Figure 6 For PVY monoclonal antibody sensitivity analysis;

[0027] Figure 7 It is a specific detection method for PVY nano-mimetic enzyme test strips;

[0028] Among them, 1: PVA, 2: PVM, 3: PVS, 4: PVX, 5: PLRV, 6: PVY, 7: healthy plant;

[0029] Figure 8 It is the sensitivity test of PVY nano-mimetic enzyme test strips;

[0030] Among them, 1:1:10 dilution, 2:1:10 2 Dilution: 3:1:10 3 Dilution: 4:1:10 4 Dilution: 5:1:10 5 6-fold dilution, negative control.

[0031] Biological Deposits:

[0032] Two hybridoma cell lines secreting monoclonal antibodies were deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, and named 4F1B2G11 and 4B4D8C3 respectively; the deposit date of 4F1B2G11 was September 1, 2022, the deposit number was CCTCC NO: C2022281, and it was classified as hybridoma cell line 4F1B2G11; the deposit date of 4B4D8C3 was September 1, 2022, the deposit number was CCTCC NO: C2022282, and it was classified as hybridoma cell line 4B4D8C3. DETAILED DESCRIPTION

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0034] Biological materials and reagents required for the examples: healthy potato seedlings, and potato seedlings infected with PVX, PVY, PVA, PVS, PVM, and PLRV were all retained in our laboratory; nanomimetic enzyme (Fe3O4, 10 mg / mL) was provided by Dr. Duan Demin, Institute of Biophysics, Chinese Academy of Sciences (for preparation, see the reference Duan D, Fan K, Zhang D, et al. Nanozyme-strip for rapid local diagnosis of Ebola); Balb / c mice were purchased from Jiangnan Laboratory Animal Base; Tizol, urea, imidazole, penicillin, and streptomycin were purchased from Sangon Biotech (Shanghai) Co., Ltd.; reverse transcription kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; gel recovery kit was purchased from Beijing Quanshijin Biological Co., Ltd.; E. coli BL21 competent cells, protein expression recombinant plasmid (pET28a), LB medium, Tris buffer solution, IgG-HRP, and SDS-PAGE protein gel were purchased from Albertsons Biotechnology; Freund's complete adjuvant, Freund's incomplete adjuvant, PEG1450, HT, and HAT were purchased from Sigma; newborn calf serum was purchased from Caoyuan Green Field Company; DMEM (Glu 4.5 g / L) was purchased from Dalian Meilun Biotechnology Co., Ltd.; dialysis bags, ELISA coating solution, ELISA stop solution, TMB color development solution, and DAB color development solution were purchased from Beijing Solebold Technology Co., Ltd.; antibody subtype detection kits were purchased from Sino Biological; ultrafiltration concentration tubes were purchased from Millipore; affinity chromatography columns and Protein A purification columns were purchased from Wuhan Huiyan Biotechnology Co., Ltd.; ELISA plates were purchased from Costar; nitrocellulose membranes, absorbent paper, glass cellulose membranes, and PVC substrates were purchased from Shanghai Jinbiao Biotechnology Co., Ltd.

[0035] The technical route of the present invention is as follows Figure 1 shown.

[0036] Example 1: Construction of a prokaryotic expression vector for potato virus Y CP protein

[0037] 1. Primer Design and Synthesis

[0038] The PVY gene sequence was retrieved from the National Center for Biotechnology Information (NCBI). Primers for amplifying the full-length coat protein (CP) gene of PVY were designed based on the full-length CP gene sequence (Table 1). The primers were aligned at NCBI and synthesized by Shanghai Sangon Biotechnology Technology Service Co., Ltd. The PVY-CP gene was amplified using primers PVY-CP-F and PVY-CP-R. The amplified product was 807 bp in length. The nucleotide sequence encoding the PVY-CP gene is shown in SEQ ID NO. 3.

[0039] Table 1. Primer sequences of PVY-CP-F and PVY-CP-R

[0040] Primers Primer sequence (5'-3') PVY-CP-F GCAAATGACACAATTGATGCA (SEQ ID NO.1) PVY-CP-R TCACATGTTCTTGACTCCAAG (SEQ ID NO.2)

[0041] 2. Extraction of viral genome

[0042] (1) Place the sample in a mortar, add liquid nitrogen and grind into powder, transfer to a 1.5 mL centrifuge tube, add 1 mL TRIzol and mix thoroughly;

[0043] (2) Centrifuge at 14,000 g for 5 min at 4°C;

[0044] (3) Take the supernatant, add 200 μL of chloroform, shake to mix, and let it stand at room temperature for 15 min;

[0045] (4) Centrifuge at 12,000 g for 15 min at 4°C; aspirate the upper aqueous phase into a new 1.5 mL centrifuge tube, add 0.5 mL of isopropanol, mix well, and let stand at room temperature for 10 min;

[0046] (5) Centrifuge at 12,000 g for 10 min at 4°C;

[0047] (6) Discard the supernatant and keep the precipitate. Add 1 mL of 75% ethanol and gently shake the centrifuge tube to resuspend the precipitate.

[0048] (7) Centrifuge at 7500 g for 5 min at 4°C, discard the supernatant, invert the centrifuge tube on filter paper, and allow to dry naturally.

[0049] (8) Add 25–100 μL of DEPC water to dissolve the precipitate to obtain RNA.

[0050] 3. Amplification of viral CP gene

[0051] (1) Synthesis of cDNA

[0052] Use the extracted plant virus total RNA as a template and follow the instructions of the kit.

[0053] (2) PCR amplification

[0054] Amplification was performed using the synthesized cDNA as a template with the primers listed in Table 1. The reaction system consisted of 50 μL of cDNA template, 2 μL of viral upstream and downstream primers (0.1 μmol L-1), 25 μL of 2× Taq enzyme, and ddH2O to 50 μL. The reaction conditions were: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min; and extension at 72°C for 10 min.

[0055] (3) Agarose gel electrophoresis detection:

[0056] Prepare a 1% agarose gel and add GoldView™ Nucleic Acid Color Dye (1 μL per 20 mL of TAE solution) in the appropriate proportions. Shake thoroughly. Slowly pour the gel into a mold and allow to cool until a gel-like mass forms. Select a suitable location to insert the DNA Maker and PCR product for electrophoresis (140 V for 20 minutes). After electrophoresis, visualize the desired band using a gel imager, excise the band, and place it in a centrifuge tube for recovery.

[0057] (4) Recovery and purification of PCR products:

[0058] The PCR products were recovered and purified according to the instructions of the Gold DNA Gel Extraction Kit.

[0059] 4. Ligation of viral CP protein gene with pET28a vector

[0060] The CP protein gene fragment of PVY purified by gel recovery was ligated to the pET28a vector using the following ligation system (Table 2) and incubated at 37°C for 30 min.

[0061] Table 2. pET28a vector ligation system

[0062] Components volume CP protein gene fragment 4 μL pET28a vector 1 μL <![CDATA[ddH2O]]> 5 μL Total volume 10 μL

[0063] 5. E. coli Transformation

[0064] Remove the BL21 competent cells from the ultra-low temperature freezer and place them on an ice box. After thawing, add 10 μL of the ligation product (PET28a-PVY-CP), pipette to mix evenly, and place on ice for 30 minutes. Heat shock at 42°C for 90 seconds, and place on ice for 2 minutes. Add 500 μL of LB liquid culture medium without antibiotics and place in a 37°C constant temperature shaker at 180 r / min for recovery for 1.5 hours. Centrifuge at 4000 g for 5 minutes at room temperature, discard the excess supernatant, pipette to mix the bacteria, and evenly spread the concentrated bacterial solution on the LB / Kan medium. + On solid culture medium, when the bacterial solution is completely absorbed by the solid culture medium, seal the plate and place it upside down in a 37°C constant temperature incubator for overnight culture. The next day, pick a single clone plaque and place it in LB / Kan + The liquid culture medium was shaken and sent to Shanghai Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0065] 6. Expression of viral CP protein gene in Escherichia coli

[0066] (1) Add the correctly sequenced E. coli culture to 5 mL of LB liquid medium, place it in a 37°C constant temperature shaking incubator, and culture it overnight at 250 rpm / min for 16-18 hours as the seed liquid;

[0067] (2) Transfer the culture medium to fresh 200 mL LB medium at a ratio of 1:100 and culture at 37°C and 250 rpm / min. 600 = 0.6, add IPTG inducer and continue induction culture at 18°C;

[0068] (3) 4°C, 5000 rpm / min, 15 min, collect the cells;

[0069] (4) Resuspend the cells in lysis buffer (50 mM Tris, 0.5 M NaCl, pH 8.0) and disrupt by ultrasonication. The ultrasonication conditions are: on for 3 s, off for 2 s, for 15 min, repeat once.

[0070] (5) After ultrasonication, the sample was incubated at 4°C, 5000 rpm / min for 15 min. The supernatant and precipitate were collected and analyzed by SDS-PAGE.

[0071] 7. Viral CP Protein Purification

[0072] (1) Take the cultured cells, add lysis buffer (50 mM Tris, 0.5 M NaCl, pH 8.0), resuspend and then ultrasonicate. The ultrasonication conditions are: on 3 s, off 2 s, time 15 min, repeat once;

[0073] (2) The ultrasonically disrupted bacterial solution was centrifuged in a low-temperature centrifuge at 4°C, 5000 rpm / min for 15 min. The supernatant was collected and denaturant urea was added to the supernatant to a final concentration of 8 M. After dissolution, the solution was allowed to stand at 4°C for 1 h and the supernatant was collected by centrifugation.

[0074] (3) The supernatant obtained above was filtered through a 0.45 μm filter membrane and protein purification was performed through a Ni affinity chromatography column. The steps are as follows:

[0075] a) Wash with 5 column volumes of deionized water to remove air and 20% ethanol;

[0076] b) Equilibrate the column with 5-10 column volumes of Buffer A (50 mM Tris, 0.15 M NaCl, 8 M urea, pH 8.0).

[0077] c) The sample was flowed through the Ni column at a rate of 0.5 mL / min;

[0078] d) Equilibrate the column with Buffer A;

[0079] e) elution with 50 mM imidazole, 100 mM imidazole, and 300 mM imidazole, respectively;

[0080] f) The eluted samples were subjected to SDS-PAGE gel analysis to determine whether the target protein was present.

[0081] 8. Conclusion

[0082] (1) Construction results of PVY-CP gene prokaryotic expression vector

[0083] The PVY-CP gene was amplified by PCR and analyzed by agarose gel electrophoresis, and a DNA fragment of 807 bp in length was detected ( Figure 2 The PVY-CP gene fragment was recovered by gel extraction, ligated into the pET28a vector, and transformed into BL21 competent cells. After incubation at 37°C on an inverted plate overnight, single clones were selected and sent to Sangon for sequencing. After sequence alignment, the bacterial solution with the correct sequencing results was selected for protein expression.

[0084] (2) PVY-CP expression results

[0085] The bacterial solution with correct sequencing was treated with IPTG inducer as recommended, and protein analysis was performed on SDS-PAGE gel. The recombinant protein PVY-CP was expressed. Figure 3As shown, lane 1 is the bacterial precipitate, lane 2 is the bacterial supernatant, and lane 3 is the bacterial total protein, indicating that the recombinant protein PVY-CP mainly exists in the bacterial supernatant in a soluble form, and partially exists in the bacterial precipitate in the form of inclusion bodies.

[0086] (3) PVY-CP purification results

[0087] The cultured cells were lysed and ultrasonically disrupted. The supernatant was collected after low-temperature centrifugation, denatured by adding urea, filtered with a 0.45 μm filter membrane, eluted with 50 mM imidazole, 100 mM, and 300 mM imidazole, and analyzed by SDS-PAGE gel to see if the target protein was present. The results were as follows: Figure 4 As shown in Figure 2A, lane 1 is 50 mM imidazole eluate, lane 2 is 100 mM imidazole eluate, and lane 3 is 300 mM imidazole eluate. The proteins eluted with 100 mM and 300 mM imidazole were diluted, dialyzed, and concentrated, and the purity of the target protein was detected by SDS-PAGE gel. The results are shown in Figure 2B. Figure 4 As shown in Figure , lane 4 is the concentrated target protein, showing high purity.

[0088] Example 2: Preparation of Potato Virus Y Monoclonal Antibody Serum

[0089] 1. Immunization of mice

[0090] (1) The recombinant protein PVY-CP prepared and purified after prokaryotic expression in Example 1 was used as the immunogen. Three healthy Balb / c mice were selected. For the first immunization, 50 μg of PVY antigen was emulsified with an equal volume of Freund's complete adjuvant and injected subcutaneously at multiple points in the abdomen.

[0091] (2) After the first immunization, mice were immunized three times every 14 days with 50 μg of PVY antigen, emulsified with an equal volume of Freund's incomplete adjuvant, and injected subcutaneously at multiple points in the abdomen.

[0092] (3) Starting from the third immunization, blood was collected from the orbital venous plexus (or tail vein) of the mice 7 days after each immunization, and the antibody titer of the mouse blood was determined by indirect ELISA.

[0093] (4) After the mice are immunized until the serum titer reaches a qualified level, select mice with higher titers and intraperitoneally inject 50 μg of PVY antigen for booster immunization.

[0094] 2. Serum titer detection of immune mice

[0095] (1) Protein coating: The experimental group used ELISA coating solution to dilute the PVY antigen protein to 5 μg / mL, and the control group added ELISA coating solution, 100 μL / well, coated at 4°C overnight, and washed twice with PBST.

[0096] (2) Blocking: Prepare 3% skim milk powder, 380 μL / well, incubate at room temperature for 1 h, and wash twice with PBST.

[0097] (3) Sample addition: Dilute serum to the specified concentration, 100 μL / well, incubate at room temperature for 1 h, and wash twice with PBST.

[0098] (4) Secondary antibody: rabbit anti-mouse IgG-HRP 1:1000, 100 μL / well, incubate at room temperature for 1 h, and wash three times with PBST.

[0099] (5) Color development: TMB color development solution, solution A: solution B = 1:1, 100 μL / well, react at room temperature for 20 min.

[0100] (6) Termination: ELISA stop solution, 50 μL / well.

[0101] (7) Reading: The main wavelength of the microplate reader is 450 nm and the secondary wavelength is 630 nm.

[0102] Mice were immunized with PVY-CP as the immunogen. After the first immunization, booster immunizations were performed every 14 days for a total of three immunizations. The serum titer of mice was determined by indirect ELISA at the fourth immunization (Table 3). Among them, the immune titer of mouse No. 3 was the highest. Cell fusion experiments were performed 3 to 7 days after booster immunization.

[0103] Table 3. Mouse serum titers

[0104] Mouse number 1# 2# 3# One free date 2020 / 6 / 8 2020 / 6 / 8 2020 / 6 / 8 Second exemption date 2020 / 6 / 17 2020 / 6 / 17 2020 / 6 / 17 Three exemption dates 2020 / 7 / 1 2020 / 7 / 1 2020 / 7 / 1 Serum titer 9000 9000 27000

[0105] Example 3. Preparation of viral monoclonal hybridoma cells

[0106] 1. Cell Fusion

[0107] (1) In a biosafety cabinet, collect about 10 myeloma cells (Sp2 / 0) with vigorous growth and good morphology. 7 Place the cells in a 50 mL centrifuge tube and resuspend in serum-free DMEM (Glu 4.5 g / L) culture medium, which should be preheated in a 37°C incubator.

[0108] (2) 3 to 7 days after the booster immunization, the spleen of the immune-qualified mice was removed under sterile conditions, ground and sieved, and then centrifuged to collect spleen cells.

[0109] (3) After the spleen cells and Sp2 / 0 are mixed and centrifuged, chemical fusion is performed using the fusion agent PEG1450, and DMEM is added to terminate the reaction.

[0110] (4) Collect the fused cells by centrifugation, culture and screen them with high-glucose DMEM supplemented with NBS (newborn calf serum) and HAT. After about 8 days, perform a primary screening for fusion using indirect ELISA, and perform a secondary screening for fusion on the positive cell wells.

[0111] (5) Select monoclonal hybridoma cells that stably express antibodies. After the cells are expanded and cultured, the cells are taken for ascites production and frozen.

[0112] 2. Fusion Cell Screening

[0113] The BSA competitive ELISA method was used for detection, and the steps were as follows:

[0114] (1) Protein coating: Dilute PVY antigen or Y virus grinding solution with ELISA coating solution to the specified concentration, 100 μL / well, coat overnight at 4°C, and wash twice with PBST;

[0115] (2) Blocking: Prepare 3% skim milk powder, 380 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0116] (3) Sample addition: add 80 μL of cell supernatant at the original volume, incubate at room temperature for 1 h, and wash twice with PBST;

[0117] (4) Secondary antibody: rabbit anti-mouse IgG-HRP 1:1000, 100 μL / well, incubate at room temperature for 1 h, and wash three times with PBST;

[0118] (5) Color development: TMB color development solution A: solution B = 1:1, 100 μL / well, react at room temperature for 20 min;

[0119] (6) Termination: ELISA stop solution, 50 μL / well;

[0120] (7) Reading: The main wavelength of the microplate reader is 450 nm, and the secondary wavelength is 630 nm.

[0121] (8) Select cells with good vitality and perform the first subcloning.

[0122] This cell fusion yielded 16 positive cell lines (Table 4), and the cell subcloning experiment was continued.

[0123] Table 4. Fusion screening of mouse No. 3

[0124] Serial number Clone number PVY virus PVX virus 1 1A11 1.7545 0.2296 2 1B9 1.4536 0.2183 3 1D3 1.6785 0.1357 4 2B3 1.4094 0.1776 5 2B6 1.5496 0.1686 6 3B5 1.5341 0.1663 7 4B4 1.754 0.2476 8 4C1 1.7426 0.1516 9 4D6 1.5496 0.1388 10 4D12 1.5537 0.2366 11 4F1 1.4375 0.1958 12 4F10 1.7629 0.1882 13 4H1 1.7305 0.3145 14 5C7 1.9273 0.1496 15 5F4 2.1857 0.1591 16 6D10 1.4017 0.2037

[0125] 3. Cell Subclone Screening

[0126] Cell cloning was performed using the limiting dilution method. Positive cells were resuspended and counted, using a criterion of 1 cell per 200 μL of culture medium. Positive cells were diluted according to the count and 200 μL was added to each well of a 96-well plate. After 7 to 9 days, microscopic examination was performed and wells containing single cell clusters were marked. Positive cells were detected by indirect ELISA. The detection method is as follows:

[0127] (1) Protein coating: The experimental group used ELISA coating solution to dilute the PVY antigen protein to 1 μg / mL, and the control group added ELISA coating solution, 100 μL / well, coated at 4°C overnight, and washed twice with PBST;

[0128] (2) Blocking: Prepare 3% skim milk powder, 380 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0129] (3) Sample addition: Take the original cell supernatant, 80 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0130] (4) Secondary antibody: rabbit anti-mouse IgG-HRP 1:1000, 100 μL / well, incubate at room temperature for 1 h, and wash three times with PBST;

[0131] (5) Color development: TMB color development solution A solution: B solution = 1:1, 100 μL / well, react at room temperature for 20 min;

[0132] (6) Termination: ELISA stop solution, 50 μL / well;

[0133] (7) Reading: The main wavelength of the microplate reader is 450 nm, and the secondary wavelength is 630 nm.

[0134] (8) Select monoclonal hybridoma cells that stably express antibodies. After the cells are expanded and cultured, the cells are taken for ascites production and frozen.

[0135] After two cell subclonings, only the microscopically detected monoclonal and diclonal clones were selected for testing, and four positive monoclonal hybridoma cell lines were obtained (Table 5). The cells were expanded and cultured, and the cells were collected for ascites production and frozen.

[0136] Table 5. Subcloning results

[0137] Hybridoma cell number Antibody No. Antibody type Antibody subclass Chain 4F1B2G11 PVY-2 IgG IgG1 Kappa 3G2F5A11 PVY-3 IgG IgG1 Kappa 4F1B3B8 PVY-4 IgG IgG1 Kappa 4B4D8C3 PVY-5 IgG IgG1 Kappa

[0138] Example 4. Preparation of monoclonal antibodies against potato virus

[0139] 1. Ascites Preparation

[0140] Intraperitoneal injection of sensitizer liquid paraffin 0.5 mL / mouse, 7 days later intraperitoneal injection of positive hybridoma cells, each cell line inoculated one mouse. Each mouse was injected with 10 5 ~10 6 Cells were collected by centrifugation and resuspended in 1× PBS buffer before injection. From day 8, a slight bulge in the abdominal cavity of the mouse was observed. The mouse was kept until the abdominal cavity was swollen to the point of difficulty in movement. Ascites was collected by drainage multiple times, centrifuged, and frozen at -80°C.

[0141] 2. Ascites Purification

[0142] (1) Take ascites, dilute with PBS and filter (0.22 μm).

[0143] (2) Take the filtered sample and purify the protein through a Protein G column. The steps are as follows:

[0144] a) Wash with 5 column volumes of deionized water to remove air and 20% ethanol;

[0145] b) Equilibrate the column with 5-10 column volumes of buffer (PB buffer);

[0146] c) The sample was passed through the Protein G column at a rate of 0.5 mL / min;

[0147] d) Equilibrate the column with the above buffer;

[0148] e) Elute with glycine and neutralize with Tris.

[0149] (3) Collect the glycine-eluted sample and dialyze it against PBS at 4°C overnight.

[0150] (4) Take the dialyzed sample, concentrate it by ultrafiltration (ultrafiltration tube), and use SDS-PAGE gel to detect the purity of the target protein.

[0151] (5) Perform performance testing on antibodies that meet the required purity.

[0152] 3. Monoclonal Antibody Detection

[0153] A. Monoclonal Antibody Performance Testing

[0154] (1) Protein coating: dilute PVY-CP, Y virus grinding solution, X virus grinding solution, and healthy tissue grinding solution with ELISA coating solution, 100 μL / well, coat overnight at 4°C, and wash twice with PBST;

[0155] (2) Blocking: Prepare 3% skim milk powder, 380 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0156] (3) Sample addition: dilute PVY monoclonal antibody to the specified concentration, 100 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0157] (4) Primary antibody: rabbit anti-mouse IgG-HRP 1:1000, 100 μL / well, incubate at room temperature for 1 h, and wash three times with PBST;

[0158] (5) Color development: TMB color development solution A: solution B = 1:1, 100 μL / well, react at room temperature for 20 min;

[0159] (6) Termination: ELISA stop solution, 50 μL / well;

[0160] (7) Reading: The main wavelength of the microplate reader is 450 nm and the secondary wavelength is 630 nm.

[0161] B. Monoclonal Antibody Specificity Detection

[0162] (1) Total protein extraction: 0.1 g of plant tissue was taken, ground in liquid nitrogen, and 250 μL of total protein extraction solution and 5 μL of 50× protease inhibitor were added;

[0163] (2) Centrifuge at 13,000 rpm, 4°C for 15 min and remove the supernatant.

[0164] (3) Add loading buffer to the supernatant and mix well, boil in boiling water for 10 min, cool for 5 min, and centrifuge at 13,000 rpm at 4°C for 10 min;

[0165] (4) Prepare 10% SDS-PAGE separating gel and 5% stacking gel, add samples and run electrophoresis at 180 V until the loading buffer runs out;

[0166] (5) Soak the PVDF membrane in methanol for 15 s before the end of electrophoresis;

[0167] (6) After electrophoresis, soak the gel in transfer buffer for 15 min and transfer to the membrane at 100 V for 1–1.5 h.

[0168] (7) After the membrane is transferred, it is washed once with TBST, stained with Ponceau red and photographed, washed several times with TBST, and blocked with 5% skim milk powder in TBST at room temperature for 1 h.

[0169] (8) After blocking, add primary antibody diluted 1:5000 and incubate at 4°C overnight;

[0170] (9) After the primary antibody reaction is complete, wash the membrane with TBST four times, 15 min each time;

[0171] (10) Add secondary antibody diluted 1:5000 and incubate at room temperature for 1 h;

[0172] (11) After the secondary antibody reaction is complete, wash the membrane with TBST four times, 10 min each time;

[0173] (12) Add ECL color developing solution and take pictures.

[0174] Western Blot analysis of the specificity of PVY-2, PVY-3, PVY-4, and PVY-5 monoclonal antibodies revealed that they all reacted specifically with protein extracts from potato tissue culture seedlings infected with PVY, but not with protein extracts from potato tissue culture seedlings infected with PVX or healthy potato tissue culture seedlings ( Figure 5 ), which shows that the four PVY monoclonal antibodies have good specificity.

[0175] C. Monoclonal Antibody Pairing Test

[0176] (1) Protein coating: Dilute PVY monoclonal antibody to 1 μg / mL with ELISA coating solution, 100 μL / well, coat overnight at 4°C, and wash twice with PBST;

[0177] (2) Blocking: Prepare 3% skim milk powder, 380 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0178] (3) Sample addition: PVY tissue was diluted 500-fold, negative tissue was diluted 500-fold, 100 μL / well, incubated at room temperature for 1 h, and washed twice with PBST;

[0179] (4) Primary antibody: dilute the biotinylated PVY antibody to 1 μg / mL, 100 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0180] (5) Secondary antibody: Avidin-HRP 1:10000, 100 μL / well, incubate at room temperature for 1 h, and wash three times with PBST;

[0181] (6) Color development: TMB color development solution A: solution B = 1:1, 100 μL / well, react at room temperature for 20 min;

[0182] (7) Termination: ELISA stop solution, 50 μL / well;

[0183] (8) Reading: The main wavelength of the microplate reader is 450 nm, and the secondary wavelength is 630 nm.

[0184] When the absorbance value was 2 times or more greater than that of the negative control, the pairing was considered successful. According to the DAS-ELISA results (Table 6), only one pair of PVY monoclonal antibodies was successfully paired: when the coating antibody was PVY-5, the detection antibody was PVY-2.

[0185] Table 6. PVY monoclonal antibody pairing results

[0186] Coating antibody PVY-2 PVY-3 PVY-4 PVY-5 Primary Antibody↓ + - + - + + - PVY-2-bio 1.2647 0.2352 0.314 0.2574 0.194 0.1324 1.8372* 0.1898 PVY-3-bio 0.3199 0.1996 0.2617 0.233 0.2082 0.2519 0.4684 0.3469 PVY-4-bio 0.3032 0.2064 0.2154 0.2008 0.1568 0.1966 0.4134 0.2033 PVY-5-bio 0.2171 0.2262 0.1824 0.2099 0.1594 0.2197 0.2441 0.2284

[0187] Note: * indicates successfully paired antibodies

[0188] D. Monoclonal Antibody Sensitivity Test

[0189] (1) Protein coating: Dilute the potato virus Y tissue culture seedling grinding solution (1 g / mL) with ELISA coating solution, with a gradient dilution from 1:10 to 1:163840. For the negative control group, add healthy potato tissue extract diluted with ELISA coating solution, 100 μL / well, coat overnight at 4℃, and wash twice with PBST.

[0190] (2) Blocking: Prepare 3% skim milk powder, 380 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0191] (3) Sample addition: dilute PVY monoclonal antibody to the specified concentration, 100 μL / well, incubate at room temperature for 1 h, and wash twice with PBST;

[0192] (4) Secondary antibody: rabbit anti-mouse IgG-HRP 1:1000, 100 μL / well, incubate at room temperature for 1 h, and wash three times with PBST;

[0193] (5) Color development: TMB color development solution A: solution B = 1:1, 100 μL / well, react at room temperature for 20 min;

[0194] (6) Termination: ELISA stop solution, 50 μL / well;

[0195] (7) Reading: The main wavelength of the microplate reader is 450 nm and the secondary wavelength is 630 nm.

[0196] The results are as follows Figure 6 As shown, the PVY monoclonal antibody was coated with PVY and detected by direct ELISA method, and the sensitivity of the PVY monoclonal antibody could reach 1:5120 dilution.

[0197] The monoclonal antibodies PVY-2 and PVY-5 were sent to Albertson Biotechnology Co., Ltd. for sequencing. The nucleotide sequence of the PVY-2 heavy chain variable region is shown in SEQ ID NO.4, and the nucleotide sequence of the PVY-2 light chain variable region is shown in SEQ ID NO.5; the nucleotide sequence of the PVY-5 heavy chain variable region is shown in SEQ ID NO.6, and the nucleotide sequence of the PVY-5 light chain variable region is shown in SEQ ID NO.7.

[0198] Two hybridoma cell lines secreting monoclonal antibodies PVY-2 and PVY-5 were deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, and named 4F1B2G11 and 4B4D8C3, respectively; the deposit date of 4F1B2G11 was September 1, 2022, the deposit number was CCTCC NO: C2022281, and it was classified as hybridoma cell line 4F1B2G11; the deposit date of 4B4D8C3 was September 1, 2022, the deposit number was CCTCC NO: C2022282, and it was classified as hybridoma cell line 4B4D8C3.

[0199] Example 5: Preparation of PVY Nano-Mimetic Enzyme Test Strips

[0200] 1. PVY monoclonal antibody nanomimetic enzyme labeling screening

[0201] (1) Take the required amount of nanozyme solution, add purified water to a concentration of 0.5 mg / mL, and sonicate for 1-2 min (53 kHz);

[0202] (2) Centrifuge at 13,000 rpm at room temperature for 5–10 min.

[0203] (3) Remove the supernatant and add purified water to a concentration of 0.5 mg / mL. Resuspend and sonicate for 1–2 min.

[0204] (4) Centrifuge at 13,000 rpm at room temperature for 5–10 min and remove the supernatant.

[0205] (5) Weigh 10 times the mass of the nanozyme N-hydroxysuccinimide (NHS), add MES solution (50 mM, pH 6.0) and mix well to prepare a 10 mg / mL NHS solution; weigh 10 times the mass of the nanozyme 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC), add MES solution (50 mM, pH 6.0) and mix well to prepare a 10 mg / mL EDC solution. Keep away from light;

[0206] (6) Pipette equal volumes of the two solutions prepared in step 5 and add them to the nanozyme washed in step 4 to a concentration of 0.5 mg / mL. Resuspend and mix thoroughly, sonicate for 30-60 s, 3-5 times in total, and react on a mixer at room temperature for 30-40 min (keep away from light).

[0207] (7) Centrifuge at 13,000 rpm at room temperature for 5–10 min and remove the supernatant;

[0208] (8) Add MES solution (50 mM, pH 6.0) to a concentration of 0.5 mg / mL, shake to mix, and then sonicate for 1-2 minutes; centrifuge at 13,000 rpm at room temperature for 5-10 minutes, and remove the supernatant;

[0209] (9) Add 100 μg of PVY monoclonal antibody to MES solution (50 mM, pH 8.0) and mix well to prepare an antibody solution with a concentration of 0.1 mg / mL;

[0210] (10) Add the antibody prepared in step 9 to the washed nanozyme in step 8 to prepare a 1 mg / mL nanozyme solution, resuspend and mix, sonicate for 10-20 s, sonicate 5-10 times in total, and react on a mixer at 2-8°C for 14-18 h;

[0211] (11) Place the reaction solution on a magnetic rack, draw the clarified liquid into a new centrifuge tube, and use an ultra-micro protein detector to detect the antibody labeling efficiency of the clarified liquid. Add Tris-buffer (50 mM, pH 7.4) to the centrifuge tube to prepare a 0.5 mg / mL nanozyme solution, resuspend and mix, sonicate for 10-20 s, 5-10 times, and react at room temperature for 30-40 min.

[0212] (12) Place the reaction solution on a magnetic rack, remove the supernatant, add 5% BSA-PBS solution to prepare a 1 mg / mL nanozyme solution, resuspend, and ultrasonicate for 10-20 s, 5-10 times. The temperature of the ultrasonic cleaning instrument should be controlled at 2-8 °C. After resuspension, place it on a 2-8 °C mixer and seal it for 2-4 h.

[0213] (13) Magnetic adsorption, discard the supernatant, add 1% BSA-PBS treatment solution to prepare a 1 mg / mL nanozyme solution, resuspend, and sonicate for 10-20 s, 5-10 times. The temperature of the ultrasonic cleaning instrument should be controlled at 2-8°C. After resuspension, store at 2-8°C and label for later use.

[0214] 2. Pretreatment of conjugate pad, sample pad and absorbent pad

[0215] A. Pretreatment of conjugate pad

[0216] (1) Cut the glass fiber membrane into bonding pads with a width of 7 mm using an instrument;

[0217] (2) Prepare the conjugate pad pretreatment solution (1% Triton X-100, 50 mM sodium borate, pH 8.0);

[0218] (3) Take an appropriate amount of cut conjugate pad and place it in the conjugate pad pretreatment box. Use a pipette to draw conjugate pad pretreatment solution and drop it on the conjugate pad to soak it completely. Soak for 25-35 minutes.

[0219] (4) Use tweezers to clamp the soaked bonding pads onto a drying net, arrange them neatly, and dry them in an oven at 40°C for 2 h until completely dry.

[0220] (5) Place the dried bonding pad in a sealed bag, add an appropriate amount of desiccant, write a label, and store it in a dehumidifier for later use.

[0221] B. Sample Pad Pretreatment

[0222] (1) Cut the glass fiber membrane into sample pads with a width of 11 mm using an instrument;

[0223] (2) Prepare sample pad pretreatment solution (10 mM PBS, 1% Tween 20, 0.1 g / L PVP K30, pH 7.4);

[0224] (3) Take an appropriate amount of cut sample pad and place it in the sample pad pretreatment box. Use a pipette to draw the sample pad pretreatment solution and drop it on the sample pad to soak it completely. Soak for 25-35 minutes.

[0225] (4) Use tweezers to clamp the soaked sample pads onto a drying net, arrange them neatly, and dry them in an oven at 40°C for 2.5 h until they are completely dry.

[0226] (5) Place the dried sample pad in a sealed bag, add an appropriate amount of desiccant, write a label, and store it in a dehumidifier for later use.

[0227] C. Absorbent pad treatment

[0228] (1) Cut the absorbent paper into absorbent pads with a width of 22 mm using an instrument;

[0229] (2) Place the cut absorbent pads on a drying net, arrange them neatly, and dry them in an oven at 40°C for 2.5 hours;

[0230] (3) Place the dried absorbent pad in a sealed bag, add an appropriate amount of desiccant, write a label, and store it in a dehumidifier for later use.

[0231] D. NC film scribing operation

[0232] (1) Take a certain amount of PVY antibody, add coating buffer solution, and dilute to a coating antibody solution with a concentration of 1.5 mg / mL;

[0233] (2) Take a certain amount of goat anti-mouse IgG, add coating buffer solution, and dilute to a goat anti-mouse IgG solution with a concentration of 1 mg / mL;

[0234] (3) Turn on the streak sprayer and perform the cleaning procedure. After cleaning, place the catheter of pump 1 in the diluted PVY (test line) antibody solution, and place the catheter of pump 3 in the diluted goat anti-mouse IgG (quality control line) solution;

[0235] (4) Place the PVC backing plate with the NC film on the correct position of the marking sprayer and execute the marking procedure at a marking speed of 1 μL / cm;

[0236] (5) After marking, perform the cleaning procedure and turn off the machine. Mark the PVC backing board and place it in an oven to dry for 1 hour at 37°C.

[0237] E. Bonding pad gold spraying operation

[0238] (1) Take the nanozyme labeled with PVY antibody, put it into a centrifuge tube, adsorb it with a magnetic stand, discard the solution, add a certain amount of nanozyme labeled antibody diluent (50 mM Tris, 10% trehalose, 5% BSA, 1% Triton X-100, 1% Tween 20, 0.05% proclin, 1% PVP K30, pH 8.5), and dilute it to a nanozyme concentration of 1 mg / mL;

[0239] (2) Place the diluted nanozyme-labeled antibody solution in an ultrasonic instrument and sonicate 5 to 10 times, each time for 10 to 20 seconds;

[0240] (3) Turn on the line sprayer and perform the cleaning procedure. After cleaning, place the catheter of pump 2 into the nanozyme-labeled antibody solution after ultrasound.

[0241] (4) Place the pretreated conjugate pad in the correct position of the line sprayer and execute the spraying procedure at a spraying speed of 5 μL / cm;

[0242] (5) After the spray pad is completed, perform the cleaning procedure and turn off the machine. After marking the bonding pad, put it in the oven and dry it for 1 hour at 37℃.

[0243] 3. PVY Nano-mimetic Enzyme Test Strip Assembly

[0244] (1) Turn on the laminating machine, place the PVC board close to the working plate of the laminating machine, press the start suction to fix the PVC board, and try to place the PVC board in the middle position to prevent it from being in an active state when the release paper is opened;

[0245] (2) Assemble the test strips according to the selected combination;

[0246] (3) Press the start button and attach the dried NC membrane, conjugate pad, absorbent pad, and pre-treated sample pad to the backing plate with the absorbent pad pressing 2 mm against the NC membrane, the conjugate pad pressing 2 mm against the NC membrane, and the sample pad pressing 2 mm against the conjugate pad.

[0247] (4) After the plate attaching process is completed, turn off the plate attaching machine. Place the reagent strip plate in a dark environment with a humidity of ≤30% for storage;

[0248] (5) Place the pasted PVC board on the cutting machine, turn on the power and switch, lift the turning frame, adjust the position of the storage plate, clamp the finished large board, align the left end of the finished large board with the blade, and lower the turning frame;

[0249] (6) Set the test strip cutting width to 0.4 cm and click Start cutting;

[0250] (7) Place the cut test strips into the reagent cartridge; turn on the power of the automatic cartridge press, place the cartridge-loaded test strips on the cartridge press conveyor, click the "Run" button, and the machine will run until all reagent cartridges are pressed, then turn off the cartridge press;

[0251] (8) Place the test strips into a heat-sealed bag containing desiccant and heat-seal it;

[0252] (9) After heat sealing, mark the test strips and store them in a dehumidifier with a humidity not exceeding 30%.

[0253] 4. PVY Nano-simulated Enzyme Test Strip Performance Test

[0254] A. PVY nano-mimetic enzyme test strips can be used for screening

[0255] (1) Grind the PVY-infected tissue culture seedlings into powder with liquid nitrogen, add extraction buffer, vortex to mix, and centrifuge at 4000 g for 2 min at room temperature;

[0256] (2) Add the positive control and blank control to the assembled test strips respectively;

[0257] (3) After adding the sample to the sample hole, time at room temperature for 15 minutes;

[0258] (4) Observe the test strips to see if there are any false positives, and record the test strip numbers if there are no false positives.

[0259] Prepare PVY nano-mimetic enzyme test strips and select antibodies based on the DAS-ELISA pairing results.

[0260] Only one pair of PVY monoclonal antibodies was successfully paired: PVY-2 and PVY-5. PVY-2 and PVY-5 were labeled, respectively, and PVY-5 and PVY-2 were coated. When a positive sample was added to a PVY nanomimetic enzyme test strip prepared with PVY-2 as the labeled antibody and PVY-5 as the coating antibody, bands appeared simultaneously along the C line (control line) and the T line (test line), indicating a positive result. However, after adding a negative control, bands also appeared along the C and T lines, indicating a false positive. When a positive sample was added to a PVY nanomimetic enzyme test strip prepared with PVY-5 as the labeled antibody and PVY-2 as the coating antibody, bands appeared simultaneously along the C and T lines, indicating a positive result. However, after adding a negative control, only the C line appeared, indicating a negative result.

[0261] Finally, a PVY nano-mimetic enzyme test strip was prepared using PVY-5 as the labeled antibody and PVY-2 as the coating antibody.

[0262] B. Specific detection of PVY nano-mimetic enzyme test strips

[0263] (1) Conduct specific testing on the test strips that do not show false positives,

[0264] (2) Grind the plants infected with PVA, PVM, PVS, PVY, PVX and PLRV and the healthy plants into powder with liquid nitrogen, add the extraction buffer, and vortex to mix;

[0265] (3) Centrifuge at 4000 g for 2 min at room temperature and collect the supernatant;

[0266] (4) After adding the sample to the sample hole, time it at room temperature for 15 minutes, and observe and record the experimental results.

[0267] The results are as follows Figure 7 As shown, when the juice of PVA, PVM, PVS, PVX, PLRV and healthy plants was dropped into the test strip, only the C line appeared on the test strip, which was a negative result, indicating that the test strip did not have an immune reaction with PVA, PVM, PVS, PVX, PLRV and healthy plants. When the juice of PVY plant was dropped into the test strip, both the C line and the T line appeared, which was a positive result, indicating that the test strip had an immune reaction with PVY and had good specificity.

[0268] C. PVY nano-mimetic enzyme test strip sensitivity detection

[0269] (1) Grind the PVY-infected tissue culture seedlings into powder with liquid nitrogen, add 1 ml of extraction buffer per 0.1 g of plant tissue, and vortex to mix thoroughly;

[0270] (2) Centrifugation at 4000 g for 2 min at room temperature;

[0271] (3) The supernatant was diluted with water at a ratio of 1:10 and 1:10. 2 , 1:10 3 , 1:10 4 , 1:10 5 5. Perform gradient dilution;

[0272] (4) Vortex the diluted sample and add it dropwise to the sample well. Count for 15 minutes at room temperature and observe and record the experimental results.

[0273] The results are as follows Figure 8 As shown, PVY nano-mimetic enzyme test strips can be used at 1:10, 1:10 2 , 1:10 3 After dilution, C line and T line appear at the same time, the test result is positive, and PVY can be detected. When the dilution ratio is 1:10 4 , 1:10 5 After dilution, only the C line appeared and no T line appeared. The result was negative and PVY could not be detected.

[0274] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. A nano-mimetic enzyme reagent strip containing two types of paired PVY monoclonal antibodies, characterized in that: The device consists of an absorbent pad, an NC membrane, a conjugation pad, a sample pad, and a backing plate. From top to bottom, the absorbent pad presses the NC membrane, the conjugation pad presses the NC membrane, and the sample pad presses the conjugation pad, and they are sequentially bonded to the same surface of the backing plate. The conjugation pad is coated with a monoclonal antibody PVY-5 labeled with a nanomimetic enzyme. The NC membrane is provided with a detection line and a control line, with the detection line located between the conjugation pad and the control line. The detection line is coated with a monoclonal antibody PVY-2, and the control line is coated with a secondary antibody. The monoclonal antibodies PVY-2 and PVY-5 can be paired; the PVY-2 is secreted by the hybridoma cell line 4F1B2G11 with a deposit number of CCTCC NO: C2022281, and the PVY-5 is secreted by the hybridoma cell line 4B4D8C3 with a deposit number of CCTCC NO: C2022282; The amino acid sequence of the heavy chain variable region of the PVY-2 monoclonal antibody is shown in SEQ ID NO.4, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.5; the amino acid sequence of the heavy chain variable region of the PVY-5 monoclonal antibody is shown in SEQ ID NO.6, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.7; PVY-2 and PVY-5 can simultaneously produce specific immune reactions with the 30KDa coat protein of potato virus Y, and the antibody type and subclass are both IgG1, and the chain type is both Kappa light chain.

2. The nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies according to claim 1, characterized in that: The nano-mimetic enzyme is Fe3O4 magnetic nanoparticles.

3. The nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies according to claim 2, characterized in that: The method for labeling monoclonal antibody PVY-5 with nanomimetic enzyme is as follows: after washing the nanoenzyme with purified water, NHS and EDC are added and mixed, ultrasonicated and activated at room temperature, monoclonal antibody PVY-5 is added at a mass ratio of nanomimetic enzyme to monoclonal antibody PVY-5 of 10:1, and the antibody and nanoenzyme are coupled to obtain nanomimetic enzyme-labeled monoclonal antibody PVY-5.

4. The nanomimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies according to claim 3, characterized in that: The control line was coated with a secondary antibody, goat anti-mouse IgG.

5. The nano-mimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies according to claim 4, characterized in that: The test strip has a detection sensitivity of 10 for leaves infected with potato virus Y. -4 g / mL.

6. Use of the nanomimetic enzyme reagent strip containing two pairable PVY monoclonal antibodies according to any one of claims 1 to 5 in the detection of potato PVY virus.

Images