OsSERK4 promoter and its application

Abstract

This application provides UsSERK4 Promoter and its application, by intercepting UsSERK4 The DNA sequence of 3234bp upstream of the ATG initial codon of the CDS sequence was used to design PCR primers. After the PCR fragment was obtained, the full-length sequence was connected to the pEASY-Blunt Zero vector, transformed into Escherichia coli, and the plasmid was extracted for sequencing to obtain the OsSERK4 promoter. Experiments have shown that the OsSERK4 promoter can be specifically induced to express by rice grassy stunt virus, and its promoter plays an indispensable role in responding to rice grassy stunt virus infection and regulating gene expression levels. The present invention provides a new tool for future research on the resistance of rice and other plants.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to a OsSERK4 Promoters and their applications. Background Art

[0002] Rice is one of the most important food crops in my country and the world. It has long been attacked by a variety of pathogens, resulting in a reduction in its yield. Among them, rice virus is known as "rice cancer". Rice virus disease is an infectious disease caused by a type of vector insect that carries the virus. Due to the explosive nature of the virus, the occurrence of the disease will cause a reduction in rice production or even a complete failure. According to data from the National Agricultural Technology Center, the areas of major rice virus diseases in 2018-2022 were 10 million, 10 million, 5 million, 3 million and 2 million mu respectively. The large area of ​​disease seriously harms rice production. Among them, rice grassy stunt virus (RGSV) is a member of the genus Tenuivirus of the family Bunyaviridae. RGSV infection of rice was first discovered in the Philippines in 1963. In recent years, it has broken out in many countries and regions in East Asia, Southeast Asia and South Asia. The virus disease was first discovered in Fujian Province, my country in 1979, causing a large-scale reduction in rice production or even a total crop failure, resulting in huge economic losses for farmers. RGSV is transmitted by the vector insect brown planthopper (Nilaparvatalugens) in a persistent proliferation mode, without egg transmission. The RGSV virus particles are branched filaments with a diameter of 4-8nm, and most are about 950-1350nm long. After RGSV infects rice, the diseased plants are significantly dwarfed, the rice heading is incomplete or the grains are shriveled, most of which do not heading at all, and the tillers increase and resemble grass, which are typical symptoms of rice grassy stunt disease. There is no effective prevention and control strategy for this disease so far.

[0003] Many members of the OsSERKs gene family of somatic embryogenesis receptor kinases in rice are induced by abscisic acid (ABA) and pathogen infection, but their functions have yet to be confirmed (Singla et al., 2009). At present, there is no relevant function report for OsSERK4. The promoter itself is not transcribed, but some promoters (such as tRNA promoters) are located downstream of the transcription start site, and these DNA sequences can be transcribed. At present, in rice virus research, only the promoter of OsAGO18 can specifically respond to rice stripe virus infection (Li Yi., 2017). Rice SERK4 protein plays an important role in rice antiviral defense (unpublished), and its promoter plays an indispensable role in responding to rice grassy stunt virus infection and regulating gene expression levels. Summary of the invention

[0004] The object of the present invention is to provide OsSERK4 Promoters and their applications.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] OsSERK4 The promoter sequence is shown in SEQ ID NO.1.

[0007] A recombinant vector comprising the promoter.

[0008] A recombinant bacterium comprising the promoter.

[0009] An expression cassette comprising said promoter.

[0010] The expression cassette is composed of the OsSERK4 The promoter, as described OsSERK4 The promoter starts the expression of the target gene, and the transcription termination sequence; OsSERK4 The promoter is linked to the target gene in a functional manner, and the target gene is linked to the transcription termination sequence.

[0011] Said OsSERK4 The application of promoters in initiating the expression of target genes in plants,

[0012] The expression of the target gene in the plant is initiated by: when the plant is induced by the pathogen of rice strawy dwarf disease, the expression level of the target gene increases; the plant is rice.

[0013] The pathogen of the rice strawy stunt disease is rice strawy stunt virus.

[0014] Said OsSERK4 Application of promoter in improving rice resistance to rice grassy dwarf disease.

[0015] A method for cultivating transgenic plants comprises the following steps: introducing the expression box into a target plant to obtain a transgenic plant; the transgenic plant can start the expression of the target gene when induced by the pathogen of rice strawy dwarf disease; the plant is rice.

[0016] The expression cassette is introduced into the target plant via a recombinant vector, and the pathogen of rice strawy stunt disease is rice strawy stunt virus.

[0017] The advantages of the present invention are:

[0018] At present, there is no report of a DNA fragment that can be specifically induced by rice grassy stunt virus. The present invention provides a DNA fragment that has specific induction activity by rice grassy stunt virus infection in rice, which is used to identify the infection of rice grassy stunt virus. There is no relevant function report of OsSERK4 promoter. The present invention relates to a DNA fragment with rice transcription promoter activity, and the present invention relates to a vector and a transgenic plant containing the promoter. In addition, the present invention also relates to the use of the promoter for regulating the expression of a target gene in a plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Real-time quantitative PCR detection GUS Gene expression results.

[0020] Figure 2 OsSERK4p:GUS GUS staining analysis results of transgenic rice after RGSV infection.

[0021] Figure 3 OsSERK4 Promoter transgenic rice materials were inoculated with rice virus to detect virus accumulation. Among them, A is protein immunoblotting to detect virus infection, and B is qRT-PCR to detect virus accumulation. DETAILED DESCRIPTION

[0022] Embodiment 1, discovery OsSERK4 The promoter can be induced by rice strawy stunt virus

[0023] 1. Obtaining the Rice OsSERK4 Promoter

[0024] The promoter of a known gene is generally a DNA sequence located in the 5' upstream region of the structural gene. OsSERK4 The sequence was in the Rice Genome Annotation Database ( http: / / rice.plantbiology.msu.edu / ) is publicly available and can be retrieved through LOC_Os02g18320, intercepted OsSERK4 PCR primers were designed based on the DNA sequence 3234 bp upstream of the ATG initiation codon of the CDS sequence.

[0025] 1) Obtaining rice cDNA template

[0026] According to the instructions, TRIzol Reagent from Invitrogen was used to extract Nipponbare rice ( Oryza sativa L. japonica. cv. Nipponbare ) total RNA, and the RNA reverse transcription kit of genestar company was used to finally obtain the rice cDNA template obtained by reverse transcription.

[0027] 2) Obtaining the Rice OsSERK4 Promoter

[0028] Use the following OsSERK4-promoter-end primers to amplify the fragment using rice cDNA as a template. The primers are:

[0029]

[0030] After obtaining the fragment by PCR, the full-length sequence was connected to the pEASY-Blunt Zero vector, transformed into Escherichia coli, and the plasmid was extracted for sequencing.

[0031] Obtaining the plant expression vector pCambia1391-OsSERK4 promoter-GUS: The DNA molecule shown in SEQ ID NO.1 in the sequence list was connected to the pEASY-Blunt Zero vector. The plasmid with the correct sequence was used to generate the vector containing NEB's Kpn I and SalI restriction endonucleases (Cat. No.: R0142S, R3138M respectively) were used to digest the vector. Kpn A plant expression vector carrying the target gene was obtained between the SalI and SalI restriction sites.

[0032] 2. Transfer OsSERK4 Acquisition of promoter-GUS rice (genetic transformation by Wuhan Boyuan Company)

[0033] 1. Callus induction culture

[0034] Nipponbare rice ( Oryza sativa L. japonica. cv. Nipponbare , hereinafter also referred to as wild-type rice) seeds are shelled, soaked in 70% ethanol for 10 minutes, and then soaked in 0.1% mercuric chloride for 30 minutes; surface sterilization is performed. Wash the solution on the surface of the seeds with a large amount of sterile water, and absorb the moisture on the surface of the seeds with sterile filter paper. The seeds are placed on a plate of mature embryo callus induction medium (see the table below for the formula), the edge of the plate is sealed with Parafilm film, and cultured in a 26℃ incubator away from light. After about 15 days, carefully remove the grown callus tissue, transfer it to the mature embryo subculture medium (see the table below for the formula), and continue to culture under the same conditions. Subculture is required every two weeks. When used for transformation, it is necessary to select granular callus tissue that has been subcultured for about 5 days and is light yellow.

[0035] The required culture medium formula is as follows:

[0036] a) NB basic medium:

[0037]

[0038]

[0039] b) Mature embryo callus induction medium and subculture medium:

[0040]

[0041] 2. Cultivation of Agrobacterium

[0042] The plasmid pCambia1391-OsSERK4promoter-GUS was electroporated into Agrobacterium EHA105 (conventional Agrobacterium, laboratory storage, see Zhu et al., 2005. The Rice Dwarf Virus P2 Protein interacts withent-Kaurene Oxidases in vivo, leading to reduced biosynthesis of Gibberellinsand rice dwarf symptoms. Plant Physiology. 139:1935-1945.) to obtain the recombinant bacteria EHA105 / pCambia1391-OsSERK4promoter-GUS. The bacteria that could grow on the Agrobacterium culture medium LB plate (the formula is as shown in the table below) were screened, and the PCR amplification with the primers: GUS-F: TCTTGCGAAGGATAGTGGGA, GUS-R: AACGCTGATCAATTCCAACAG obtained a PCR product of 901 bp, which was the positive bacteria, namely the recombinant bacteria EHA105 / pCambia1391-OsSERK4promoter-GUS.

[0043] Streak EHA105 / pCambia1391-OsSERK4promoter-GUS on LB plates containing antibiotics (50 mg / L Kanamycin, 50 mg / L Rifampicin) and culture at 28°C for 2 days. Pick a single colony and inoculate it into liquid LB medium and culture it at 28°C with shaking until the OD 600 The concentration of acetosyringone was about 0.5, and acetosyringone was added to a final concentration of 100 mM to obtain an Agrobacterium suspension for transforming rice callus.

[0044] LB plate formula for Agrobacterium culture medium:

[0045]

[0046] (3) Co-culture of rice callus and Agrobacterium

[0047] Place the subcultured callus in a sterilized conical flask and pour in the Agrobacterium suspension to submerge the callus. Leave at room temperature for 20 minutes and gently shake from time to time to allow the callus to fully contact the bacterial solution. Gently remove the callus with sterile tweezers, place it on a sterile filter paper to absorb the excess bacterial solution, and transfer it to a co-culture medium plate (formula see the table below) covered with a layer of sterile filter paper. Culture in the dark at 28°C for 2-3 days to obtain co-cultured callus.

[0048] The required culture medium formula is as follows:

[0049] a) Co-cultivation medium:

[0050]

[0051] (4) Screening and differentiation of resistant callus

[0052] Wash the co-cultivated callus with an appropriate amount of sterile water to remove residual Agrobacterium on the surface, place it on the screening medium (see the formula below), and culture it in the dark at 26°C for screening. After two weeks, transfer it to a new screening medium and continue screening for two weeks. Select the callus that is in good condition after two rounds of screening, transfer it to a differentiation medium (see the formula in the table below), culture it in the dark for 3 days, and then transfer it to a light incubator (15hr / day) for light culture. Differentiated seedlings can be seen after one month. When the differentiated seedlings grow to about 2cm, transfer them to the rooting medium (see the formula in the table below) in a conical flask and continue to culture for about two weeks. Select seedlings with good growth and developed root systems, wash the culture medium on the roots with tap water, and transplant them into the soil. Collect the seeds to obtain T0 generation transgenic plants. OsSERK4promoter - GUS Rice seeds are sown to obtain T1 generation transgenic rice for future use.

[0053] The required culture medium formula is as follows:

[0054] a) Screening medium:

[0055]

[0056] b) Differentiation Medium:

[0057]

[0058] c) Rooting medium:

[0059]

[0060] 3. After RGSV infects rice, the SERK4 promoter is activated and the GUS gene expression is initiated

[0061] 1. Preparation of cDNA after transgenic rice infection

[0062] The transgenic rice of the same period was infected with RGSV virus (rice grassy stunt virus), and the rice infected with non-toxic insects was used as a control. Two weeks after infection, 0.5g of the diseased leaves were taken and ground into powder in liquid nitrogen. After grinding in liquid nitrogen, total RNA was extracted according to the TRIzol Reagent instructions of Invitrogen (Invitrogen Trizol Reagent, cat No.15596-018 instructions). After determining the total RNA concentration, 0.5ug of total RNA was taken and the RNA reverse transcription kit of Genestar was used for subsequent experiments. The system is as follows:

[0063]

[0064] Mix well and centrifuge, react at 37℃ for 5 min to remove genomic DNA. After the reaction is completed, add other components required for the reaction:

[0065]

[0066] Mix slowly and centrifuge. Set the program to 42℃ for 15 min and 85℃ for 5 min. After the reaction, place the cDNA on ice or in a refrigerator at -20℃. Then perform real-time fluorescence quantitative PCR (qPCR) to dilute the cDNA template 20 times.

[0067] 2. Real-time quantitative PCR detection GUS Gene expression

[0068] Using rice cDNA obtained by reverse transcription as a template, real-time PCR was used to GUS Genes were detected, and the experimental method was based on the instructions of 2×RealStar Green Fast Mixture (Cat. No. A301-10) from GenStar. The primers were:

[0069]

[0070] The internal reference gene is rice EF (Genbank: AF030517), and the primers are:

[0071]

[0072] The results are as follows Figure 1 As shown, GUS The mRNA level increased significantly in rice plants infected with RGSV compared with uninfected plants, indicating that RGSV infection can activate SERK4 Promoter, start GUS Gene expression.

[0073] Embodiment 2, OsSERK4p:GUS GUS staining analysis of transgenic T1 rice after RGSV infection

[0074] 1. Acquisition of Materials

[0075] The transgenic rice plants at the same seedling stage were infected with RGSV virus, and rice plants infected with non-toxic insects were used as controls. Two weeks after infection, the whole rice plants were collected as materials for GUS staining.

[0076] 2. GUS staining experiment

[0077] GUS histochemical staining was performed according to the method described by Liang et al. (1989).

[0078] 1. Use a double-sided blade to cut the whole rice plant into small sections, separate the roots, stems and leaves. Try to cause less damage to the plant during the cutting process to ensure the integrity of the tissue.

[0079] 2. Immediately place the cut materials in 90% acetone fixative and fix on ice for 1 hour.

[0080] 3. Pour out the acetone, add GUS cleaning solution, and pump on ice for 10 minutes. Be careful to prevent the liquid from rushing out during the pumping process and keep the stained material immersed in GUS cleaning solution. Repeat three times.

[0081] 4. After pouring out the GUS cleaning solution, add GUS staining solution to ensure that the plants are immersed in the staining solution, and stain at 37℃ in the dark for 3-17 hours.

[0082] 5. After staining, use 70% ethanol to decolorize and replace with 70% ethanol until decolorization is complete.

[0083] 6. Use a stereoscope to observe the staining of the plant material and take photos. The stained tissue can be permanently preserved in 70% ethanol.

[0084] The results are as follows Figure 2 As shown, OsSERK4p:GUS After RGSV infection, transgenic rice turned blue after GUS staining. GUS Gene expression is not tissue specific, indicating OsSERK4 The promoter can be activated under the conditions of RGSV infection, initiating the systemic expression of the gene.

[0085] Embodiment 3, OsSERK4 Promoter transgenic rice material inoculated with rice virus to detect virus accumulation

[0086] Western blot detection of transgenic rice after RGSV infection OsSERK4Expression of SERK4 protein driven by the promoter.

[0087] Preparation of SDS-PAGE gel: It consists of an upper concentrated gel and a lower separation gel. The concentration of the lower separation gel is determined according to the molecular weight of the protein, while there is no concentration difference for the concentrated gel. First, clean the gel plate, then rinse it with ddH2O, dry it, and fix the gel plate with a gel rack. Prepare the separation gel according to Table 2-1, add the required reagents in sequence, TEMED is a catalytic coagulant, and needs to be added last. After the mixture is fully mixed, add it to the gel plate, leaving a length of about 2 cm for the gel plate, absorb 1 mL of ddH2O and slowly add it to the gel plate to flatten the gel surface and seal it. After standing for 20 minutes, the boundary between the separation gel and ddH2O can be observed, and the separation gel has solidified; pour out the ddH2O, let it stand for 2-3 minutes, and after the water evaporates, prepare the concentrated gel according to Table 2-2, add the concentrated gel to the upper layer of the separation gel, slowly insert the comb, and let it stand for 20 minutes. After the concentrated gel solidifies, the SDS-PAGE gel is successfully prepared and can be used directly or stored in water.

[0088] Table 2-1 10% SDS-PAGE separation gel formula

[0089]

[0090] Table 2-2 SDS-PAGE stacking gel formula

[0091]

[0092] The specific steps of Western blot are as follows:

[0093] 1. The SD-PAGE gel was successfully prepared, moisturized and stored in a 4°C refrigerator for the next experiment.

[0094] 2. Sample loading: Insert the SD-SPACE gel into the electrophoresis tank, add electrophoresis solution, pull out the comb to load the sample, and perform electrophoresis at a constant current of 20-25 mA for each gel for 50-70 min;

[0095] 3. Semi-dry transfer: Use the marker as an indicator. When the protein band of the target size can be clearly distinguished, end the electrophoresis, cut the SDS-PAGE gel of the band adjacent to the target band, cut two pieces of transfer filter paper (Bio-Rad) of the same size and a piece of NC membrane (or PVDF membrane), and completely wet the cut SDS-PAGE gel, filter paper and NC membrane with protein transfer buffer. Stack them in the order of filter paper-NC membrane-SDS-PAGE gel-filter paper, and place them on the semi-dry transfer instrument in sequence. To avoid affecting the transfer, exhaust air bubbles between each layer. Transfer the membrane at a constant voltage of 16-20V for 20-35 minutes. After the transfer, stain with Ponceau red as an internal reference and take pictures. After the transfer, wash off the Ponceau red dye with TBST.

[0096] 4. Blocking: Use TBST solution to prepare 5% skim milk as blocking solution. After the transfer, place the NC membrane in a container of appropriate size and add blocking solution. The NC membrane must be completely immersed in the blocking solution. Block at room temperature at a low speed of 45 rpm for 2 hours, or block at 4°C overnight.

[0097] 5. Primary antibody: According to the titer ratio of different antibodies, add an appropriate amount of primary antibody to the new blocking solution, place the blocked membrane in it, the membrane needs to be completely infiltrated, and incubate at room temperature on a low-speed shaker at 45 rpm for 90 min or at 4°C overnight;

[0098] 6. Wash the membrane: Recover the primary antibody (it can be reused about three times depending on the titer), wash the residual primary antibody with TBST buffer, then add new buffer to wash the membrane, wash at room temperature at 80 rpm for 5 min, and repeat five times;

[0099] 7. Secondary antibody: Add an appropriate amount of secondary antibody to the blocking solution according to the titer ratio of the secondary antibody, place the washed NC membrane in it (the membrane must be completely infiltrated), and incubate at room temperature on a low-speed shaker (45 rpm) for 40 min;

[0100] 8. Wash the membrane: same as step 6;

[0101] 9. Exposure: Prepare the commercial substrate, evenly add it on the NC membrane, react for 1-2 minutes, absorb the excess substrate, place the NC membrane in a dark folder, put the film in the dark folder in the dark, wait for 30 seconds (the length of time can be adjusted according to the specific situation), take out the film, and put it in the film processor for development and fixing reaction.

[0102] Preparation of reagents required for the experiment:

[0103] 1 M Tris-HCl (1000 mL, pH 6.8): Weigh 121.1 g of Tris powder and dissolve it in 800 mL of ddH2O. Adjust the pH to 6.8 with concentrated hydrochloric acid and then make up to 1000 mL.

[0104] 1.5 M Tris-HCl (1000 mL, pH 8.8): Weigh 187.1 g of Tris powder and dissolve it in 800 mL of ddH2O. Adjust the pH to 8.8 with concentrated hydrochloric acid and then make up to 1000 mL.

[0105]

[0106] Add each reagent according to the above table and mix well to obtain the plant total protein extraction buffer.

[0107] 10× electrophoresis buffer (1000 mL)

[0108]

[0109] Add the reagent to 800 mL of ddH2O, heat until fully dissolved, and then make up to 1000 mL.

[0110] Western blot results Figure 3 As shown in A, after RGSV infection, the RGSV coat protein (PC5) antibody was used to detect the results. The results showed that only the RGSV-inoculated OsSERK4p :GUS transgenic rice can detect the correct size band, and the non-RGSV-inoculated OsSERK4p : No bands were detected in GUS transgenic rice, indicating OsSERK4p :GUS transgenic rice inoculated with RGSV virus was successful.

[0111] 3. Real-time quantitative PCR detection of viral accumulation, the results are as follows Figure 3 As shown in .B. After RGSV infection, OsSERK4p : GUS transgenic rice expressed significantly higher expression than that of rice not inoculated with RGSV OsSERK4p : The low expression level of GUS transgenic rice further proves OsSERK4p : The inoculation of GUS transgenic rice with RGSV virus was successful. The specific experimental steps refer to the real-time quantitative PCR detection of GUS gene expression in Example 1. The primers used are as follows:

[0112]

[0113] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. Application of OsSERK4 promoter in improving rice resistance to rice grassy dwarf disease, characterized in that: The promoter sequence is shown as SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The invention also comprises a recombinant vector, a recombinant bacterium and an expression box of an OsSERK4 promoter.

3. The use according to claim 2, characterized in that: The expression cassette consists of an OsSERK4 promoter with promoter function, a target gene whose expression is driven by the OsSERK4 promoter, and a transcription termination sequence; the OsSERK4 promoter is functionally connected to the target gene, and the target gene is connected to the transcription termination sequence.

4. Application of OsSERK4 promoter in promoting expression of target gene in plants, characterized in that: The expression of the target gene in the plant is initiated as follows: when the plant is induced by the pathogen of rice strawy dwarf disease, the expression level of the target gene increases; the plant is rice; and the promoter sequence is shown in SEQ ID NO.

1.

5. The use according to claim 4, characterized in that: The pathogen of the rice strawy stunt disease is rice strawy stunt virus.

Images