A PPFIBP1-RET fusion gene and a detection kit, detection method and application thereof

The detection of PPFIBP1-RET gene fusion through fluorescent quantitative PCR technology solves the shortcomings of RET gene fusion detection in NSCLC, achieves higher detection accuracy and sensitivity, and is suitable for screening or diagnosis of lung cancer.

CN116334114BActive Publication Date: 2025-10-17HANGZHOU LC BIOTECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211627423.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-16
Publication Date
2025-10-17
Estimated Expiration
2042-12-16

AI Technical Summary

Technical Problem

With existing technologies, the detection of RET gene fusion in non-small cell lung cancer (NSCLC) has not been fully covered, and there is a lack of effective detection methods to improve detection accuracy.

Method used

A detection method based on fluorescence quantitative PCR technology was developed. By designing specific primers and probes, PPFIBP1-RET gene fusion was detected. Reverse transcriptase and DNA polymerase were used for reverse transcription and amplification, and the results were analyzed in combination with FAM and ROX fluorescent-labeled probes.

Benefits of technology

It provides higher detection specificity and sensitivity, is simple and fast, safe to operate, and has a high degree of automation, making it suitable for the screening or diagnosis of lung cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334114B_ABST
    Figure CN116334114B_ABST
Patent Text Reader

Abstract

The application discloses a PPFIBP1 and RET fusion gene, and belongs to the technical field of gene detection. The nucleotide sequence of the fusion gene is shown as SEQ ID No. 1. The application further discloses a kit and a method for detecting expression of the fusion gene and application thereof. The application provides a novel fusion gene, and provides more indexes for screening or diagnosis of cancer, especially lung cancer. The application detects expression of the fusion gene based on a fluorescent quantitative PCR technology, and has the advantages of high specificity, high sensitivity, convenience and rapidness, simple and safe operation, and high automation degree.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of gene detection, and particularly relates to a PPFIBP1-RET fusion gene, a detection kit, a detection method and application thereof. BACKGROUND

[0002] The RET gene is located on the long arm of chromosome 10 and encodes a receptor tyrosine kinase. It is expressed in normal neurons, sympathetic and parasympathetic ganglia, thyroid C cells, adrenal medulla cells, urogenital tract cells, and testicular germ cells. After RET protein activation, it activates downstream signaling pathways (including RAS, MAPK, ERK, PI3K, AKT, etc.), leading to cell proliferation, migration and differentiation.

[0003] RET gene fusion caused by chromosomal rearrangement also occurs in non-small cell lung cancer (NSCLC), and the frequency of RET gene fusion in NSCLC is about 1%-2%. Currently, four RET gene fusion partner genes have been identified, which are KIF5B, CCDC6, TRIM33 and NCOA4. More RET gene fusion partner genes are clinically waiting to be explored to improve the detection accuracy of NSCLC. SUMMARY

[0004] In order to solve the above technical problems, the inventors accidentally found a new type of RET gene fusion in non-small cell lung cancer clinical sample research, that is, fusion with PPFIBP1 gene, and developed a method for detecting PPFIBP1-RET gene fusion mutation based on fluorescence quantitative PCR technology, thereby completing the present application.

[0005] The first aspect of the present application provides a PPFIBP1 and RET fusion gene, and the amino acid sequence is shown as SEQ ID No. 1.

[0006] The breakpoint of the fusion gene occurs on the 7th intron of the PPFIBP1 gene and the 11th intron of the RET gene. The sequence before the breakpoint is shown as SEQ ID No. 2, which belongs to the PPFIBP1 gene; the sequence after the breakpoint is shown as SEQ ID No. 3, which belongs to the RET gene.

[0007] The PPFIBP1 protein encoded by the PPFIBP1 gene is a member of the liprin family of LAR protein-tyrosine phosphatase interacting proteins. Liplin family proteins interact with members of the transmembrane protein tyrosine phosphatase LAR family, which is important for axon guidance and mammary gland development.

[0008] The RET gene is a proto-oncogene tyrosine-protein kinase receptor Ret, located at 10q11.2, with a full length of 60 kb, containing 21 exons, encoding a tyrosine kinase receptor superfamily protein of 1100 amino acids. The RET gene plays an important role in organogenesis and neural development.

[0009] The fusion gene described above occurs at the genomic level, and the nucleotide sequence of the reverse transcription product (i.e. cDNA) of the transcript (i.e. RNA) is shown in SEQ ID No. 4.

[0010] The second aspect of the present application provides a vector comprising the reverse transcription product (cDNA) sequence described in the first aspect of the present application. The vector can be used to prepare a positive control.

[0011] The third aspect of the present application provides a kit for detecting the expression of the fusion gene described in the first aspect of the present application, comprising a first primer pair for amplifying the reverse transcription product of the transcript of the fusion gene and a first probe targeting the amplification product of the first primer pair, wherein the upstream and downstream primers of the first primer pair have the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6, respectively, and the first probe has the nucleotide sequence shown in SEQ ID No. 7.

[0012] Further, the kit further comprises a second primer pair for amplifying the reference gene REF and a second probe targeting the amplification product of the second primer pair, wherein the upstream and downstream primers of the second primer pair have the nucleotide sequences shown in SEQ ID No. 8 and SEQ ID No. 9, respectively, and the second probe has the nucleotide sequence shown in SEQ ID No. 10, and the second probe and the first probe are labeled with different fluorescent groups.

[0013] In some embodiments of the present application, the first probe has a fluorescent group connected to the 5' end of the probe sequence, and a FAM group is selected, and a quenching group is connected to the 3' end of the probe, and a BHQ1 group is selected; the second probe has a fluorescent group connected to the 5' end of the probe sequence, and a ROX group is selected, and a quenching group is connected to the 3' end of the probe, and a BHQ2 group is selected.

[0014] Further, the kit further comprises an enzyme mixture, which comprises a reverse transcriptase and a DNA polymerase. The reverse transcriptase is used to reverse transcribe the RNA of the sample to be tested into a cDNA sequence, and the DNA polymerase is used to amplify the cDNA sequence.

[0015] The fourth aspect of the present application provides a method for detecting the expression of the fusion gene of the first aspect of the present application, comprising the following steps:

[0016] S1, obtaining an RNA sample of a sample to be tested;

[0017] S2, performing RT-qPCR amplification on the nucleic acid sample by using the kit of the fifth aspect of the present application;

[0018] S3, obtaining amplification results of the fusion gene and the reference gene REF, respectively, and if the sample to be tested has a fusion gene amplification Ct value <40 and an obvious "S" type amplification curve, the sample to be tested is positive for PPFIBP1-RET fusion gene mutation.

[0019] In some embodiments of the present application, the system for performing amplification RT-qPCR amplification is as follows:

[0020] 20 μL system: 0.8 μL of each primer of the first primer pair, 0.4 μL of the first probe, 0.4 μL of each primer of the second primer pair, 0.3 μL of the second probe, 0.86 μL of nuclease-free water, 10 μL of buffer, 1.04 μL of mixed enzyme solution, and 5 μL of the nucleic acid sample of the sample to be tested,

[0021] The enzyme mixture contains 2400 U of reverse transcriptase and 24-30 U of DNA polymerase.

[0022] The amplification program is as follows:

[0023] 52℃ for 5 minutes; 95℃ for 1 minute; 95℃ for 10 seconds, 60℃ for 30 seconds, collect fluorescence signal, 45 cycles.

[0024] The fifth aspect of the present application provides the use of the expression detection reagent of the fusion gene of the first aspect of the present application in the preparation of a kit for predicting or diagnosing lung cancer.

[0025] In some embodiments of the present application, the expression detection reagent of the fusion gene comprises a first primer pair for amplifying the reverse transcription product of the transcript of the fusion gene and a first probe targeting the amplification product of the first primer pair, the upstream and downstream primers of the first primer pair have the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6, respectively, and the first probe has the nucleotide sequence shown in SEQ ID NO. 7.

[0026] Further, the expression detection reagent further comprises a second primer pair for amplifying the internal reference gene REF and a second probe targeting the amplification product of the second primer pair, wherein the upstream and downstream primers of the second primer pair have the nucleotide sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9 respectively, and the second probe has the nucleotide sequence shown in SEQ ID NO. 10, and the second probe and the first probe are labeled with different fluorescence.

[0027] In some embodiments of the present application, the first probe has a fluorescent group connected at the 5' end of the probe sequence, and a FAM group is selected, and a quenching group is connected at the 3' end of the probe, and a BHQ1 group is selected; the second probe has a fluorescent group connected at the 5' end of the probe sequence, and a ROX group is selected, and a quenching group is connected at the 3' end of the probe, and a BHQ2 group is selected.

[0028] Advantages of the present application

[0029] Compared with the prior art, the present application has the following advantages:

[0030] The present application provides a new type of fusion gene, which provides more indicators for the screening or diagnosis of cancer, especially lung cancer.

[0031] The present application detects the fusion gene based on fluorescent quantitative PCR technology, which has strong specificity, high sensitivity, is simple and fast, easy to operate and safe, and has high automation. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 The sample fluorescent PCR detection results in the embodiments of the present application are shown. A: clinical sample 1, B: clinical sample 2, C: positive control, D: negative control. DETAILED DESCRIPTION

[0033] Unless otherwise indicated, implied from the context, or customary in the art, all parts and percentages in this application are based on weight, and the test and characterization methods used are contemporary with the filing date of this application. Where applicable, the contents of any patent, patent application, or publication referred to in this application are hereby incorporated by reference in their entirety, and the equivalent same family patents are also incorporated by reference, particularly the definitions of the relevant terms disclosed in these documents. If the definition of a specific term disclosed in the prior art is inconsistent with any definition provided in this application, the definition provided in this application shall prevail.

[0034] Numerical ranges are approximations, and thus the endpoints should be considered to be approximations also, unless otherwise indicated. A numerical range includes all values from and including the lower and to and including the upper value of the range. For ranges including a lower value Q and an upper value Q, unless otherwise stated, the lower value preferably is Q+0.0001, Q+0.001, Q+0.01, Q+0.1, Q+1, Q+2, Q+5, Q+10, Q+15, Q+20, Q+25, Q+50, Q+75, Q+100, or Q+1000; and the upper value is preferably Q-0.0001, Q-0.001, Q-0.01, Q-0.1, Q-1, Q-2, Q-5, Q-10, Q-15, Q-20, Q-25, Q-50, Q-75, Q-100, or Q-1000. These same rules apply to numerical ranges expressed in a single category, e.g., Q-10, as well as to ranges using two or more categories, e.g., Q-10 to Q+10. For ranges in which the upper and / or lower limits change, e.g., amounts, useful upper limits of Q+0.0001, Q+0.001, Q+0.01, Q+0.1, Q+1, Q+2, Q+5, Q+10, Q+15, Q+20, Q+25, Q+50, Q+75, Q+100, or Q+1000, are expressly contemplated. It is specifically intended that the description of the application set forth herein, including the examples, are intended for purposes of illustration only and are not intended to limit the scope of the application. The application is not limited to the examples and reference examples described herein and numerous variations and modifications are possible in light of the above teachings and can be practiced without departing from the scope of the application.

[0035] The terms "comprising," "including," "containing," and variations thereof, do not exclude the presence of other components, steps or processes, and are used herein to mean that additional components, steps or processes can be added. Thus, use of such terminology indicates that the complete scope of the expression can include a single component or a plurality of components, and that when such terminology is used, it is taken to mean either the singular or plural number unless specifically stated otherwise. Unless specifically stated otherwise, and as apparent from the following, it will be appreciated that, throughout this specification, the meaning of "comprising", "including", and "having" comprises, includes, and has also the meaning of "consisting of" and "consisting essentially of".

[0036] In order to make the technical problems solved by the present application, the technical solutions and the beneficial effects clearer, the present application will be further explained in details in combination with the embodiments.

[0037] Embodiments

[0038] The following examples are presented herein to demonstrate preferred embodiments of the present application. Those skilled in the art will appreciate that the techniques disclosed in the following examples represent techniques that the inventors have found function well in the practice of the present application and thus can be considered to be preferred approaches for practicing the present application. However, it will be readily apparent to one of ordinary skill in the art in light of the present specification that modifications can be made to the specific embodiments disclosed herein without departing from the spirit of the scope of the present application.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The materials, methods, and examples provided herein are illustrative only and are not intended to be limiting.

[0040] Those skilled in the art will appreciate, or be able to determine, many equivalents to the specific embodiments of the inventions described herein. Such equivalents are considered to be within the scope of the claims.

[0041] The molecular biology experimental methods not specifically described in the following examples were performed according to the specific methods listed in the book of Molecular Cloning: A Laboratory Manual (Fourth Edition) (J. Sambrook, M. R. Green, 2017) or according to the kit and product instructions. Other experimental methods, if not specifically described, are conventional methods. The instruments and equipment used in the following examples, if not specifically described, are conventional laboratory instruments and equipment; the experimental materials used in the following examples, if not specifically described, are purchased from conventional biochemical reagent stores.

[0042] Example 1 PPFIBP1-RET fusion gene discovery

[0043] The inventors found a new fusion type, i.e., PPFIBP1 gene and RET gene fusion (PPFIBP1-RET) mutation, in the study of non-small cell lung cancer clinical samples by NGS sequencing of FFPE samples of patients.

[0044] The new fusion breakpoint is on the 7th intron of the PPFIBP1 gene and the 11th intron of the RET gene, and the fusion gene sequence is as follows (SEQ ID No. 1):

[0045] TTTCTTTTTTAAAAGGACTGAACTTCTGATAAGAAATTGATTGAAATAGTTTGTATTCTGTTTTTTAAAGTTTTACATTAGGGAGCCATTTCCAGATTTTCCAGCTTGTGTTGTCAGGGGAAGATGTGATTTATTTCAGGTTGGAAATTTAGACCATATTTAAAGTATTGCCATGAAATATAGTTGAGTAGTTTTTTGTTAAAACAGATAAATTATCCCAGTTTACAATTCCATTTTTTTCAGTGGTTTCTTCTTTGCACGAGCAAAGAAGAAAGGAAGCTGTAAAATACAATAGCAGATGGGCCAGTGGCAGCCCTTGAGGAGCAGTGCTTCCACACTCTGAGGCGGAACATGGTGGCGCCTTTCTTTGCAGGGGTGGCTATGTAGAGAAGTTGTCCTGGACACTTCCACTGTAGTCAGAGGTCCTGGGCTGGGCCTGGTGCTCATTTAGTCCTGGGGCAGGGGTCAGGGGAGACAGTAGACCAGGAACCAGAGAGGGTCGAAGTACTGAGTCCAAGCCATGCTGTGACCACACCTGTCATGTAGCAGCTTTCAGGGGCCTGGCTGTGGGGTCCTGCCCAGGGCAGAGACAGGCAGCGT

[0046] The sequence before the breakpoint is as follows (SEQ ID No. 2):

[0047] TTTCTTTTTTAAAAGGACTGAACTTCTGATAAGAAATTGATTGAAATAGTTTGTATTCTGTTTTTTAAAGTTTTACATTAGGGAGCCATTTCCAGATTTTCCAGCTTGTGTTGTCAGGGGAAGATGTGATTTATTTCAGGTTGGAAATTTAGACCATATTTAAAGTATTGCCATGAAATATAGTTGAGTAGTTTTTTGTTAAAACAGATAAATTATCCCAGTTTACAATTCCATTTTTTTCAGTGGTTTCTTCTTTGCACGAGCAAAGAAGAAAGGAAGCTGTAAAATACAATAGCAGAT

[0048] The sequence after the breakpoint is as follows (SEQ ID No. 3):

[0049] GGGCCAGTGGCAGCCCTTGAGGAGCAGTGCTTCCACACTCTGAGGCGGAACATGGTGGCGCCTTTCTTTGCAGGGGTGGCTATGTAGAGAAGTTGTCCTGGACACTTCCACTGTAGTCAGAGGTCCTGGGCTGGGCCTGGTGCTCATTTAGTCCTGGGGCAGGGGTCAGGGGAGACAGTAGACCAGGAACCAGAGAGGGTCGAAGTACTGAGTCCAAGCCATGCTGTGACCACACCTGTCATGTAGCAGCTTTCAGGGGCCTGGCTGTGGGGTCCTGCCCAGGGCAGAGACAGGCAGCGT

[0050] At the RNA level, the PPFIBP1 gene 7thexon is fused with the RET gene 12thexon, and the cDNA sequence is as follows (SEQ ID No. 4):

[0051] GAGCTTCTAAGTAGGACATCCTTAGAAACTCAGAAGTTGGATCTGATGGCTGAAATATCTAACTTGAAGTTGAAACTGACAGCTGTAGAGAAGGACAGATTGGATTATGAAGATAAGTTCAGAGACACAGAGGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCTAGGAGAAGGCGAATTTGGAAAAGTGGTCAAGGCAACGGCCTTCCATCTGAAAGGCAGAGCAGGGTACACCACGGTGGCCGTGAAGATGCTGAAAG

[0052] Example 2: Detection of PPFIBP1-RET fusion gene

[0053] 1. Sample nucleic acid extraction

[0054] The sample to be tested is a paraffin section of a puncture sample, including clinical sample 1 and clinical sample 2. The nucleic acid of the puncture sample was extracted using the nucleic acid extraction reagent (model number: FFPE DNA / RNA) of Aidbio, and the specific operation was referred to the manufacturer's instructions. The extraction concentration and purity were within the required range.

[0055] 2. Positive control and negative control

[0056] The positive control was prepared by mixing the cDNA plasmid of PPFIBP1-RET fusion gene with the cDNA plasmid of β-actin; the negative control was nuclease-free water.

[0057] 3. Design and synthesis of primers and probes for PPFIBP1-RET fusion gene and internal reference gene

[0058] Based on the genomic analysis data, the genes were analyzed, and the Oligo software was used to analyze the site of TaqMan primers and probes, from which the best combination was selected. The primers and probes for PPFIBP1-RET fusion gene are as follows:

[0059] The sequence of the upstream primer PPIFBP1-F1 is (5'-3'): ATGAAGATAAGTTCAGAGACACA (SEQ ID No. 5);

[0060] The sequence of the downstream primer RET-R1 is (5'-3'): CAAATTCGCCTTCTCCTAGACT (SEQ ID No. 6);

[0061] The sequence of the probe RET-P1 is (5'-3'): ATCCAAAGTGGGAATTCCCTCGGAAG (SEQ ID No. 7), wherein the fluorescent group is connected to the 5' end of the probe sequence, the FAM group is selected, and the quenching group is connected to the 3' end of the probe, and the BHQ1 group is selected.

[0062] REF was selected as the internal reference gene, and the primers and probes for the internal reference gene are as follows:

[0063] The sequence of the upstream primer REF-F1 is (5'-3'): TTCTACAATGAGCTGCGTGTG (SEQ ID No. 8);

[0064] The sequence of the downstream primer REF-R1 is (5'-3'): AAGAGGTAGCGGGCCACT (SEQ ID No. 9);

[0065] The sequence of the probe REF-P1 is (5'-3'): CCGTGCTGCTGACCGAGGCC (SEQ ID No. 10), wherein the fluorescent group is connected to the 5' end of the probe sequence, the ROX group is selected, and the quenching group is connected to the 3' end of the probe, and the BHQ2 group is selected.

[0066] 4. Screening of enzymes

[0067] The present embodiment adopts one-step RNA fluorescence PCR, so the enzyme needs to select a reverse transcriptase and DNA polymerase mixed enzyme system (2400 U of reverse transcriptase and 25 U of DNA polymerase) and an appropriate buffer. At an appropriate temperature, the above designed primer probe is used as a reverse transcription primer. Under the action of reverse transcriptase, cDNA of the target band is obtained. Then, under the action of DNA polymerase, PCR reaction occurs with the cDNA obtained by reverse transcription as a template.

[0068] 5. Preparation of PCR reaction system

[0069] The primer is diluted to 10 μM. After optimization, 0.8 μL of primer of PPFIBP1-RET fusion gene is added to each reaction, 0.4 μL of probe is added to the reaction system, 0.4 μL of primer of internal reference is added to the reaction system, 0.3 μL of probe is added to the reaction system, 0.86 μL of nuclease-free water is added, 10 μL of buffer is added, 1.04 μL of reverse transcriptase and DNA polymerase mixed enzyme system is added, and 5 μL of sample RNA is added, as shown in Table 1:

[0070] Table 1 Reaction system

[0071] Components Single reaction volume (μL) 5 reaction volume (μL) PPIFBP1-F1 (10 μM) 0.8 8 RET-R1 (10 μM) 0.8 8 RET-P1 (10 μM) 0.4 4 REF-F1 (10 μM) 0.4 4 REF-R1 (10 μM) 0.4 4 REF-P1 (10 μM) 0.3 3 Mixed enzyme system 1.04 10.4 Buffer 10 100 Water 0.86 8.6

[0072] According to 15 μL per reaction, it is divided into PCR tubes. After dispensing, each RNA template, positive control and negative control are added.

[0073] 6. PCR reaction

[0074] Centrifuge the PCR tube briefly, collect the reagent on the tube wall to the bottom of the tube, and eliminate the bubbles in each reaction tube. Place the PCR reaction tube into a quantitative PCR instrument, and then immediately perform PCR reaction. Open the corresponding software (here, ABI 7500 is taken as an example) of the quantitative PCR instrument to set “Target name” as the name, “Reporter” as “FAM”, “ROX”, “Quencher” as “NONE”, and reference dye as “None”. According to the steps shown in Table 2, PCR amplification is performed.

[0075] Table 2 PCR program

[0076]

[0077] 52℃ 5min, reverse transcription of RNA sample; 95℃ 1min, pre-denaturation; 95℃ 10s, denaturation; 60℃ 30s, annealing and extension, and signal collection after extension.

[0078] After the experiment, wrap the cooled PCR reaction tube with PE gloves and dispose of it as biological waste. It is strictly forbidden to open the PCR reaction tube cover to avoid contamination.

[0079] 7. Fluorescence PCR Results Analysis

[0080] The baseline should be selected in an area with relatively stable fluorescence signals before exponential amplification. The starting point should avoid signal fluctuations at the beginning of fluorescence acquisition, and the endpoint should be 1–2 cycles below the Ct value of the sample that first exhibited exponential amplification. Positive control tubes, sample test tubes, and negative control tubes should also be selected. The inflection point of the positive control's amplification curve should be used as the threshold. The negative control must exhibit no amplification curve increase. Both the positive controls FAM and ROX should exhibit distinct amplification curves with Ct values ​​<30; otherwise, the amplification is invalid. The sample's ROX signal, or internal reference gene, should exhibit a distinct amplification curve, with a Ct value ≤27. If the sample's Ct value in the FAM channel is <40 and the curve exhibits a distinct "S"-shaped amplification curve, the sample is positive for the PPFIBP1-RET fusion gene mutation.

[0081] The test results of clinical samples 1 and 2 are as follows Figure 1 Based on the above judgment criteria, the test result of clinical sample 1 was positive for PPFIBP1-RET fusion gene mutation, and the test result of clinical sample 2 was negative for PPFIBP1-RET fusion gene mutation, which was consistent with the results of immunohistochemistry, as shown in Table 3.

[0082] Table 3 Comparison of fluorescence PCR detection results and immunohistochemistry results of different samples

[0083] Clinical sample Immunohistochemistry results Fluorescent PCR detection results Clinical sample 1 RET positive Positive Clinical sample 2 RET negative Negative

[0084] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A PPFIBP1 and RET fusion gene, characterized in that: Its nucleotide sequence is shown in SEQ ID No.

1.

2. The fusion gene according to claim 1, characterized in that The nucleotide sequence of the reverse transcription product of the transcript is shown in SEQ ID No.

4.

3. A carrier, characterized in that It comprises the reverse transcription product sequence according to claim 2.

4. A kit for detecting the expression of the fusion gene according to claim 1, characterized in that: The method includes a first primer pair for amplifying the reverse transcription product of the transcript of the fusion gene and a first probe targeting the amplified product of the first primer pair, wherein the upstream and downstream primers of the first primer pair have the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6, respectively, and the first probe has the nucleotide sequence shown in SEQ ID NO.

7. The method also includes a second primer pair for amplifying the internal reference gene REF and a second probe targeting the amplified product of the second primer pair, wherein the upstream and downstream primers of the second primer pair have the nucleotide sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9, respectively, and the second probe has the nucleotide sequence shown in SEQ ID NO. 10, and the second probe and the first probe are labeled with different fluorescent markers.

5. The kit according to claim 4, characterized in that The kit further comprises an enzyme mixture, which comprises reverse transcriptase and DNA polymerase.

6. The kit according to any one of claims 4 to 5, characterized in that The kit further comprises a positive control substance and / or a negative control substance.

7. A method for detecting the expression of the fusion gene according to claim 1, characterized in that: The following steps are involved: S1, obtain RNA sample of the sample to be tested; S2, performing RT-qPCR amplification on the RNA sample using the kit according to claim 5; S3. Obtain the amplification results of the fusion gene and the internal reference gene REF, respectively. If the Ct value of the fusion gene amplification of the test sample is less than 40, and the amplification curve has an obvious "S"-shaped amplification curve, the test sample is positive for the PPFIBP1-RET fusion gene mutation.

8. The method according to claim 7, characterized in that In step 2, the RT-qPCR amplification system is as follows: 20μL system: 0.8μL of each primer of the first primer pair, 0.4μL of the first probe, 0.4μL of each primer of the second primer pair, 0.3μL of the second probe, 0.86μL of nuclease-free water, 10μL of buffer, 1.04μL of mixed enzyme solution, 5μL of the nucleic acid sample of the sample to be tested, The enzyme mixture contains 2400U reverse transcriptase and 24-30U DNA polymerase, The amplification procedure is as follows: 52°C for 5 minutes; 95°C for 1 minute; 95°C for 10 seconds, 60°C for 30 seconds, collecting fluorescence signals, 45 cycles.

9. Use of the fusion gene expression detection reagent according to claim 1 in preparing a kit for predicting or diagnosing lung cancer.

Citation Information

Patent Citations

  • Probe, primer and detection kit used for RET gene fusion detection

    CN103361419A

  • Primer, probe and detection reagent kit for detecting RET fusion gene

    CN104745719A