DNA barcodes, primer sets and application for identifying the genetic relationship of pepper
By providing DNA barcodes and primer sets for groups A, B, and C, combined with fluorescent PCR amplification and kits, the complexity and inaccuracy of pepper kinship identification in existing technologies have been solved, enabling rapid and accurate pepper kinship identification and improving breeding efficiency.
Patent Information
- Application Number
- CN202310399077.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-14
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2043-04-14
AI Technical Summary
Existing DNA barcoding technology is cumbersome to operate and has poor reliability and reproducibility when identifying the kinship of peppers, making it difficult to meet the needs of efficient breeding in pepper breeding.
DNA barcodes for groups A, B, and C, along with their corresponding primer sets, were provided. Fluorescent PCR amplification was performed using simple repetitive sequences in the whole pepper genome, establishing an identification method that can accurately identify yellow pepper, Reyin No. 1, and hybrid offspring. Identification was then performed using kits and detection instruments.
It enables rapid, accurate, and convenient identification of pepper kinship, improves breeding efficiency, overcomes the time-consuming and labor-intensive nature of traditional methods and the complexity of existing technologies, and provides stable and reliable results.
Smart Images

Figure BDA0004178739030000051 
Figure BDA0004178739030000061 
Figure BDA0004178739030000091
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of pepper germplasm screening, and particularly relates to a DNA barcode for identifying the genetic relationship of pepper, a primer group and application. BACKGROUND
[0002] Pepper (Piper nigrum L.) is known as the "King of Spices", and is the world's most important spice crop and a favorite seasoning, which is widely used in food, medicine and other fields. Pepper blight caused by Phytophthora capsici Leon is a serious harm, and no effective disease-resistant varieties have been bred so far. The pepper (P. nigrum cv. Reyin-1) currently cultivated in China has a popularization area of more than 90% in the country, but this variety is susceptible to pepper blight. A hybrid offspring with both disease resistance and yield is obtained by crossing P. flaviflorum with high disease resistance and P. nigrum cv. Reyin-1 with high yield. In order to efficiently breed pepper varieties with high disease resistance and yield, it is very important to identify the genetic relationship of pepper by using DNA barcode molecular identification technology. However, in the existing DNA barcode technology, ITS (ribosomal RNA internal transcribed spacer region) and mitochondrial non-coding region or conserved gene sequence are mainly used for species identification; the operation of restriction fragment length polymorphism (RFLP) is very complicated, and the reliability and repeatability of the results are poor; random amplified polymorphic DNA (RAPD) is easily disturbed, and the technical level of the operator is required to be high, which is difficult to popularize in the breeding work.
[0003] Therefore, in order to solve these problems and improve the efficiency of pepper breeding, it is necessary to provide a DNA barcode for accurately and quickly identifying the hybrid offspring, which is a problem urgently needed to be solved by those skilled in the art. SUMMARY
[0004] Therefore, in order to solve these problems and improve the efficiency of pepper breeding, it is necessary to provide a DNA barcode for accurately and quickly identifying the hybrid offspring, which is a problem urgently needed to be solved by those skilled in the art.
[0005] The present application provides a DNA barcode, which comprises:
[0006] Group A barcode: barcode 1, barcode 2 and barcode 3; and / or,
[0007] Group B barcode: barcode 4, DNA barcode 5, barcode 6 and DNA barcode 7; and / or,
[0008] Group C barcode: barcode 8, DNA barcode 9 and barcode 10;
[0009] The barcode 1 has a nucleotide sequence as shown in SEQ ID NO: 7;
[0010] The barcode 2 has a nucleotide sequence as shown in SEQ ID NO: 8;
[0011] The barcode 3 has a nucleotide sequence as shown in SEQ ID NO: 9;
[0012] The barcode 4 has a nucleotide sequence as shown in SEQ ID NO: 10;
[0013] The barcode 5 has a nucleotide sequence as shown in SEQ ID NO: 11;
[0014] The barcode 6 has a nucleotide sequence as shown in SEQ ID NO: 12;
[0015] The barcode 7 has a nucleotide sequence as shown in SEQ ID NO: 13;
[0016] The barcode 8 has a nucleotide sequence as shown in SEQ ID NO: 14;
[0017] The barcode 9 has a nucleotide sequence as shown in SEQ ID NO: 15;
[0018] The barcode 10 has a nucleotide sequence as shown in SEQ ID NO: 16.
[0019] The application is based on the fluorescent PCR amplification of all simple sequence repeats (SSR) in the whole genome of pepper, establishes DNA barcodes effectively corresponding to the origin, and can realize effective identification of the genetic relationship of pepper. The application screens the SSR DNA barcodes, obtains barcodes that can clearly distinguish between Zanthoxylum simulans, Rehderodendron 1 and hybrid offspring, and other ISSR barcodes or genes (such as ITS) cannot accurately and quickly identify the intraspecific identification of closely related peppers.
[0020] The application provides a primer set for detecting the DNA barcode.
[0021] Further, the primer set comprises:
[0022] a primer group 1 targeting group A barcodes, an upstream primer sequence of the primer group 1 is shown as SEQ ID NO: 1, and a downstream primer sequence of the primer group 1 is shown as SEQ ID NO: 2; and / or,
[0023] a primer group 2 targeting group B barcodes, an upstream primer sequence of the primer group 2 is shown as SEQ ID NO: 3, and a downstream primer sequence of the primer group 2 is shown as SEQ ID NO: 4; and / or,
[0024] a primer group 3 targeting group C barcodes, an upstream primer sequence of the primer group 3 is shown as SEQ ID NO: 5, and a downstream primer sequence of the primer group 3 is shown as SEQ ID NO: 6.
[0025] The primer group is a primer group screened to have the best amplification effect on the barcode, and the amplification effect includes, but is not limited to, specificity of the amplification product and brightness of the amplification band.
[0026] The different primer groups of the present application can be used alone or in combination when identifying pepper, and the recognition accuracy is the highest when all primer groups are used together.
[0027] The present application provides a kit comprising at least one of the primer groups, amplification buffer, detection primer and / or formamide solution described in the present application.
[0028] Further, in the kit of the present application,
[0029] The amplification buffer is Taq PCR Master Mix;
[0030] The detection primer is M13, which has a fluorescent label;
[0031] The formamide solution contains a molecular weight internal standard.
[0032] Further, in the kit of the present application,
[0033] The fluorescent label on the detection primer is LIZ fluorescent;
[0034] The formamide solution contains 1vol% LIZ-500 molecular weight internal standard.
[0035] The present application provides a pepper identification system comprising the primer group, the kit and / or the detection instrument described in the present application.
[0036] The present application provides at least one of the following I) to III) for use in the identification of pepper germplasm resources:
[0037] I), the DNA barcode described in the present application;
[0038] II) the primer set according to the present application;
[0039] III) the kit according to the present application.
[0040] The present application provides a method for identifying the relationship of pepper, comprising identifying the pepper by any one of i) and ii) as follows:
[0041] i) the primer set according to the present application;
[0042] ii) the detection kit according to the present application.
[0043] Further, the method for identifying the relationship of pepper according to the present application comprises the following steps:
[0044] The genomic DNA of pepper is amplified by using primer set 1, primer set 2 and / or primer set 3, and the pepper is identified according to the characteristics of the amplified fragments;
[0045] The pepper includes Zanthoxylum simulans, Zanthoxylum planispinum and hybrid offspring.
[0046] The identification method is capillary electrophoresis.
[0047] Further, the identification standard of the method for identifying the relationship of pepper according to the present application is:
[0048] The primer 1 amplifies a 220bp fragment with 9 repeats, the primer 2 amplifies a 228bp fragment with 8 repeats and a 234bp fragment with 10 repeats, and / or the primer 3 amplifies a 285bp fragment with 7 repeats, which is identified as Zanthoxylum simulans.
[0049] The primer 1 amplifies a 208bp fragment with 5 repeats, the primer 2 amplifies a 231bp fragment with 9 repeats and a 237bp fragment with 11 repeats, and / or the primer 3 amplifies a 282bp fragment with 6 repeats and a 288bp fragment with 8 repeats, which is identified as Zanthoxylum planispinum.
[0050] The primer 1 amplifies a 208bp fragment with 5 repeats and a 229bp fragment with 12 repeats, the primer 2 amplifies a 234bp fragment with 10 repeats and a 237bp fragment with 11 repeats, and / or the primer 3 amplifies a 282bp fragment with 6 repeats and a 285bp fragment with 7 repeats, which is identified as hybrid offspring.
[0051] As a preferred technical solution of the present application, the reaction system for amplifying the genomic DNA of pepper is:
[0052] 2x Taq PCR Master Mix 5 μL, genomic DNA 1 μL, upstream primer 0.1 μL, downstream primer 0.4 μL, fluorescent M13 primer 0.4 μL, and sterile deionized water to 10 μL.
[0053] More preferably, the concentrations of the upstream primer, the downstream primer and the fluorescent M13 primer are all 10 μM.
[0054] As a preferred technical solution of the present application, the fluorescent PCR amplification reaction program in step S2 is as follows:
[0055] 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 62 to 55℃ drop PCR annealing for 30 s, 72℃ extension for 30 s, for a total of 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles; 72℃ final extension for 20 min; 4℃ incubation for 6 h, and then used for fluorescent capillary electrophoresis detection.
[0056] The identification method can be used to identify pepper pollen, stems and leaves, seeds and other different growth stages; the detection period is short, the operation is simple, and the waste is not caused, the result is stable and reliable, and the repeatability is good, which overcomes the disadvantages of the traditional morphological identification method that is inaccurate, time-consuming and laborious. At the same time, the operation of the existing molecular biology technology is also complicated.
[0057] The present application provides a DNA barcode and primer set for identifying pepper germplasm resources, the DNA barcode is obtained by screening the SSR sequences of Zanthoxylum simulans, Zanthoxylum simulans and hybrid offspring, and the primer set is correctly amplified according to the barcode, and then applied to the identification of pepper germplasm resources. The experimental results show that the DNA barcode and primer set of the present application can be combined in various forms to identify the genetic relationship of pepper, the detection period is short, the operation is simple, the detection process is economical and saving, the identification result is accurate and reliable, and the repeatability is good. The present application overcomes the disadvantages of the traditional morphological identification method that is inaccurate, time-consuming and laborious, and plays an active role in the identification of high-quality pepper germplasm resources and genetic breeding, and also provides an effective method for the identification and protection of germplasm resources. BRIEF DESCRIPTION OF DRAWINGS
[0058] Figure 1 Fig. 1 shows the results of amplifying Zanthoxylum simulans, Zanthoxylum simulans and hybrid offspring by primer 1 fluorescent PCR according to the present application;
[0059] Figure 2 Fig. 1 shows the results of amplifying Zanthoxylum simulans, Zanthoxylum simulans and hybrid offspring by primer 2 fluorescent PCR according to the present application;
[0060] Figure 3The application uses primer 3 fluorescence PCR to amplify the results of Zanthoxylum simulans, hot lead No. 1 pepper, and hybrid offspring. DETAILED DESCRIPTION
[0061] The application provides a DNA barcode for identifying pepper genetic relationships, a primer set, and applications. Those skilled in the art can refer to the content herein, and appropriately improve process parameters to achieve. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are all considered to be included in the application. The method and application of the application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application herein without departing from the content, spirit and scope of the application, to achieve and apply the technology of the application.
[0062] Compared with traditional breeding methods and other existing DNA barcode technologies, the application has the advantages of time saving, labor saving, money saving, accuracy, and high efficiency, plays an active role in high-quality pepper germplasm resource genetic relationship identification and genetic breeding, and also provides an effective method for identification and protection of germplasm resources.
[0063] The test materials used in the application are ordinary market products and can be purchased in the market.
[0064] The application will be further described below in combination with examples:
[0065] Example 1: Construction of a pepper DNA barcode
[0066] Pepper samples of Zanthoxylum simulans, hot lead No. 1, and hybrid offspring were collected for genome sequencing, and MISA program was used to analyze the SSR sites in the genome sequence.
[0067] Primers were designed to perform PCR amplification on these SSR sites, and primers that could not amplify corresponding fragments were discarded. The effective primers were used to amplify the above three varieties of pepper samples, respectively, and capillary electrophoresis detection was performed. After analysis, the corresponding simple sequence repeat (SSR) sites were established. Finally, 3 pairs of primers (see Table 1) were obtained, and the polymorphism of the fragments obtained by amplifying the sample genome using the 3 pairs of primers could assist in identifying the genetic relationship of peppers.
[0068] Table 1. Identification of specific primers for Zanthoxylum simulans, hot lead No. 1 pepper, and hybrid offspring
[0069]
[0070]
[0071] Example 2: Identification of pepper genetic relationships
[0072] (1) Extract the pepper genome using the CTAB method, and dilute to 20 ng / μL for fluorescent PCR amplification.
[0073] (2) Perform fluorescent PCR amplification of the SSR DNA barcode using the primers in Table 1, and identify the pepper relatives by reading the DNA barcode information.
[0074] Fluorescent PCR amplification reaction system (10 μL): 2 x Taq PCR Master Mix 5 μL, template (genomic DNA) 1 μL, upstream primer 0.1 μL, downstream primer 0.4 μL (both upstream and downstream primer concentrations are 10 μM), fluorescent M13 primer (concentration 10 μM) 0.4 μL, and sterile deionized water to 10 μL;
[0075] Reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 62 to 55°C drop PCR annealing for 30 s, 72°C extension for 30 s, a total of 10 cycles; 95°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s, a total of 25 cycles; 72°C final extension for 20 min; 4°C incubation for 6 h, and then used for fluorescent capillary electrophoresis detection.
[0076] (3) After quantitative dilution of the PCR product, 1 μL of the PCR diluted product was added to 9 μL of formamide (containing 1% internal standard) for denaturation, and then the DNA sequencer ABI 3730xl was used for capillary fluorescent electrophoresis detection. The internal standard is LIZ-500 molecular weight internal standard (also known as internal lane standard), which is composed of 16 double-stranded DNA fragments labeled with LIZ fluorescein (orange), and the molecular weights are 35, 50, 75, 100, 139, 150, 160, 200, 250, 300, 340, 350, 400, 450, 490, and 500 bp. The fragment size in the amplification result electrophoretogram is equal to the actual bp number of the amplified fragment plus about 18 bp of M13 fluorescent primer, with an error range of 0 to 2 bp. The peak number indicates the number of heterozygous gene fragments amplified.
[0077] (4) The above method was used to identify the samples of P. doederainum, Rehder 1, and hybrid offspring.
[0078] The amplification results of primer 1 are shown in Figure 1As shown, when primer 1 is used for fragment amplification, three fragments (three peaks) are amplified, containing three SSR sites, and the SSR repeat element is TTA. Among them, the amplification fragment of Litsea cubeba contains a 220 bp fragment with 9 repeats (including a 21 bp primer); the amplification fragment of Hot Lead No. 1 contains a 208 bp fragment with 5 repeats (including a 21 bp primer); and the hybrid offspring contains a 220 bp fragment with 5 repeats (including a 21 bp primer) and a 229 bp fragment with 12 repeats (including a 21 bp primer).
[0079] Primer 1 amplification fragment: (wherein Figure 1 The length of the amplified fragment includes the primer, and the specific sequence is as follows, excluding the (21 bp) primer sequence, and the underlined part is the SSR repeat element.
[0080] 187 bp amplification fragment sequence: gcacagcccgaagagtctagtgaaaataagcctgttgaaagtattccgcagggggaggaaaagacaggggaaacgaatcaaacaggctcttcaggaaagcctatcagaggaggagtacctttcttcgcctttactcttatttgcttattattattattattatttaaataagatggtgtggtccagctg (as shown in SEQ ID NO: 7);
[0081] 199 bp amplification fragment sequence: gcacagcccgaagagtctagtgaaaataagcctgttgaaagtattccgcagggggaggaaaagacaggggaaacgaatcaaacaggctcttcaggaaagcctatcagaggaggagtacctttcttcgcctttactcttatttgcttattattattattattattattattattttaaataagatggtgtggtccagctg (as shown in SEQ ID NO: 8);
[0082] 208bp amplified fragment sequence: gcacagcccgaagagtctagtgaaaataagcctgttgaaagtattccgcagggggaggaaaagacaggggaaacg aatcaaacaggctcttcaggaaagcctatcagaggaggagtacctttcttcgcctttactcttatttgcttattattattattat tattattattattattattattttaaataagatggtgtggtccagctg (as shown in SEQ ID NO: 9);
[0083] The amplification results of primer 2 are as follows Figure 2 As shown, when primer 2 was used for fragment amplification, four fragments (four peaks) were obtained, containing four SSR sites, with the SSR repeat element being TCT. The amplified fragments from *Ligustrum lucidum* were characterized by a 228 bp fragment with eight repeats (including a 12 bp primer) and a 234 bp fragment with ten repeats (including a 12 bp primer); primer 1 contained a 231 bp fragment with nine repeats (including a 12 bp primer) and a 237 bp fragment with eleven repeats (including a 12 bp primer); the hybrid progeny contained a 234 bp fragment with ten repeats (including a 12 bp primer) and a 237 bp fragment with eleven repeats (including a 12 bp primer).
[0084] Primer 2 amplification fragment: (wherein) Figure 2 The amplified fragment length includes primers; the specific sequences are shown below (12 bp primer sequence removed). The underlined portion represents the SSR repeat element.
[0085] 216bp amplified fragment sequence: ctgttcgagctccggaaagtcgttcaagttccacatcgctctccctcttcttcttcttcttcttcttcttcaacctactcccccc ctcttctcctcccttagctattgagctagcagaaagatagctcctttcttctcccccatctccctatccaaccacatcaaaga ctgcttcaaagacagctctcgtggatcggaaagtgtgcgctctgcttc (as shown in SEQ ID NO: 10);
[0086] 219 bp amplicon sequence: ctgttcgagctccggaaagtcgttcaagttccacatcgctctccctcttcttcttcttcttcttcttcttcttcttcaacctactcccc ccctcttctcctcccttagctattgagctagcagaaagatagctcctttcttctcccccatctccctatccaaccacatcaaa gactgcttcaaagacagctctcgtggatcggaaagtgtgcgctctgcttc (as set forth in SEQ ID NO: 11);
[0087] 222 bp amplicon sequence: ctgttcgagctccggaaagtcgttcaagttccacatcgctctccctcttcttcttcttcttcttcttcttcttcttcaacctactcc ccccctcttctcctcccttagctattgagctagcagaaagatagctcctttcttctcccccatctccctatccaaccacatca aagactgcttcaaagacagctctcgtggatcggaaagtgtgcgctctgcttc (as set forth in SEQ ID NO: 12);
[0088] 225 bp amplicon sequence: ctgttcgagctccggaaagtcgttcaagttccacatcgctctccctcttcttcttcttcttcttcttcttcttcttcttcaacctac tccccccctcttctcctcccttagctattgagctagcagaaagatagctcctttcttctcccccatctccctatccaaccaca tcaaagactgcttcaaagacagctctcgtggatcggaaagtgtgcgctctgcttc (as set forth in SEQ ID NO: 13).
[0089] The results of the amplification with primer 3 are shown in Figure 2. Figure 3As shown, when the primer 3 is used for fragment amplification, three fragments (three peaks) containing three SSR loci are amplified, and the SSR repeat element is TCT. Among them, the characteristic of the amplification fragment obtained from Litsea cubeba is that it contains a 285 bp fragment (including a 15 bp primer) with 7 repeats; the characteristic of the amplification fragment obtained from H. 1 is that it contains a 282 bp fragment (including a 15 bp primer) with 6 repeats and a 288 bp fragment (including a 15 bp primer) with 8 repeats; the characteristic of the amplification fragment obtained from the hybrid offspring is that it contains a 282 bp fragment (including a 15 bp primer) with 6 repeats and a 285 bp fragment (including a 15 bp primer) with 7 repeats.
[0090] Amplification fragment of primer 3: (wherein Figure 3 The length of the amplified fragment includes the primer, and the specific sequence is as follows, and the primer sequence (15 bp) is removed. The underlined part is the SSR repeat element.
[0091] 267 bp amplification fragment sequence: ccagcttcacaggactccagaaccgaagagaggagccttctttgtccatctctaaactccaatgccagcttaacatcccaactggagctttccctggttacatgccacatgggttataattgatcattcactaggataagtctcttcttcttcttcttcttccaccgaggacacaaagggtgttggagataataatcattaactagcatctatgagattataaatggtaaaagtttggatggccagttgcccttcttgacaccaacc (as shown in SEQ ID NO: 14);
[0092] 270 bp amplification fragment sequence: ccagcttcacaggactccagaaccgaagagaggagccttctttgtccatctctaaactccaatgccagcttaacatcccaactggagctttccctggttacatgccacatgggttataattgatcattcactaggataagtctcttcttcttcttcttcttcttccaccgaggacacaaagggtgttggagataataatcattaactagcatctatgagattataaatggtaaaagtttggatggccagttgcccttcttgacaccaacc (as shown in SEQ ID NO: 15);
[0093] 273 bp amplified fragment sequence: ccagcttcacaggactccagaaccgaagagaggagccttctttgtccatctctaaactccaatgccagcttaacatcccaactggagctttccctggttacatgccacatgggttataattgatcattcactaggataagtctcttcttcttcttcttcttcttcttccaccgaggacacaaagggtgttggagataataatcattaactagcatctatgagattataaatggtaaaagtttggatggccagttgcccttcttgacaccaacc (as shown in SEQ ID NO: 16);
[0094] By comprehensive analysis of the map and sequencing results, the DNA barcode characteristic information of P. jom-lupi, P. jom-lupi, and hybrid offspring pepper is obtained as shown in Table 2:
[0095] P. jom-lupi is characterized by primer 1 amplifying a 220 bp fragment with 9 repeats (as shown in SEQ ID NO: 8); primer 2 amplifying a 228 bp fragment with 8 repeats and a 234 bp fragment with 10 repeats (as shown in SEQ ID NO: 10 and 12); and primer 3 amplifying a 285 bp fragment with 7 repeats (as shown in SEQ ID NO: 15).
[0096] P. jom-lupi is characterized by primer 1 amplifying a 220 bp fragment with 9 repeats (as shown in SEQ ID NO: 8); primer 2 amplifying a 228 bp fragment with 8 repeats and a 234 bp fragment with 10 repeats (as shown in SEQ ID NO: 10 and 12); and primer 3 amplifying a 285 bp fragment with 7 repeats (as shown in SEQ ID NO: 15).
[0097] The hybrid offspring is characterized by primer 1 amplifying a 208 bp fragment with 5 repeats and a 229 bp fragment with 12 repeats (as shown in SEQ ID NO: 7 and 9). Primer 2 amplifies a 234 bp fragment with 10 repeats and a 237 bp fragment with 11 repeats (as shown in SEQ ID NO: 12 and 13). Primer 3 amplifies a 282 bp fragment with 6 repeats and a 285 bp fragment with 7 repeats (as shown in SEQ ID NO: 14 and 15).
[0098] Table 2. DNA barcode characteristic information of P. jom-lupi
[0099]
[0100] Example 3 Identification of pepper genetic relationship by DNA barcoding
[0101] The DNA barcoding of pepper genetic relationship identification was verified by blind test.
[0102] In the first step of blind test, 7 samples of each of Zanthoxylum ailanthoides (No. 1-7), Zanthoxylum ailanthoides var. variegatum (No. 8-15) and hybrid (No. 16-21) were taken for blind test;
[0103] In the second step of test, the samples were amplified by primers (SEQ ID NO: 1-6) and capillary electrophoresis. The primer set can be used to amplify one or more pairs of combinations to distinguish the blind test samples by DNA barcoding characteristics and identify the samples of origin;
[0104] In the third step of unblinding, the results are shown in Table 3. The results of 7 samples of Zanthoxylum ailanthoides, Zanthoxylum ailanthoides var. variegatum and hybrid identified by DNA barcoding characteristics were all correct. Therefore, the DNA barcoding of origin is suitable for the identification of origin.
[0105] Table 3. Identification of pepper samples by genetic relationship DNA barcoding characteristics
[0106]
[0107] The above is only the preferred embodiment of the present application, it should be noted that for those skilled in the art, without departing from the principles of the present application, can also make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. Primer set for DNA barcoding amplification in pepper germplasm resource identification; The barcodes are: Group A barcode, Group B barcode, and Group C barcode; The group A barcodes are: barcode 1, barcode 2, and barcode 3; The group B barcodes are: barcode 4, barcode 5, barcode 6 and barcode 7; The group C barcodes are: barcode 8, barcode 9, and barcode 10; The nucleotide sequence of barcode 1 is shown in SEQ ID NO: 7; The nucleotide sequence of barcode 2 is shown in SEQ ID NO: 8; The nucleotide sequence of barcode 3 is shown in SEQ ID NO: 9; The nucleotide sequence of barcode 4 is shown in SEQ ID NO: 10; The nucleotide sequence of barcode 5 is shown in SEQ ID NO: 11; The nucleotide sequence of barcode 6 is shown in SEQ ID NO: 12; The nucleotide sequence of the barcode 7 is shown in SEQ ID NO: 13; The nucleotide sequence of barcode 8 is shown in SEQ ID NO: 14; The nucleotide sequence of the barcode 9 is shown in SEQ ID NO: 15; The nucleotide sequence of the barcode 10 is shown in SEQ ID NO: 16; The primer sets are: primer set 1 for the target group A barcode, primer set 2 for the target group B barcode, and primer set 3 for the target group C barcode; The primer set 1 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2; The primer set 2 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 4; The primer set 3 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 6; The peppers mentioned are: yellow pepper, Reyin No. 1 and their hybrid offspring.
2. A kit for identifying pepper germplasm resources, characterized in that, Includes the primer set, amplification buffer, and formamide solution as described in claim 1; The pepper mentioned is yellow pepper, Reyin No. 1, and their hybrid offspring.
3. The reagent kit according to claim 2, characterized in that, The amplification buffer is Taq PCR Master Mix; The formamide solution contains a molecular weight internal standard.
4. The reagent kit according to claim 3, characterized in that, The formamide solution contains 1 vol% LIZ-500 molecular weight internal standard.
5. The application of the primer set according to claim 1 or the kit according to any one of claims 2 to 4 in the identification of pepper germplasm resources, characterized in that, The pepper mentioned is yellow pepper, Reyin No. 1, and their hybrid offspring.
Citation Information
Patent Citations
Method for identifying pepper germplasm resources
CN102703598A
Primers for developing genotype specific marker in piper nigrum
IN237969B