SEC63 fragment and its application in preparing drugs for diagnosis and / or treatment of liver cancer

Abstract

The present invention discloses a SEC63 fragment and its application in the preparation of liver cancer diagnosis and / or treatment drugs. The amino acid sequence of the SEC63 fragment is shown in SEQ ID NO.1, which can be used as a marker or target for the preparation of drugs for diagnosis and / or treatment of liver cancer, liver cancer metastasis and / or liver cancer prognosis assessment. The present invention first discovered that the expression level of the SEC63 fragment is significantly positively correlated with lymph node metastasis and distant metastasis of liver cancer, and that patients with high expression of the SEC63 fragment have a poor prognosis. Further studies have found that inhibitors of the SEC63 fragment can significantly inhibit the migration and invasion ability of liver cancer cells. Therefore, the SEC63 fragment can be used as a liver cancer treatment target and diagnostic biomarker for liver cancer patient prognosis monitoring and liver cancer treatment, providing new ideas and strategies for treatment-related drugs and diagnostic products.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a fragment of the human endoplasmic reticulum membrane transporter SEC63 and its application in drugs for the diagnosis and / or treatment of liver cancer, liver cancer metastasis and / or prognostic assessment. Background Technology

[0002] Primary liver cancer is a malignant tumor with a high incidence and mortality rate in my country, with approximately 600,000 new cases each year. Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer. Although the level of tumor diagnosis and treatment is constantly improving, liver cancer is characterized by its insidious onset, high metastasis rate, and poor drug sensitivity. Currently, conventional treatments for liver cancer have not yielded revolutionary breakthroughs, resulting in high recurrence and mortality rates and a poor overall prognosis. Liver transplantation and surgical resection remain the most effective treatments for liver cancer, but patients with metastatic, advanced-stage liver cancer are not candidates for surgery. The prognosis for these patients is even worse, with a 5-year overall survival rate of less than 20%. Therefore, research on the diagnosis and treatment of liver cancer, especially metastatic liver cancer, is of great significance.

[0003] Secretory proteins are essential components of life processes in organisms, and these proteins need to enter the endoplasmic reticulum (ER) for further processing before they can function. In eukaryotes, organelles are separated into independent regions by membranes, and protein precursors, after synthesis, need to enter the ER for processing. Due to the presence of the ER membrane, the entry of proteins from the cytoplasm into the ER requires the participation of the general secrecy pathway (Sec), which then transports them to specific regions to perform their functions. The transporter protein SEC63 is a component of the Sec translocase complex, mainly located in the ER, and participates in protein transport. In tumor cells, SEC63 is located not only in the ER but also in the cytoplasm and nucleus. However, the function of SEC63 located outside the ER has not yet been reported.

[0004] In the tumor microenvironment, tumor cells can undergo metabolic reprogramming, adjusting their metabolic behavior to ensure that absorbed nutrients are both converted into energy for rapid growth and provide sufficient raw materials for biosynthesis. Tumor cells differ from normal cells in glucose utilization and lipid synthesis. Acetyl-CoA is a central metabolic intermediate in this metabolic reprogramming process. Acetyl-CoA originates from multiple catabolism pathways and serves not only as a raw material for lipid biosynthesis to maintain cell membrane systems but also as a substrate for protein acetylation reactions. It can regulate gene expression levels through epigenetic mechanisms. Therefore, intracellular acetyl-CoA levels are crucial for various biological activities such as cell growth, mitosis, and autophagy. ACLY (ATP citrate lyase) is an adenosine triphosphate citrate lyase that catalyzes the production of acetyl-CoA from citrate. Previous studies have shown that increased ACLY expression levels in various cancers promote tumor malignant progression. In liver cancer cells, ACLY can regulate acetyl-CoA levels, thereby modulating protein acetylation modifications and thus regulating the biological functions of liver cancer, promoting its development and progression.

[0005] In the occurrence, development, and metastasis of liver cancer, nutritional deficiencies due to insufficient blood supply are common, and tumor cells frequently experience endoplasmic reticulum (ER) stress. Current research indicates that tumor cells possess ER stress tolerance, and methods targeting the ER stress pathway in tumor cells hold promise for developing new anti-tumor drugs, making it a current hot topic in tumor molecular biology research. Previous studies have found that SEC63 participates in the process of normal cells undergoing ER stress. SEC63 gene mutations are also associated with polycystic liver disease, but current research on the function of SEC63 remains limited. However, there are currently no reports of SEC63 being applied to the diagnosis and treatment of liver cancer, especially in the treatment of liver cancer metastasis. Researching the role and mechanisms of SEC63 in liver cancer metastasis and developing corresponding diagnostic and therapeutic kits will significantly advance the current state of liver cancer diagnosis and treatment in my country and open new avenues for drug screening, efficacy evaluation, and targeted therapy. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of existing technologies in the diagnosis and treatment of liver cancer, analyze the mechanism of SEC63 in the occurrence and development of human liver cancer, and provide a new SEC63 fragment for monitoring high-risk groups of liver cancer, using the detection of its expression level as a predictor of cancer treatment, diagnosis and prognosis, as well as related applications of the SEC63 fragment.

[0007] The technical solution of this invention is described in detail below:

[0008] In a first aspect, the present invention provides a SEC63 fragment, the amino acid sequence of which is shown in SEQ ID NO.1.

[0009] SEQ ID NO.1: kvygrcmwyr lrllkpqpni iptvkkivll agwalflfla ykvsktdreyqeynpyevln ldpgatvaei kkqyrllslk yhpdkggdev mfmriakaya altdeesrkn weefgnpdgpqatsfgialp awivdqknsi lvllvyglaf.

[0010] The SEC63 gene coding sequence contains 2280 bases, encoding a protein of 760 amino acids. This study found that 150 amino acids from position 51 to 200 (i.e., the sequence shown in SEQ ID NO.1) can serve as a marker and drug target for the SEC63 protein, specifically labeling the SEC63 protein.

[0011] Optionally or preferably, the SEC63 fragment described above has the nucleotide sequence shown in SEQ ID NO.2.

[0012] SEQ ID NO.2:

[0013] AAAGTATATGGAAGGTGTATGTGGTATCGTTTACGGTTATTAAAACCCCAGCCAAATATTATTCCTACAGTAAAGAAAATAGTTCTGCTTGCAGGATGGGCATTGTTCTTATTCCTTGCATATAAAGTTTCCAAAACAGACCGAGAATACCAAGAATACAATCCTTATGAAGTATTAAATTTGGATCCTGGAGCCACAGTAGCAGAAATTAAAAAACAATATCGT TTGCTGTCACTTAAATATCATCCAGATAAAGGAGGTGATGAGGTTATGTTCATGAGGATAGCAAAAGCTTATGCTGCTTTAACGGATGAAGAGTCCCGGAAAAATTGGGAAGAATTTGGAAATCCAGATGGGCCTCAAGCCACAAGCTTTGGAATTGCCCTGCCAGCTTGGATAGTTGACCAGAAAAACTCAATTCTGGTTTTACTTGTATATGGATTGGCATTT.

[0014] Secondly, the present invention provides the use of the above-mentioned SEC63 fragment as a biomarker in the preparation of drugs for the diagnosis and / or treatment of liver cancer, liver cancer metastasis and / or prognostic assessment of liver cancer.

[0015] Optionally or preferably, in the above applications, the drug is an antibody prepared using the amino acid sequence shown in SEQ ID NO.1 as an antigen.

[0016] Optionally or preferably, in the above applications, the drug is used for diagnosing liver cancer, diagnosing liver cancer metastasis, and / or for liver cancer prognostic assessment, and the drug is a primer for detecting the SEC63 fragment gene.

[0017] Optionally or preferably, in the above applications, the sequence of the primer is as shown in SEQ ID NO.3-4.

[0018] SEQ ID NO.3: CGAGCAAATTCGATTAAAGAATATC (SEC63 fragment qPCR F),

[0019] SEQ ID NO.4: CCTGCAAGCAGAACTATTTTCTTTA (SEC63 fragment qPCR R).

[0020] Optionally or preferably, in the above applications, the drug is used to treat liver cancer and / or liver cancer metastasis, and the drug contains small interfering RNA or shRNA.

[0021] Optionally or preferably, in the above applications, the sequence of the small interfering RNA is as shown in SEQ ID NO.5 or SEQ ID NO.6.

[0022] SEQ ID NO.5: CCCUUGAAGAAGAUCAGCAAU (SEC63 fragment siRNA1).

[0023] SEQ ID NO.6: GCCUACUUCAAGAAAUGGUU (SEC63 fragment siRNA2).

[0024] Optionally or preferably, in the above applications, the sequence of the shRNA is as shown in SEQ ID NO.7-8 or SEQ ID NO.9-10.

[0025] SEQ ID NO.7:

[0026] CCGGCCCUUGAAGAAGAUCAGCAAUCUCGAGAUUGCUGAUCUUCUUCAAGGGU UUUUG (SEC63 fragment shRNA1 F);

[0027] SEQ ID NO.8:

[0028] AAUUCAAAAACCCUUGAAGAAGAUCAGCAAUCUCGAGAUUGCUGAUCUUCUUCAAGGG (SEC63 fragment shRNA1 R).

[0029] SEQ ID NO.9:

[0030] CCGGGCUUUACAUUGCAGAUAGGAACUCGAGUUCCUAUCUGCAAUGUAAAGCUUUUUG (SEC63 fragment shRNA2 F);

[0031] SEQ ID NO.10:

[0032] AAUUCAAAAAGCUUUACAUUGCAGAUAGGAACUCGAGUUCCUAUCUGCAAUGUAAAGC (SEC63 fragment shRNA2 R).

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] This invention, through in-depth research on the SEC63 sequence, extracted a characteristic fragment and found that its expression level differed significantly between tumor tissue and adjacent normal tissue. Therefore, it can be used as a biomarker for tumor diagnosis and treatment. Furthermore, liver cancer patients with high expression of this SEC63 fragment have a poorer prognosis, indicating that the SEC63 fragment itself can serve as a biomarker for assessing tumor prognosis. Experiments in this invention demonstrated that the expression level of the SEC63 fragment is positively correlated with intrahepatic metastasis, lymph node metastasis, and distant metastasis in liver cancer patients. Further research revealed that inhibitors of the SEC63 fragment can significantly inhibit the migration and invasion abilities of liver cancer cells. Therefore, this invention provides a new target for the treatment, diagnosis, and prognostic prediction of liver cancer, and provides primer pairs and antibodies targeting the SEC63 fragment for diagnosing tumorigenesis or assessing tumor prognosis, offering new ideas and strategies for treatment-related drugs and diagnostic products. Attached Figure Description

[0035] Figure 1 This is a graph showing the expression levels and statistical results of the SEC63 fragment in hepatocellular carcinoma (HCC) tissues and adjacent non-tumor tissues detected by immunohistochemistry. The first row on the left represents positive results from HCC tissues, and the second row represents negative results from adjacent non-tumor tissues. The right side shows the statistical expression levels of the SEC63 fragment gene transporter in HCC and non-HCC tissues (20 HCC tissues and 20 non-HCC tissues were included in the statistical analysis).

[0036] Figure 2The graph shows the relationship between the protein level of the SEC63 fragment and the overall survival rate (left) and disease-free survival rate (right) of liver cancer patients, based on the results of immunohistochemistry. SEC63(L) indicates low expression of SEC63, and SEC63(H) indicates high expression of SEC63.

[0037] Figure 3 The results show the detection of the mRNA level corresponding to the SEC63 fragment by molecular probe (top figure) and the relationship between the mRNA level corresponding to the SEC63 polypeptide fragment and the overall survival rate (bottom left figure) and disease-free survival rate (bottom right figure) of liver cancer patients. SEC63(L) indicates low expression of SEC63, and SEC63(H) indicates high expression of SEC63.

[0038] Figure 4 This is a graph showing the results of Western blot analysis of the expression levels and correlations of SEC63 fragments and ACLY in 12 pairs of patient tissue samples.

[0039] Figure 5 The Dot blot experiment verifies that the polyclonal antibody prepared in Example 1 can specifically recognize the SEC63 fragment. The figure shows the results of the antibody recognizing the polypeptide fragments at different dilutions.

[0040] Figure 6 This is a representative graph showing the expression of SEC63 fragment and ACLY in patients with metastatic liver cancer detected by immunohistochemistry, as well as a statistical graph showing the expression levels of SEC63 fragment and ACLY in patients with metastatic or non-metastatic liver cancer.

[0041] Figure 7 This is a statistical analysis of Cox multivariate data from patients with liver cancer, revealing the correlation between the SEC63 fragment and the prognosis of liver cancer.

[0042] Figure 8 The ROC curve for analyzing the SEC63 fragment can effectively predict whether liver cancer patients will develop metastases.

[0043] Figure 9 This describes the effect of SEC63 fragment inhibitors on the expression of the SEC63 fragment in liver cancer cell lines.

[0044] Figure 10 This figure shows the results of a Transwell assay to examine the effect of SEC63 fragment inhibitors on the migration and invasion abilities of liver cancer.

[0045] Figure 11 This is a graph showing the results of a scratch assay to examine the effect of SEC63 fragment inhibitors on the migration ability of liver cancer.

[0046] Figure 12Figure 1 shows the results of an in vivo mouse experiment to examine the effect of SEC63 fragment inhibitors on the invasive and metastatic capabilities of liver cancer.

[0047] Figure 13 The effect of SEC63 fragment inhibitors on the expression levels of EMT markers in liver cancer was detected by qPCR.

[0048] Figure 14 The effect of SEC63 fragment inhibitors on the expression levels of EMT markers in liver cancer was detected by Western blot.

[0049] Figure 15 The effect of SEC63 fragment inhibitors on ACLY expression levels was detected by Western blot.

[0050] Figure 16 The effect of combining SEC63 fragment inhibitors and ACLY inhibitors on histone H3 acetylation in liver cancer cells was detected by Western blot. Detailed Implementation

[0051] The technical solution of the present invention will be explained and described in detail below with reference to preferred embodiments, so that those skilled in the art can better understand the present invention. Unless otherwise specified, the biological materials, reagents, experimental methods, etc. used in the embodiments are all conventional items and techniques in the art.

[0052] The transporter SEC63 is a transporter located on the membrane of the endoplasmic reticulum in human cells. It is a dimer complex composed of three transmembrane domains and plays a key role in transporting newly synthesized polypeptide precursors into the endoplasmic reticulum membrane.

[0053] This study found that a polypeptide fragment of SEC63, specifically amino acid sequence sites 50-200, has both marker and target functions and can represent the SEC63 protein.

[0054] The amino acid sequence of the SEC63 fragment is shown in SEQ ID NO.1, and the corresponding gene nucleotide sequence is shown in SEQ ID NO.2.

[0055] Example 1: Preparation of Antibody and Gene Detection Primer Pairs for SEC63 Fragment Detection

[0056] 1.1 SEC63 fragment detection primer pair

[0057] Using the nucleotide sequence of the SEC63 fragment shown in SEQ ID NO.2 as the identification target, the following qPCR primer pair sequences were designed:

[0058] SEC63 fragment qPCR F: CGAGCAAATTCGATTAAAGAATATC (SEQ ID NO.3),

[0059] SEC63 fragment qPCR R:CCTGCAAGCAGAACTATTTTCTTTA (SEQ ID NO.4).

[0060] 1.2 Polyclonal antibody corresponding to SEC63 fragment

[0061] The amino acid sequence of the SEC63 fragment shown in SEQ ID NO.1 was artificially synthesized as an antigen to prepare the corresponding polyclonal antibody. The antibody preparation process is as follows:

[0062] 1) Rabbit preparation

[0063] Select two healthy 6-week-old New Zealand white rabbits (approximately 2 kg) and allow them to acclimatize to their new living environment for at least a few days before the first blood draw (for negative control).

[0064] 2) Rabbit's Immunization

[0065] The multi-route combined injection method was adopted: 0.50 ml of antigen with complete adjuvant (IgG amount of 5 mg / ml) was injected subcutaneously on the medial side of both palms (plantar surfaces); 14 days later, antigen with incomplete adjuvant was injected subcutaneously at multiple points; 7 days later, 2 ml of antigen without adjuvant was injected into the ear vein; serum antibody titer was measured, and the steps were repeated for those who did not meet the requirements, with the IgG amount increased appropriately.

[0066] 3) Valence testing

[0067] Two references were used: the negative reference was rabbit serum obtained before immunization, which was diluted with the initial concentration of the primary antibody (blocking dilution); the positive reference was the antigen used for immunization.

[0068] ① Coating antigen: Add 100 μl of antigen at a concentration of 1 μg / ml to each well of a 96-well plate and incubate overnight at 4°C, or incubate at 37°C for 2 hours.

[0069] ② Blocking: Discard the antigen solution, add 200 μl of blocking solution to each well, and incubate overnight at 4°C or for 2 hours at 37°C.

[0070] ③ Pour off the sealing solution, pat the plate on absorbent paper to remove as much residual liquid as possible, and wash the plate three times with detergent, patting out as much residual liquid as possible each time. If storing for a period of time, dry at 37°C and seal in a resealable bag at -20°C.

[0071] ④ Take a 96-well plate coated with the antigen, add 100 μl of negative control solution to the first well, 100 μl of positive control solution to the second well, and add 1:500 antiserum to the third well. Serially dilute the solution in each subsequent well and incubate at 37°C for 1 hour.

[0072] ⑤ Discard the liquid, wash the plate three times with washing solution, and pat dry. Add 100 μl of HRP-labeled mouse anti-rabbit IgG (1:2000 dilution) to each well and incubate at 37°C for 45 minutes.

[0073] ⑥ Discard the liquid, wash the plate three times with washing solution, and pat dry. Add 100 μl of TMB substrate to each well and incubate at 37°C for 5-20 minutes (the development time depends on the color intensity).

[0074] ⑦ Add 50 μl of stop solution (2NH2SO4) to each well and read the absorbance at 450 nm on a microplate reader.

[0075] Once the antibody titer reaches 1 million or higher, the rabbits can be bled out for final purification.

[0076] 4) Preparation of antibody affinity-affinity columns

[0077] Weigh 1 mg of CNBr-Sepherose 4B agarose gel and add it to 2 mmol / L hydrochloric acid. Incubate overnight at 4°C to allow it to fully swell, yielding 3 ml of swollen gel. Transfer the gel to a purification column and wash the medium three times with approximately 20 ml of 2 mmol / L hydrochloric acid. Wash the medium once with coupling buffer. Since the activating groups are easily hydrolyzed at the pH of the coupling buffer, this step should ideally be completed within a few minutes. Add 5-10 mg of antigen dissolved in 5 ml of coupling buffer to the gel. Gently mix and shake at room temperature for 2-4 hours, or incubate overnight at 4°C. If binding efficiency needs to be measured, take a small amount of solution for testing after this step. Wash the medium once with 20 ml of coupling buffer. Add 15 ml of 1% BSA solution and incubate at room temperature for 2 hours, or overnight at 4°C. Wash the medium at least three times with phosphate buffer, at least 15 ml each time. Antigen immobilization is complete and the gel is ready for purification. If not used immediately, or after use, seal with 20% ethanol.

[0078] 5) Purification and preservation of antiserum

[0079] Dilute the antiserum with an equal volume of PBS, centrifuge at 5000-10000 rpm for 15 minutes, and collect the supernatant. Wash the antigen affinity column with 10 volumes of PBS to equilibrate the column. Add 10 ml of the diluted antiserum to the equilibrated column. Gently mix and shake at room temperature for 2-4 hours, or overnight at 4°C. Wash the antigen column with 10 volumes of PBS to remove contaminating proteins. Wash the column with 2 volumes of antibody elution buffer to obtain the specific antibody (i.e., the target polyclonal antibody). Equilibrate the column with 10 volumes of PBS. Block the column with 20% ethanol and store at 4°C.

[0080] 6) Validation of polyclonal antibody specificity

[0081] The specificity of the polyclonal antibody obtained by the above method was verified by Dot blot experiments. The results showed that the antibody can specifically recognize the SEC63 fragment sequence. (See [link to Dot blot analysis]). Figure 5 .

[0082] Example 2: Relationship between SEC63 fragment expression level in hepatocellular carcinoma tissue and patient clinical characteristics and prognosis

[0083] In this implementation case, the expression level of the SEC63 fragment in the subject's tissues was detected by qPCR, immunohistochemistry, and western blot. The relationship between the SEC63 fragment and patient survival and prognosis was analyzed by Kaplan-Meier and Cox regression. The correlation between SEC63 and patient clinicopathological data was analyzed by chi-square test.

[0084] We collected tissue samples (including cancerous tissue and adjacent normal tissue) and clinical data from 139 patients diagnosed with liver cancer at Peking University Cancer Hospital between 2009 and 2011 and analyzed them using different experimental methods.

[0085] 2.1 Immunohistochemistry

[0086] ① Dewaxing and hydration: Paraffin sections of the tissue samples to be tested were placed in a 60°C oven and baked for 30-60 minutes. Then, they were sequentially immersed in xylene I, II, and III for 10 minutes each, followed by an ethanol gradient (high to low: 100%, 95%, 80%, 70%) for 2 minutes each. They were then washed three times with PBS, 3 minutes each time.

[0087] ② Cell permeation and blocking: Infiltrate the sections with preheated blocking and permeation buffer (40ml PBS + 120μl Triton X-100 + 400μl 30% H2O2) for 30min (RT, protected from light) to reduce the activity of endogenous peroxidase. Wash 3 times with PBS, 3min each time.

[0088] ③ Antigen retrieval: Microwave retrieval. Soak the slides in 0.01M sodium citrate buffer (pH 6.0) on high for 4 minutes until boiling, then remove and allow to cool naturally to room temperature. Repeat twice, adding more buffer each time to prevent the slides from drying out. Wash 3 times with PBS, 3 minutes each time.

[0089] ④ Serum blocking: Block some non-specific binding sites with serum from the same source as the secondary antibody, incubate at 37°C for 30 minutes, and then remove excess serum with filter paper.

[0090] ⑤ Incubation with primary antibody: Add 20 μl of diluted primary antibody (the primary antibody is the polyclonal antibody prepared by immunizing rabbits with antigen in Example 1), and incubate overnight at 4°C or for 1-2 hours at 37°C. Wash 3 times with PBS, 3 min each time.

[0091] ⑥ Incubate with secondary antibody: 20 μl of diluted secondary antibody (mouse anti-rabbit secondary antibody or goat anti-rabbit secondary antibody), incubate at 37℃ for 1-2 h, wash 3 times with PBS, 3 min each time.

[0092] ⑦ Staining of sections: Develop the stain with DAB-H2O2 for 10 minutes. At this time, observe the staining under a microscope to see if it is obvious. The staining can be stopped with distilled water within 10 minutes.

[0093] ⑧ Counterstaining and mounting: Stain with hematoxylin for 30 seconds, wash with water, differentiate with hydrochloric acid and alcohol for 2 seconds, and immerse in running water for 15 minutes. During dehydration, apply ethanol in a gradient (from low to high: 50%, 70%, 95%, 100%) for 2 minutes each. Translate the sections with xylene for 5 minutes, and finally mount with neutral resin.

[0094] Immunohistochemical results were analyzed using a semi-quantitative method, scoring based on the proportion of positive cells and staining intensity. Three fields of view (400x magnification) were randomly selected from each tissue section, and the staining intensity and percentage of positive cells were scored for each field. The final score was the product of staining intensity and percentage of positive cells. The staining intensity scoring criteria were: no staining = 0 points, pale yellow = 1 point, brownish-yellow = 2 points, and brownish-red = 3 points. The percentage of positive cells was: <5% = 0 points, 5%-25% = 1 point, 26%-50% = 2 points, 51%-75% = 3 points, and >75% = 4 points. A final score greater than 0 was defined as positive, and a score ≥6 indicated high expression. Each immunohistochemical slide was independently interpreted by two pathologists.

[0095] Figure 1 This is the result of immunohistochemical detection of the expression level of the SEC63 fragment in liver cancer tissue and adjacent non-tumor tissue. The first row on the left shows the positive results of liver cancer tissue, and the second row shows the negative results of adjacent non-tumor tissue. The right side shows the statistical expression level of the SEC63 transporter gene in liver cancer tissue and non-liver cancer tissue (20 cancer tissues and 20 non-liver cancer tissues were statistically analyzed). It can be seen that compared with adjacent non-liver cancer tissue, the expression of the SEC63 fragment is higher in cancer tissue than in adjacent non-tumor tissue.

[0096] We analyzed the overall survival and disease-free survival rates of 139 patients from Peking University Cancer Hospital, and plotted the results using the Kaplan-Meier method. (See attached table). Figure 2 This study analyzed the relationship between the protein expression level of the SEC63 fragment and the overall survival and disease-free survival of liver cancer patients based on immunohistochemical results. It found that patients in the group with high SEC63 fragment expression levels had shorter average survival times and poorer prognosis compared to those in the group with low SEC63 fragment expression levels.

[0097] 2.2 Real-time quantitative PCR (qPCR)

[0098] The following two shRNAs were used to knock out the SEC63 fragment.

[0099] SEC63 fragment shRNA1:

[0100] F:

[0101] CCGGCCCUUGAAGAAGAUCAGCAAUCUCGAGAUUGCUGAUCUUCUUCAAGGGU UUUUG (SEQ IDNO.7),

[0102] R:

[0103] AAUUCAAAAACCCUUGAAGAAGAUCAGCAAUCUCGAGAUUGCUGAUCUUCUUCAAG

[0104] GG

[0105] (SEQ ID NO.8).

[0106] SEC63 fragment shRNA2:

[0107] F:

[0108] CCGGGCUUUACAUUGCAGAUAGGAACUCGAGUUCCUAUCUGCAAUGUAAAGCU UUUUG(SEQ IDNO.9),

[0109] R:

[0110] AAUUCAAAAAGCUUUACAUUGCAGAUAGGAACUCGAGUUCCUAUCUGCAAUGU AAAGC (SEQ ID NO. 10).

[0111] At the same time, a control gene was set up, and the corresponding shRNA was used to knock down the control gene.

[0112] The mRNA levels corresponding to the SEC63 fragment in liver cancer cells after SEC63 gene knockout were then detected using qPCR primer pairs targeting the SEC63 fragment (SEQ ID NO. 3-4 listed in Example 1). The mRNA levels corresponding to the SEC63 fragment in liver cancer patients were then analyzed in relation to patient survival time. Results are shown below. Figure 3The top image shows the mRNA level detected by molecular probes (qPCR primer pairs) after the SEC63 fragment was knocked out. The bottom image shows the relationship between the mRNA level corresponding to the SEC63 fragment and the overall survival rate (bottom left) and disease-free survival rate (bottom right) of liver cancer patients. The results also showed that high mRNA expression levels corresponding to the SEC63 fragment were associated with shorter average survival time and poorer prognosis.

[0113] 2.3 Western blot

[0114] The expression levels of SEC63 fragment and ACLY in 12 pairs of patient tissue samples were detected by Western blot.

[0115] The specific method for Western blot is as follows:

[0116] SDS-PAGE gel preparation: Prepare SDS-PAGE gels of the required concentration according to the size of the target protein;

[0117] ① After accurately assembling the positive and negative electrodes of the electrophoresis apparatus, fill it with 1×Running Buffer, load the sample, and perform electrophoresis at a constant voltage, usually 80V;

[0118] ② Transfer: After electrophoresis, remove the compressed gel and stack the membranes in the following order: black side (negative electrode) - sponge - three layers of filter paper - gel - membrane - three layers of filter paper - sponge - white side (positive electrode). Use NC membrane. Assemble the instrument, place an ice plate inside and cool it with an external ice box. Fill the instrument with 1×Trans Buffer and transfer the membrane at a constant voltage of 80V for 2 hours. After the transfer is complete, stain the NC membrane with Ponceau S to check if the transfer was successful, and cut it according to the marker position.

[0119] ③Western blot: After cutting, the NC membrane was blocked with blocking buffer for 1 hour; the blocking buffer was discarded, and the membrane was washed 3 times with PBS-T for 10 minutes each time; the primary antibody (the primary antibody was the polyclonal antibody prepared by immunizing rabbits with the antigen in Example 1) was diluted with blocking buffer according to the ratio and incubated at 4°C overnight; after the primary antibody was recovered, the membrane was washed 3 times with 0.5% PBS-T for 10 minutes each time; the secondary antibody (mouse anti-rabbit secondary antibody or goat anti-rabbit secondary antibody) was diluted 1:10000 with blocking buffer and incubated at room temperature for 1 hour; after discarding the secondary antibody, the membrane was washed 3 times with PBS-T for 10 minutes each time, and after drying the NC membrane, it was exposed using an Odyssey exposure apparatus and the results were observed.

[0120] Western blot results are as follows Figure 4 The results of the analysis of expression levels and correlations of SEC63 and ACLY in 12 pairs of patient tissue samples showed that the expression levels of SEC63 fragments and ACLY in liver cancer tissues were higher than those in adjacent normal tissues, and the expression levels of SEC63 fragments and ACLY in liver cancer tissues were highly correlated.

[0121] This study performed a Cox multivariate analysis on clinical data of 139 patients at Peking University Cancer Hospital and found that the SEC63 fragment was an independent risk factor for poor prognosis in liver cancer. (See [link to relevant documentation]). Figure 7 .

[0122] In summary, the SEC63 fragment extracted in this invention is strongly correlated with the occurrence and poor prognosis of liver cancer, and can be used as a biomarker for the diagnosis and prognostic assessment of liver cancer.

[0123] Example 3: Correlation between SEC63 fragment and liver cancer metastasis

[0124] We used the polyclonal antibody from Example 1 to perform immunohistochemical analysis on tissue samples from patients with metastatic and non-metastatic liver cancer. Simultaneously, we detected ACLY expression using the corresponding ACLY antibody and performed statistical analysis. The results are as follows: Figure 6 As shown.

[0125] Figure 6 This chart represents the expression of SEC63 fragments and ACLY in patients with metastatic liver cancer, and provides a statistical graph of their expression levels in patients with and without metastatic liver cancer. The detection and statistical results show that the expression levels of SEC63 fragments and ACLY are correlated with intrahepatic metastasis, lymph node metastasis, and distant metastasis. Furthermore, the expression levels of SEC63 fragments and ACLY are higher in the metastatic group than in the non-metastatic group.

[0126] This study also found that the SEC63 fragment can serve as a good model for predicting whether metastasis has occurred in liver cancer patients. ROC curve analysis showed that the model had an AUC value of 0.8645 and a P-value < 0.0001. Figure 8 ).

[0127] Example 4: Lentiviral drugs targeting the gene corresponding to the SEC63 fragment can reduce the migration and invasion ability of liver cancer cells.

[0128] 4.1 Construction of stable cell lines with SEC63 knockout

[0129] First, a lentiviral expression vector plasmid was constructed. Then, the lentivirus was packaged into 293T cells, and subsequently, the lentivirus was used to infect liver cancer cell lines (Huh7, PLC / PRF / 5) to construct stable cell lines. The specific method is as follows:

[0130] The experiment was divided into three groups: the SEC63 shRNA1 group, the SEC63 shRNA2 combination control group, and three target plasmids. The first group contained SEC63 shRNA1 as described in Example 2, the second group contained SEC63 shRNA2 as described in Example 2, and the third group was the control, containing control shRNA. All other experimental conditions and procedures were the same among the three groups. Two types of liver cancer cells were used: Huh7 cells and PLC / PRF / 5 cells.

[0131] 1) Lentiviral packaging:

[0132] a) Mix the lentiviral plasmid and DMEM separately according to the following dosage (1-3 μg of packaging plasmid, 3 μg of target plasmid, and 2 ml of DMEM) to obtain a plasmid mixture. Mix the transfection reagent and DMEM separately (21 μL of PEI transfection reagent and 2 ml of DMEM) to obtain a transfection reagent mixture. Then mix the plasmid mixture and the transfection reagent mixture thoroughly and let stand at room temperature for 20 min.

[0133] b) HEK 293T cells (density 80%-90%), remove supernatant, add the above mixed solution (about 4 ml), and replace with 7 ml of complete culture medium after 8 hours;

[0134] c) 48 h after transfection, collect the supernatant for the first time (incubate at 4℃), add 4 ml of culture medium and continue culturing. Collect the supernatant for the second time 24 h later. Centrifuge both supernatants at 3000 rpm for 15 min at 4℃. Filter the supernatant through a 0.22 μm filter membrane. Add 5×PEG8000 to the filtrate (filtrate volume:PEG8000 = 4:1), mix every 20 min at 4℃ for 3-6 times, and incubate overnight at 4℃.

[0135] d) On the second day, centrifuge at 3000g for 30min, discard the supernatant, dissolve the precipitate in 200μl of complete culture medium, transfer to 1.5ml EP tube and dissolve overnight at 4℃, then freeze at -80℃.

[0136] 2) Lentiviral infection of cells:

[0137] Liver cancer cells were seeded into 6-well plates at a density of 20%-30%. After adhesion, the medium was removed, virus solution was added, and 1 ml of complete culture medium was added. The cell status was observed after 6-8 hours. The medium was changed or added to a total volume of 2 ml. Drug screening was performed after 48 hours.

[0138] Drug screening was performed using Western blot. The polyclonal antibody targeting the SEC63 fragment from Example 1 was used to detect the expression of the SEC63 fragment in different groups of infected liver cancer cells. Results are shown below. Figure 9The image shows the electrophoresis results of SEC63 fragment inhibitors, namely SEC63 fragment shRNA1 and SEC63 fragment shRNA2, in inhibiting SEC63 fragment expression in hepatocellular carcinoma cell lines. β-actin is the normal control protein, and SEC63 is the SEC63 fragment. The image shows that both shRNAs, SEC63 fragment shRNA1 and SEC63 fragment shRNA2, can inhibit SEC63 fragment expression, indicating the successful construction of a stable cell line with SEC63 fragment knockout.

[0139] Using the stable cell lines with the SEC63 fragment knocked out as described above, transwell assays, scratch assays, and in vivo experiments were performed.

[0140] 4.2 Transwell Experiment

[0141] Transwell invasion and migration assays: Chambers with and without Matrigel coating were used. The chambers were placed in 24-well plates. Experimental cells (i.e., stable cell lines with the SEC63 fragment knocked out) were serum-starved overnight and plated into the upper chambers of serum-free DMEM. Simultaneously, DMEM containing 10% FBS was added to the lower chamber. After incubation at 37°C for 24 hours, migrating or invading cells were stained with crystal violet, and cell counts were performed in three random fields.

[0142] See the experimental results. Figure 10 After knocking down the SEC63 fragment, both Huh7 and PLC / PRF / 5 cell lines showed reduced invasion and migration abilities compared to the Ctrl shRNA group without SEC63 knockdown, exhibiting significant differences. This indicates that knocking down SEC63 in hepatocellular carcinoma cell lines can reduce the migration and invasion abilities of hepatocellular carcinoma cells.

[0143] 4.3 Scratch Test

[0144] Seed an appropriate number of cells into a 6-well plate. After the cells adhered, a 200 μl yellow pipette tip was used to create a scratch perpendicular to the bottom of the culture dish. The scratches were observed and photographed under a microscope at 0 h, 6 h, 24 h, 36 h, and 48 h. The scratch area was measured using ImageJ software.

[0145] See the experimental results. Figure 11 After knocking down the SEC63 fragment, Huh7 and PLC / PRF / 5 cells, compared to the Ctrl shRNA group without SEC63 knockdown, showed significantly slower contraction in scratch width over time (left column, top and bottom images), and significantly slower contraction in relative scratch area (right column, top and bottom images). The scratch assay results also demonstrate that knocking down the SEC63 fragment can reduce the migration and invasion capabilities of liver cancer cells in liver cancer cell lines.

[0146] 4.4 In vivo experiments

[0147] A mouse lung metastasis model was established. Five-week-old nude mice were randomly divided into three groups (n=6 / group) and injected via tail vein with the established stable cell lines Huh7 Ctrl (Ctrl shRNA group), Huh7 SEC63 shRNA1 (SEC63 shRNA1 group), and Huh7SEC63 shRNA2 (SEC63 shRNA2 group), respectively. The injection dose was 1×10⁻⁶. 6 One cell per mouse was injected, and the mice were euthanized 8 weeks later to examine the growth of HCC tumors in the lungs.

[0148] See Figure 12 The top figure shows the immunohistochemical (HE staining) results of three representative lung overall appearance photographs and lung tissue sections detected by the polyclonal antibody of Example 1. The bottom figure shows the number of metastatic lesions of different stages of tumors in the three groups. Compared with the control Ctrl shRNA group, the number of stage I-II, III-IV, and total metastatic lesions in the SEC63 shRNA1 group and SEC63 shRNA2 group were significantly reduced, indicating that knocking down the expression of the SEC63 fragment reduced the metastatic ability of the hepatocellular carcinoma cell line (Huh7) in mice.

[0149] Example 5: Effect of SEC63 fragment knockout on EMT biomarker expression levels

[0150] EMT (Epithelial-Mesenchymal Transition) is one of the characteristics of malignant progression of tumors. It is mainly manifested by an abnormal decrease in the expression of cell adhesion molecules, while cytoskeletal proteins such as vimentin and fibronectin are significantly upregulated. At the same time, the expression of Snail family transcription factors, which are significantly related to the occurrence of EMT, is also abnormally upregulated.

[0151] This study used three stable cell lines constructed from Huh7 and PLC / PRF / 5 cell lines as experimental subjects. The three stable cell lines were: Control shRNA group (no effect on SEC63, control), SEC63 shRNA1 group (SEC63 shRNA1 knockdown of SEC63 fragment expression), and SEC63 shRNA2 group (SEC63 shRNA2 knockdown of SEC63 fragment expression). The effect of SEC63 knockout on the expression levels of EMT markers in cells was detected by qPCR and Western blot.

[0152] The specific operating procedure for real-time quantitative PCR (qPCR) is as follows:

[0153] 1) The PCR reaction system is shown below:

[0154]

[0155] 2) Real-time PCR experiments were performed using an ABI 7500fast instrument. The specific reaction conditions were as follows: 95℃ pre-denaturation for 1 min, followed by 40 cycles of 95℃-1 min, 60℃-30 s, and 72℃-30 s, and finally the melting curve program of 95℃-15 s, 60℃-1 min, 95℃-30 s, and 60℃-15 s.

[0156] 3) After the operation is complete, export the data and use the software to analyze it.

[0157] qPCR test results as follows Figure 13 As shown, compared to the control group, the mRNA levels of Snail1 (represented by SNAI1 in the figure) and Vimentin (represented by VIM in the figure) markers of mesenchymal cells were significantly reduced in both cell lines after knocking down the expression of the SEC63 fragment.

[0158] Western blot experiments were performed using commercially available antibodies for each biomarker protein, while the primary antibody used for the SEC63 fragment was the polyclonal antibody prepared in Example 1. Results are as follows: Figure 14 As shown, compared with the control group, after knocking down the expression of the SEC63 fragment, the expression levels of Snail1 and Vimentin, markers of mesenchymal-like cells, decreased in both cell lines, while the expression level of E-cadherin, a marker of epithelial-like cells, increased.

[0159] Example 6: Small interfering RNA (MIRNA) targeting the SEC63 fragment can inhibit liver cancer metastasis.

[0160] The specific sequence of small interfering RNA is shown below. Common methods for its synthesis include chemical synthesis, in vitro transcription, in vivo transcription, and enzymatic digestion.

[0161] SEC63 fragment siRNA1: CCCUUGAAGAAGAUCAGCAAU (SEQ ID NO.5),

[0162] SEC63 fragment siRNA2: GCCUACUUCAAGAAAUGGUU (SEQ ID NO.6).

[0163] Two cell lines, Huh7 and PLC / PRF / 5, were used as experimental subjects. Each cell line was divided into three groups: the first group was transfected with control siRNA (control siRNA group), the second group was transfected with SEC63 fragment siRNA1 (SEC63 siRNA1 group), and the third group was transfected with SEC63 fragment siRNA2 (SEC63 siRNA2 group). After transfection, Western blot experiments were performed to detect the expression of ACLY and SEC63 fragments. The primary antibody for ACLY was the corresponding commercially available antibody, the primary antibody for SEC63 fragment was the polyclonal antibody prepared in Example 1, and the primary antibody for control β-actin was the corresponding commercially available antibody.

[0164] See the results of the Western blot. Figure 15 The results showed that transfection with two small interfering RNAs could knock out or down the expression of the SEC63 fragment, and the expression level of ACLY also decreased accordingly after knocking out or down the SEC63 fragment.

[0165] Example 7: Mechanism of Action of SEC63 Fragment Inhibitor

[0166] We further investigated the effects of knocking out the SEC63 fragment and / or ACLY on EMT markers and histone H3 acetylation using Western blot.

[0167] The Huh7 cell line, whose SEC63 fragment expression was knocked down by SEC63 shRNA1 and SEC63 shRNA2, was used as the experimental subject. It was divided into two groups: the first group was transfected with control shRNA (a commercially available shRNA, serving as an internal reference gene for the cell line), and the second group was transfected with ACLY shRNA. Then, the expression of the SEC63 fragment was detected using the polyclonal antibody from Example 1, and the expression of ACLY, Snail1, H3ac, and β-actin was detected using their respective commercially available antibodies. Results are shown below. Figure 16 .

[0168] Figure 16 The results of Western blot analysis were used to detect the effects of combined SEC63 fragment inhibitors (SEC63 shRNA1 and SEC63 shRNA2) and ACLY inhibitors (ACLY shRNA) on histone H3 acetylation in hepatocellular carcinoma cells.

[0169] The above experiments revealed that knocking out the SEC63 fragment alone reduced the expression levels of acetylated snail1 and H3 histones in cells. Similarly, knocking out ACLY alone or in combination with SEC63 also reduced the expression levels of acetylated snail1 and H3 histones, yielding the same results as knocking out SEC63 alone. When SEC63 and ACLY were knocked out in combination, the binding of acetylated H3 histones to the SNAI gene promoter region was weakened, leading to a decrease in snail1 protein expression. This result demonstrates that the mechanism by which the SEC63 fragment inhibits liver cancer metastasis is through ACLY. SEC63 can alter the level of acetylated H3 histones in cells via ACLY, thereby affecting their binding to the SNAI gene promoter and ultimately altering the expression level of the EMT marker snail1.

[0170] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. SEC63 fragment, characterized in that The amino acid sequence is shown in SEQ ID NO.

1.

2. The SEC63 fragment according to claim 1, characterized in that The nucleotide sequence is shown in SEQ ID NO.

2.

3. Use of the SEC63 fragment according to claim 1 or 2 as a marker in the preparation of drugs for diagnosing liver cancer metastasis.

4. The use according to claim 3, characterized in that: The drug is an antibody prepared using the amino acid sequence shown in SEQ ID NO.1 as an antigen.

5. The use according to claim 3, characterized in that: The drug is a primer for detecting the SEC63 fragment gene.

6. The use according to claim 5, characterized in that: The sequences of the primers are shown in SEQ ID NO.3-4.

7. Use of the SEC63 fragment according to claim 1 or 2 as a target in the preparation of a drug for treating liver cancer, wherein the drug comprises a small interfering RNA, and the sequence of the small interfering RNA is shown in SEQ ID NO.5 or SEQ ID NO.

6.

8. Use of the SEC63 fragment according to claim 1 or 2 as a target in the preparation of a drug for treating liver cancer, wherein the drug comprises shRNA, and the sequence of the shRNA is shown in SEQ ID NO.7-8, or SEQ ID NO.9-10.

Images