Tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance detection kit and application

Abstract

The application provides a tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance detection kit and application thereof. The scheme provides a detection kit capable of simultaneously detecting tuberculosis mycobacterium, non-tuberculosis mycobacterium and mutations of various tuberculosis drug resistance genes. The multiple amplification qPCR technology is applied to the detection of the mutation genes of tuberculosis drug resistance, multiple mutation gene detection in one system is realized without interference, tuberculosis mycobacterium and non-tuberculosis mycobacterium can be detected, and the detection kit has the advantages of high sensitivity, high specificity, simple operation, short time consumption and small sample consumption.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of detection, in particular to a detection kit for Mycobacterium tuberculosis and non-tuberculosis Mycobacterium and tuberculosis drug resistance and application. BACKGROUND

[0002] Mycobacterium is a kind of long and slightly curved actinomycete species, sometimes with branches or filamentous bodies. There are many species of Mycobacterium, which can be divided into Mycobacterium tuberculosis complex, non-tuberculosis Mycobacterium and leprosy Mycobacterium. Mycobacterium tuberculosis complex includes Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium microti and Mycobacterium africanum, etc. Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis, which invades multiple organ systems of human body. Active Mycobacterium tuberculosis can accumulate in various organs of the body, and pulmonary tuberculosis is the most common. Pulmonary tuberculosis is a highly contagious airborne disease. About 2 billion people in the world are infected with Mycobacterium tuberculosis, and about 10 million new cases of tuberculosis were added in 2019. WHO has listed tuberculosis as one of the infectious diseases to be controlled. Non-tuberculosis Mycobacterium refers to Mycobacterium other than Mycobacterium tuberculosis, Mycobacterium bovis and leprosy Mycobacterium, which mainly causes lung lesions and can also cause lesions in other parts of the body. Common are lymphadenitis, skin and soft tissue infection and skeletal system infection. It can also cause blood-borne dissemination in severe cellular immune suppressors.

[0003] The treatment of diseases caused by Mycobacterium tuberculosis infection is mainly drug administration interference. If the drug can have an anti-tuberculosis effect, it will greatly help the treatment of the disease. However, in reality, due to various reasons, Mycobacterium tuberculosis develops drug resistance, which greatly reduces the effect of drug treatment. Studies have shown that chromosome-mediated drug resistance is the main basis for Mycobacterium tuberculosis to develop drug resistance. Therefore, the current research on drug resistance of Mycobacterium tuberculosis mainly focuses on the target of the drug and the mutation of the related gene.

[0004] Currently, the detection of Mycobacterium tuberculosis in clinical practice has the problem of low detection rate. For example, for extrapulmonary infections such as pleurisy, because the content of Mycobacterium tuberculosis in pleural effusion is very small, the positive rate of etiology detection is generally low. The sensitivity of picture staining is <10%, the sensitivity of Mycobacterium culture is <30%, the detection sensitivity of GeneXpert MTB / RIF (Xpert) and Xpert Ultra is 21.4%-22.7% and 37.5%-48.2% respectively, and the accuracy of immunological methods and biochemical parameters in diagnosing tuberculous pleurisy and other extrapulmonary infections is also poor. There is no clear detection method for non-tuberculosis Mycobacterium whether it is pulmonary tuberculosis or extrapulmonary tuberculosis.

[0005] The method of fluorescence probe for drug resistance of Mycobacterium tuberculosis complex includes nested amplification or melting curve method, the detection sensitivity of the nested amplification kit of a foreign big brand can only reach the level of sputum culture, the detection depth of the melting curve method needs to be 20% or even higher, and only one mutant gene can be detected each time, and several detection kits are needed to detect the rifampicin, isoniazid and fluoroquinolone resistance caused by rpoB, ahpC, inhA94, katG315 and gyrA gene mutations. In other words, the current drug resistance detection has the problems of long time consumption, high sample demand or low detection accuracy. When most patients in the clinic first appear drug resistance, the proportion of drug resistance genes is not high. Due to insufficient testing depth, mutant samples cannot be detected, so the best opportunity to change drugs is missed.

[0006] In summary, the current detection of Mycobacterium tuberculosis and non-tuberculous Mycobacterium has the problem of low sensitivity, and the detection of tuberculosis drug resistance has the problems of long time consumption, high sample demand and complex operation. SUMMARY

[0007] The purpose of the present application is to provide a tuberculosis or non-tuberculosis Mycobacterium and tuberculosis drug resistance detection kit and application, which applies multiple amplification qPCR technology to the detection of mutant genes of tuberculosis drug resistance, realizes the mutual interference of multiple mutant gene detection in one system, and can also detect Mycobacterium tuberculosis and non-tuberculosis Mycobacterium, has the advantages of high sensitivity, high specificity, simple operation, short time consumption and small sample amount.

[0008] In order to achieve the above purpose, the present application provides a tuberculosis or non-tuberculosis Mycobacterium and tuberculosis drug resistance detection kit, which comprises: at least two groups of combinations of multiple rpoB primer probe pairs for rpoB gene of Mycobacterium tuberculosis, multiple AhpC primer probe pairs for AhpC gene of Mycobacterium tuberculosis, multiple InhA primer probe pairs for InhA gene of Mycobacterium tuberculosis, multiple KatG primer probe pairs for KatG gene of Mycobacterium tuberculosis and multiple GyrA primer probe pairs for GyrA gene of Mycobacterium tuberculosis.

[0009] In the second aspect, the application provides an application method of a tuberculosis or non-tuberculosis Mycobacterium and tuberculosis drug resistance detection kit, which is used for detecting tuberculosis drug resistance mutations, Mycobacterium tuberculosis and non-tuberculosis Mycobacterium for non-diagnostic purposes.

[0010] Compared with the prior art, the technical scheme has the following characteristics and beneficial effects:

[0011] 1. Design the primer probe sequence for detecting the 23s RNA gene of the Mycobacterium tuberculosis complex, the 16s RNA gene of the non-tuberculous Mycobacterium, and the rpoB gene, Gyr gene, AhpC promoter, InhA gene and promoter, and KatG gene 315 mutation of the Mycobacterium tuberculosis complex, and the digital PCR detection system can realize the simultaneous detection of multiple reactions without interference in one system, and reduce the detection time.

[0012] 2. Design a mutation site as the last base at the 3' end of the primer, and use phosphate modification to block the 3' end of the primer. Multiple upstream primers are designed for multiple mutation sites of the same gene, and a downstream primer and a probe are used (the probe is on the same strand as the downstream primer). High-fidelity enzyme and Taq enzyme are mixed in the reaction system to realize the detection of multiple targets.

[0013] 3. In the super-multiplex reaction system, a specific normalization sequence is added to the 5' end of the primer to avoid the detection method caused by the difference in primer amplification efficiency in the super-multiplex system, and to avoid the influence of the amplification efficiency difference of multiple primers on the detection result. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 The figure shows the principle of using phosphate to block the 3' end of the upstream primer in the embodiment of the present application, combined with the specific detection of point mutations by high-fidelity enzyme.

[0015] Figure 2 The figure shows the process of adding universal primer normalization primer amplification efficiency to both ends of the primer in the embodiment of the present application.

[0016] Figure 3 The figure shows the original detection result of the embodiment of the present application. DETAILED DESCRIPTION

[0017] The technical solutions in the embodiments of the present application will be described in detail below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art belong to the scope of protection of the present application.

[0018] The present scheme provides a tuberculosis or non-tuberculosis Mycobacterium and tuberculosis drug resistance detection kit and application. The qPCR technology of multiplex amplification is introduced into the mutation detection of tuberculosis drug resistance, which can detect the Mycobacterium tuberculosis complex, non-tuberculosis Mycobacterium and tuberculosis drug resistance mutation gene in the same system. The detection of multiple primers and probes does not interfere with each other, improves the test depth, and improves the sensitivity and specificity of the detection.

[0019] The scheme utilizes the digital PCR detection method to realize the detection of tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance. The digital PCR is an absolute quantitative technology for single molecule target DNA. The technology is to dilute the nucleic acid template, add it to the PCR reaction system containing corresponding primers and fluorescent probe markers, and then divide the prepared reaction system containing nucleic acid templates into tens of thousands to hundreds of thousands of water-in-oil microdroplets through a microfluidic chip to enter the PCR cycle, so that the PCR reaction is independently carried out in each microdroplet. Then the number of negative and positive microdroplets is counted by detecting the fluorescence of each microdroplet, and the copy number of the target template in the original system is calculated by using the Poisson distribution principle. Because the droplets are divided, the mutual interference in the PCR reaction system is greatly reduced, thereby improving the sensitivity of the amplification of low-abundance targets. The copy number of the nucleic acid template in the original reaction system is directly calculated by the Poisson distribution principle, without introducing an internal reference to avoid the influence of the difference in amplification efficiency on the quantitative result, so as to achieve absolute quantification. Because there is no mutual interference in the PCR reaction system, different target genes can be labeled by different fluorescent probes, and different primers correspond to different mutation sites, so that the digital PCR combined with the ultra-multiplex technology is used to detect these mutations. Not only can all the mutations be concentrated in one system for detection, but also the test depth can reach 0.1%.

[0020] The scheme is based on the low interference, high sensitivity and high test depth of dPCR, and uses the qPCR technology of ultra-multiplex amplification to design a primer for the wild type gene at each drug resistance gene mutation site of tuberculosis drug resistance, so that the mutation site is the last base at the 3' end of the primer, and the 3' end of the primer is blocked by using phosphate (ddT, ddA, ddC, ddG, digoxin, SPC). For rpoB gene, AhpC gene, InhA gene, KatG gene and GyrA gene, multiple upstream primers are designed for multiple mutation sites of the same gene, and one downstream primer and one probe (the probe is on the same strand as the downstream primer) are used. High-fidelity enzyme and Taq enzyme are mixed in the reaction system to detect multiple mutation sites.

[0021] Specifically, the scheme provides a tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance detection kit, which comprises: at least two or more combinations of multiple rpoB primer probe pairs for the rpoB gene of Mycobacterium tuberculosis, multiple AhpC primer probe pairs for the AhpC gene of Mycobacterium tuberculosis, multiple InhA primer probe pairs for the InhA gene of Mycobacterium tuberculosis, multiple KatG primer probe pairs for the KatG gene of Mycobacterium tuberculosis, and multiple GyrA primer probe pairs for the GyrA gene of Mycobacterium tuberculosis; high-fidelity enzyme and Taq enzyme, and ddPCR mixed solution.

[0022] wherein the plurality of rpoB primer probe pairs for the rpoB gene of Mycobacterium tuberculosis include upstream primers of nucleic acid sequences as shown in SEQ ID NOs: 1-15, downstream primers of nucleic acid sequences as shown in SEQ ID NO: 16, and probes of nucleic acid sequences as shown in SEQ ID NO: 17; the plurality of AhpC primer probe pairs for the AhpC gene of Mycobacterium tuberculosis include upstream primers of nucleic acid sequences as shown in SEQ ID NOs: 18-31, primers of nucleic acid sequences as shown in SEQ ID NO: 32, and probes of nucleic acid sequences as shown in SEQ ID NO: 33; the plurality of InhA primer probe pairs for the InhA gene of Mycobacterium tuberculosis include upstream primers of nucleic acid sequences as shown in SEQ ID NOs: 34-38, downstream primers of nucleic acid sequences as shown in SEQ ID NO: 39, and probes of nucleic acid sequences as shown in SEQ ID NO: 40; the plurality of KatG primer probe pairs for the KatG gene of Mycobacterium tuberculosis include upstream primers of nucleic acid sequences as shown in SEQ ID NOs: 41-43, downstream primers of nucleic acid sequences as shown in SEQ ID NO: 44, and probes of nucleic acid sequences as shown in SEQ ID NO: 45; and the plurality of GyrA primer probe pairs for the GyrA gene of Mycobacterium tuberculosis include upstream primers of nucleic acid sequences as shown in SEQ ID NOs: 46-50, downstream primers of nucleic acid sequences as shown in SEQ ID NO: 51, and probes of nucleic acid sequences as shown in SEQ ID NO: 52.

[0023] It is worth mentioning that the primers with more internal complementary sequences in the rpoB primer probe pairs, the AhpC primer probe pairs, the InhA primer probe pairs, the KatG primer probe pairs, and the GyrA primer probe pairs are appropriately shortened in length, and the primers with lower Tm values are added with nucleotide modifications to increase Tm. The rpoB primer of SEQ ID NO: 14 is modified by adding G nucleotides, and the AhpC primers of SEQ ID NOs: 26-29 are all modified by adding T nucleotides at different positions and quantities.

[0024] In addition, the detection kit for Mycobacterium tuberculosis or non-tuberculosis Mycobacterium and tuberculosis drug resistance also comprises an exogenous internal reference primer probe corresponding to each of the rpoB gene, the AhpC gene, the InhA gene, the KatG gene and the GyrA gene, the sequence of the rpoB exogenous internal reference primer probe for the rpoB gene is shown as SEQ ID NO: 63, the sequence of the AhpC exogenous internal reference primer probe for the AhpC gene is shown as SEQ ID NO: 64, the sequence of the InhA exogenous internal reference primer probe for the InhA gene is shown as SEQ ID NO: 65, the sequence of the KatG exogenous internal reference primer probe for the KatG gene is shown as SEQ ID NO: 66, and the sequence of the GyrA exogenous internal reference primer probe for the GyrA gene is shown as SEQ ID NO: 67. It is worth mentioning that when the primer probe corresponding to the gene is contained, the corresponding internal reference primer probe is also contained.

[0025] It has been found through research that the drug resistance genes related to tuberculosis drug resistance mainly include the rpoB gene, the AhpC gene, the InhA gene, the KatG gene and the GyrA gene. The present application designs a primer corresponding to the wild-type gene for each drug resistance gene mutation site of each drug resistance gene, and the mutation site is located at the last base of the 3' end of the corresponding primer, and the 3' end of the primer is blocked by using phosphoric acid modification, wherein the phosphoric acid is selected from one of ddT, ddA, ddC, ddG, digoxin and SPC. In other words, the present application designs multiple upstream primers for the mutation sites of the same drug resistance gene, uses one downstream primer and one probe, and the downstream primer and the probe are on the same strand. In addition, two enzymes, high-fidelity enzyme and Taq enzyme, are mixed in the reaction system.

[0026] The detection mechanism of the present application for the drug resistance gene is shown in Figure 1 As shown on the left side of Figure 1 , if there is no mutation of the drug resistance gene in the detection object, the 3' end of the primer corresponding to the gene is blocked and cannot be amplified, so that the fluorescence signal cannot be detected. As shown on the right side of Figure 1 , if a mutation occurs on a certain drug resistance gene of the detection object, the high-fidelity enzyme will cut off the last base of the mismatched 3' end (that is, the base corresponding to the mutation site), so that the reaction system can detect the fluorescence signal.

[0027] It is worth mentioning that the tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance detection kit provided in the scheme includes at least two drug resistance gene primer probe pairs for rpoB gene, AhpC gene, InhA gene, KatG gene and GyrA gene, and each drug resistance gene primer probe pair contains multiple upstream primers. In order to reduce the interference between different primer probe pairs, the scheme uses dPCR technology to divide each reaction into more than 20000 small droplets, which to some extent reduces the PCR amplification interference to the minimum. However, the different amplification efficiencies of different primers will also cause the non-uniformity of the detection results. Therefore, the same normalization sequence is added to the 5' end of the primer of all primer probe pairs, and an excess of the primer of the normalization sequence is also added to the reaction system. As shown in Figure 2 The first few rounds of amplification of the reaction system use the primers corresponding to the target gene for amplification, and at the same time, the normalization sequence is added to both ends of the amplicon. In the later amplification, the amplicon with the normalization sequence added in the first few rounds is used as the template, and the sequence is used as the primer for amplification, so as to normalize the difference in amplification efficiency of different primers. Figure 2 ① in the above formula is a new amplicon formed by adding a universal primer to both ends of the amplicon after the first round of amplification, Figure 2 ② in the above formula is a new amplicon formed by using the new amplicon one as a template and performing one round of amplification, Figure 2 ③ in the above formula is a new amplicon two formed by using the primer with a universal primer added to both ends as an amplification primer and using the new amplicon two as a template for amplification, Figure 2 ④ in the above formula is a normalization amplification performed by using the universal primer as an amplification primer and using the new amplicon two as a template.

[0028] In some embodiments, the sequence of the normalization sequence is shown in SEQ ID NO: 68, and the normalization sequence is "GCAAGCCCTCACGTAGCGAA".

[0029] In some preferred embodiments, the tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance detection kit further comprises a tuberculosis primer probe pair for detecting Mycobacterium tuberculosis, which comprises a primer with a nucleic acid sequence as shown in SEQ ID NO: 53-54, and a probe with a nucleic acid sequence as shown in SEQ ID NO: 55.

[0030] In some preferred embodiments, the tuberculosis or non-tuberculosis mycobacterium and tuberculosis drug resistance detection kit further comprises a non-tuberculosis primer probe pair for detecting non-tuberculosis mycobacterium, which comprises a primer with a nucleic acid sequence as shown in SEQ ID NO: 56-57, and a probe with a nucleic acid sequence as shown in SEQ ID NO: 58.

[0031] In some embodiments, the probe of the rpoB gene is an MGB probe, and the fluorescent reporter group is a FAM group; the probe of the AhpC gene is an MGB probe, and the fluorescent reporter group is a ROX group; the probe of the InhA gene is an MGB probe, and the fluorescent reporter group is a ROX group; and the probe of the GyrA gene is an MGB probe, and the fluorescent reporter group is a CY5 group.

[0032] In some embodiments, the probe for Mycobacterium tuberculosis is an MGB probe, and the fluorescent reporter group is CY5.5; and the probe for non-tuberculosis Mycobacterium is an MGB probe, and the fluorescent reporter group is VIC.

[0033] In addition, the present application also randomly generates random primers such as SEQ ID NO: 59-60 and a probe such as SEQ ID NO: 61, and generates a foreign reference primer probe such as SEQ ID NO: 62. The advantage of this design is that by using the corresponding foreign reference primer probe of the randomly generated sequence, the cross-reaction between the internal reference and various species can be minimized.

[0034] In addition, the present application provides a use of a tuberculosis or non-tuberculosis Mycobacterium and tuberculosis drug-resistant detection kit, which uses digital dPCR to amplify and detect the test substance. Specifically, the primers and probes in the kit are mixed with the test substance, and water, high-fidelity enzyme and Taq enzyme are added to obtain a reaction system after mixing the ddPCR mixture. The test substance is amplified and detected by digital dPCR, and the amplification program is 98℃ for 5min 【98℃ for 15s, 60℃ for 30s】*40.

[0035] Example 1: A detection kit for simultaneously detecting Mycobacterium tuberculosis, non-tuberculosis Mycobacterium and tuberculosis drug resistance:

[0036] 1. Design of primer and probe pairs

[0037] According to the 23sRNA of Mycobacterium tuberculosis, the 16s RNA of non-tuberculosis Mycobacterium and the rpoB, gyrA, ahpC, inhA and katG315 genes and promoter sequence analysis results of Mycobacterium tuberculosis, the primers and probes contained in the kit are shown in Table 1 as follows:

[0038] Table 1 Primer and probe combination table

[0039]

[0040]

[0041]

[0042]

[0043] 2. Detection sample acquisition:

[0044] In this scheme, inactivated bacteria were purchased and DNA samples were extracted from them using magnetic beads. Sterile sputum and alveolar lavage fluid were taken and human DNA samples were extracted using magnetic beads. Inactivated bacterial strain genomic DNA was purchased as Mycobacterium tuberculosis and non-tuberculosis Mycobacterium. The drug-resistant mutation template was obtained by artificially synthesizing the corresponding gene sequence of the specified drug-resistant site. The external reference endogenous template was obtained by biological synthesis.

[0045] 3. Digital dPCR amplification:

[0046] 3.1 Mix primers and probes for rpoB, gyrA, ahpC, inhA, and katG315 genes, and Mycobacterium tuberculosis and non-tuberculosis Mycobacterium primer probe pairs to obtain primer probe mixture. In actual operation, according to actual needs, select mixed primers and probes to obtain corresponding primer probe mixture.

[0047] The construction of the primer probe mixture of this scheme is shown in Table 2 below:

[0048] Table 2 Construction of primer probe mixture

[0049]

[0050]

[0051] 3.2 Construction of dPCR reaction system

[0052] This scheme mixes various reagents required for dPCR to construct a dPCR reaction system. The dPCR reaction system is shown in Table 3 below:

[0053] Table 3 dPCR reaction system

[0054]

[0055]

[0056] The PCRmix in this reaction system includes high-fidelity enzyme, Taq enzyme, and dNTP.

[0057] 3.3 dPCR amplification

[0058] The reaction system was placed in dPCR for amplification, and the amplification program was controlled as 98℃ 5min 【98℃ 15s, 60℃ 30s】*40.

[0059] 4. Results show:

[0060] The detection results of this scheme are shown in Table 4:

[0061] Table four test results table

[0062]

[0063]

[0064]

[0065]

[0066] The data in Table Four can see that the system detects different species of Mycobacterium tuberculosis complex, common species of non-tuberculous mycobacteria, human samples, and rpoB gene, Gyr gene, AhpC promoter, InhA gene and promoter and KatG gene 315 mutation simulation samples. Only the simulation sample with corresponding mutation has a detection value and the detection result stability is better.

[0067] Example Two Screening of Common Primers and Probes for Each Drug-resistant Gene

[0068] This scheme designs 3 common primers, 3 probes and 3 corresponding unblocked upstream primers for each drug-resistant gene. qPCR is performed with 10000 copies / μl (stock solution), 1000 copies / μl (10-fold dilution), 100 copies / μl (100-fold dilution) of the corresponding sequence plasmid as the template. The CT values and maximum fluorescence values detected by 3 pairs of primers and probes for 5 genes are shown in Table Five:

[0069] Table Five CT values and maximum fluorescence values detected by 3 pairs of primers and probes for 5 genes

[0070]

[0071] Because the maximum fluorescence intensity of the amplification product determines the difference between the gray values of positive and negative droplets in droplet digital PCR, in order to maximize the difference between the gray values of positive and negative droplets, the primer probe combination with larger maximum fluorescence intensity of the amplification product should be selected when selecting the primer probe combination. Through this condition, the first pair of rpoB gene, the second pair of Gyr gene, the first and second pairs of AhpC gene, the third pair of InhA gene, and the first pair of KatG can be selected from the three groups of primer probe combinations of each of the five genes. Because 10 is about 2 to the power of 3.3, the CT value of the detection increases by 3.3 for every 10-fold dilution of the template concentration. The primer probe combination is considered to be the combination that is least affected by external conditions and can be selected for the construction of a multiplex system. Through the analysis of the two factors, the first pair of rpoB gene, the second pair of Gyr gene, the second pair of AhpC gene, the third pair of InhA gene, and the first pair of KatG are selected for each of the five genes. The common primer probe is used for the construction of the system.

[0072] Example three: screening of primer modification for each drug-resistant gene

[0073] The common primer probe of the Gyr gene selected through the above experiment is used to modify the last base at the 3' end of the upstream primer with phosphoric acid, ddC, and digoxin, respectively. The qPCR is performed with 10000 copies / μl (stock solution), 1000 copies / μl (10-fold dilution), and 100 copies / μl (100-fold dilution) of the corresponding sequence plasmid as the template. The enzyme ratio is selected according to the literature report, which is 1:5 (the final concentrations of NEB high-fidelity enzyme Q5 and Zymo Research ATaq enzyme are 0.09 U and 0.45 U, respectively, in a 15 μl system). The influence of different modifications on the amplification efficiency of the blocking primer is analyzed. The results are shown in Table 6.

[0074] Table 6: Influence of different modifications on the amplification efficiency of the blocking primer

[0075]

[0076]

[0077] As shown in the above table: all modifications will cause the amplification efficiency of the primer to decrease to some extent. From the detection value and the maximum fluorescence value of the amplification curve, compared with ddC and digoxin modification, the use of phosphoric acid modification can minimize the influence on the amplification efficiency of the primer. Therefore, in the following experiments, phosphoric acid modification is selected to block the 3' end of the upstream primer.

[0078] Example four: screening of enzyme concentration and ratio

[0079] The 3' end of the upstream primer is selected for phosphate modification for building the system. In the system building process, NEB high-fidelity enzyme Q5 and Novozyme's ATAQ enzyme are selected, and the present scheme selects Q5: ATAQ equal to 1:5 for building the system. One mutant template is selected for each channel (template concentration is 10000 copies / μl), and the system with a final volume of 15 μl is verified. Six groups are verified respectively, and the enzyme concentration ratio and its detection value are shown in Table Seven as follows:

[0080] Table Seven Enzyme concentration ratio and its detection value

[0081]

[0082] From the detection value and the maximum fluorescence value of the amplification curve, in the system with a final volume of 15 μl, when the concentrations of ATAQ enzyme and high-fidelity enzyme Q5 are 0.5 U and 0.1 U respectively, the amplification efficiency of all channels in the system is the highest.

[0083] Example Five, primer addition sequence selection

[0084] The 3' end of the upstream primer is modified with phosphate, and one mutant upstream primer is selected for each channel. The universal sequences in Table Eight are added to the 5' end of all primers respectively, and NEB high-fidelity enzyme Q5 and Novozyme's ATAQ enzyme are 0.5 U and 0.1 U respectively for building the system with a final volume of 15 μl. The template concentration is 10000 copies / μl, and the detection results are shown in Table Eight:

[0085] Table Five Different universal sequences

[0086]

[0087] Through the analysis of the detection results, it is shown that after adding all the universal primers to the detection primers, the detection CT value is increased, which indicates that adding all the universal primers will reduce the amplification efficiency of the original primers. However, the detection values of different channels are relatively close, and the amplification efficiency of the primers is reduced less and is within the acceptable range, so that the amplification difference caused by different amplification efficiencies of the primers can be avoided. Comprehensive analysis shows that adding the universal primer "GCAAGCCCTCACGTAGCGAA" can reduce the amplification efficiency of the primers the least, so "GCAAGCCCTCACGTAGCGAA" is selected as the universal primer for the universal sequence in the subsequent experiments.

[0088] Example Six, system detection of tuberculosis drug resistance gene mutation test depth verification

[0089] The 3' end of the upstream primer is modified with phosphoric acid, and the sequence "GCAAGCCCTCACGTAGCGAA" is added to the 5' end of all primers as a universal primer. In addition to all primer probes, 1 micromole / L of the sequence "GCAAGCCCTCACGTAGCGAA" is added to the system. The high-fidelity enzyme Q5 of NEB and the ATAQ enzyme of Nuclisense are 0.5 U and 0.1 U, respectively, used to build a system with a final volume of 15 microliters. One mutation is selected for each channel as a detection target. The template concentration of the wild type and mutant in each channel is 10 copies / ul and 10,000 copies / ul, respectively, for digital PCR. The original detection chart of each channel in the digital PCR is as follows Figure 3 The detection values are shown in Table Nine as follows:

[0090] Table Nine Detection Values

[0091]

[0092] The results show that the detection system can still detect the mutation ratio of 0.1% in each channel of the detection system. It shows that the test depth can reach 0.1% when the template concentration is high enough.

[0093] The present application is not limited to the above best mode, and anyone can derive other various forms of products under the inspiration of the present application, but regardless of any changes in shape or structure, any technical solution with the same or similar technical solutions as the present application falls within the scope of the present application.

Claims

1. A detection kit for tuberculous or non-tuberculous mycobacteria and drug-resistant tuberculosis, characterized in that, include: Multiple sets of rpoB primer-probe pairs targeting the rpoB gene of Mycobacterium tuberculosis, multiple sets of AhpC primer-probe pairs targeting the AhpC gene of Mycobacterium tuberculosis, multiple sets of InhA primer-probe pairs targeting the InhA gene of Mycobacterium tuberculosis, multiple sets of KatG primer-probe pairs targeting the KatG gene of Mycobacterium tuberculosis, and multiple sets of GyrA primer-probe pairs targeting the GyrA gene of Mycobacterium tuberculosis were detected using digital PCR. The multiple sets of rpoB primer-probe pairs targeting the rpoB gene of Mycobacterium tuberculosis are shown as upstream primers for the nucleic acid sequences shown in SEQ ID NO:1~15, downstream primers for the nucleic acid sequences shown in SEQ ID NO:16, and probes for the nucleic acid sequences shown in SEQ ID NO:

17. Multiple sets of AhpC primer-probe pairs targeting the AhpC gene of Mycobacterium tuberculosis are shown, including upstream primers for the nucleic acid sequences shown in SEQ ID NO:18~31, downstream primers for the nucleic acid sequences shown in SEQ ID NO:32, and probes for the nucleic acid sequences shown in SEQ ID NO:

33. Multiple sets of InhA primer-probe pairs targeting the InhA gene of Mycobacterium tuberculosis are shown, including upstream primers for the nucleic acid sequences shown in SEQ ID NO:34~38, downstream primers for the nucleic acid sequences shown in SEQ ID NO:39, and probes for the nucleic acid sequences shown in SEQ ID NO:

40. Multiple sets of KatG primer-probe pairs targeting the KatG gene of Mycobacterium tuberculosis are shown, including upstream primers for the nucleic acid sequences shown in SEQ ID NO:41~43, downstream primers for the nucleic acid sequences shown in SEQ ID NO:44, and probes for the nucleic acid sequences shown in SEQ ID NO:

45. Multiple sets of GyrA primer-probe pairs targeting the GyrA gene of Mycobacterium tuberculosis are shown, including upstream primers for nucleic acid sequences as shown in SEQ ID NO:46~50, downstream primers for nucleic acid sequences as shown in SEQ ID NO:51, and probes for nucleic acid sequences as shown in SEQ ID NO:

52. The same normalization sequence was added to the 5' end of all primers for all primer-probe pairs, and an excess of the normalization sequence primer was also added to the reaction system. The nucleic acid sequence of the normalization sequence is shown in SEQ ID NO:

68. For primers with a large number of internal complementary sequences in rpoB, AhpC, InhA, KatG, and GyrA primer-probe pairs, shorten the primer length appropriately. For primers with low Tm values, add nucleotide modifications to increase Tm.

2. The detection kit for tuberculous or non-tuberculous mycobacteria and drug-resistant tuberculosis according to claim 1, characterized in that, This includes a tuberculosis primer-probe pair for the detection of Mycobacterium tuberculosis, including primers with nucleic acid sequences as shown in SEQ ID NO:53-54 and probes with nucleic acid sequences as shown in SEQ ID NO:

55.

3. The detection kit for tuberculous or non-tuberculous mycobacteria and drug-resistant tuberculosis according to claim 1, characterized in that, This includes nontuberculous primer-probe pairs for the detection of nontuberculous mycobacteria, including primers with nucleic acid sequences as shown in SEQ ID NO:56~57 and probes with nucleic acid sequences as shown in SEQ ID NO:

58.

4. The detection kit for tuberculous or non-tuberculous mycobacteria and drug-resistant tuberculosis according to claim 1, characterized in that, It contains high-fidelity enzymes, Taq enzymes, and ddPCR mixture.

5. A method for applying the detection kit for tuberculous or non-tuberculous mycobacteria and drug-resistant tuberculosis according to any one of claims 1 to 4, characterized in that, Used for non-diagnostic detection of drug-resistant mutations in tuberculosis, Mycobacterium tuberculosis, and non-tuberculous mycobacteria.

Images