Application of integrin protein ITGA5 as a marker in preparation of a drug for treating high leukocytic acute myeloid leukemia
By analyzing the abnormal expression of the integrin protein ITGA5 and applying the inhibitor ATN161, the problem of high early mortality in HAML was solved, and effective diagnosis and treatment of HAML were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-10
- Publication Date
- 2026-03-24
AI Technical Summary
In the current technology, high leukocytic acute myeloid leukemia (HAML) has a high early mortality rate, lacks effective biomarkers for diagnosis and treatment, and the biological mechanism of integrin-mediated cell migration behavior is unclear.
By collecting bone marrow cells from HAML patients, NHAML patients, and healthy controls, single-cell transcriptomic and proteomic sequencing were performed to create a single-cell molecular atlas of HAML. It was discovered that the integrin protein ITGA5 is abnormally expressed in HAML. By using ITGA5 inhibitors such as ATN161 to inhibit its expression or activity, therapeutic drugs were prepared to inhibit leukocyte migration, invasion, and proliferation.
It effectively inhibits the migration, invasion, and proliferation of HAML leukocytes, providing new diagnostic and therapeutic targets and reducing the early mortality rate of HAML.
Smart Images
Figure CN116392572B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the application of integrin protein ITGA5 as a biomarker in the preparation of drugs for treating high leukocytic acute myeloid leukemia. Background Technology
[0002] Acute myeloid leukemia (AML) is a clonal malignant tumor of hematopoietic stem cells characterized by the accumulation of immature progenitor cells, impaired differentiation, and suppression of hematopoietic function. AML is characterized by a white blood cell count exceeding 100 × 10⁶ in the peripheral blood. 9 A leukocytic count ( / L) is called hyperleukocytic acute myeloid leukemia (HAML), accounting for approximately 5%-20% of AML cases. HAML has a rapid onset and progression, a relatively low remission rate, and a high early mortality rate, with a mortality rate as high as 40% within one week, making it a high-risk type of acute leukemia. Leukemic cells proliferate extensively in the bone marrow and migrate to the periphery, accumulating in tissues and causing tissue hypoxia and embolism, which are the main causes of early death. However, the mechanism of its malignant proliferation and infiltration remains unclear.
[0003] Integrins are among the most important mechanosensitive receptors on the cell membrane, mediating mechanical interactions between cells and the surrounding matrix or neighboring cells. They transduce mechanical stimuli into biochemical signals, activating a series of intracellular responses and ultimately influencing cell differentiation, migration, and other functions, making them crucial in cellular micromechanics research. Integrins and related focal adhesion proteins are fundamental and vital in cell migration and adhesion between cells and the extracellular matrix (ECM). Currently, a unified understanding of the mechanobiological mechanisms underlying integrin-mediated cell migration is lacking.
[0004] Due to the high early mortality rate, some HAML patients do not have the opportunity to receive routine treatment and drug therapy. Therefore, effective biomarkers will be of great significance for the diagnosis and treatment of HAML. Summary of the Invention
[0005] The purpose of this invention is to provide the application of integrin protein ITGA5 as a biomarker in the preparation of drugs for treating high-leukocyte acute myeloid leukemia. A further purpose of this invention is to provide the application of integrin protein ITGA5 in the preparation of products for diagnosing high-leukocyte acute myeloid leukemia.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] This invention collects bone marrow cells from HAML patients, NHAML (non-hyperleukemic acute myeloid leukemia) patients, and healthy controls. Single-cell transcriptomics and proteomics sequencing are performed to create a molecular atlas of HAML single cells, analyzing HAML-specific populations and aberrantly expressed molecules. Abnormal expression of integrin ITGA5 was discovered in HAML leukemia cells. Further expanding the sample size, bone marrow CD34+ cells and bone marrow supernatant were collected from healthy individuals, treatment-naïve HAML patients, and NHAML patients. Nucleic acid was extracted, and PCR was used to verify integrin gene expression levels, confirming that HAML patients specifically highly express integrin ITGA5. This invention also found that inhibiting the expression or activity of the integrin protein ITGA5 can effectively inhibit HAML leukocyte migration, invasion, and proliferation.
[0008] Application of integrin protein ITGA5 as a biomarker in the preparation of drugs for the treatment of HAML.
[0009] Application of integrin protein ITGA5 inhibitors in the preparation of drugs for the treatment of HAML.
[0010] Application of integrin protein ITGA5 inhibitors in the preparation of drugs that inhibit HAML leukocyte migration, invasion, and proliferation.
[0011] The drug targets ITGA5 to inhibit ITGA5 gene expression or ITGA5 protein activity.
[0012] The ITGA5 inhibitor includes substances that inhibit ITGA5 gene expression and substances that inhibit ITGA5 protein activity. Further, the ITGA5 inhibitor is ATN161; or the ITGA5 inhibitor is an antibody against the ITGA5 protein.
[0013] The application of reagents for detecting the expression level of the integrin protein ITGA5 in the preparation of diagnostic reagents or kits for HAML. The reagents for detecting the expression level of the integrin protein ITGA5 include qPCR primers.
[0014] Advantages and beneficial effects of this invention: This invention effectively inhibits the migration and invasion of HAML leukocytes by suppressing the expression of the integrin protein ITGA5. ITGA5 can serve as a detection target for HAML and also as a therapeutic target for HAML. Attached Figure Description
[0015] Figure 1 The ITGA5 inhibitor ATN161 inhibits leukocyte migration in HAML patients.
[0016] Figure 2 It is the ITGA5 inhibitor ATN161 that inhibits leukocyte invasion in HAML patients.
[0017] Figure 3 This involves qPCR detection of ITGA5 expression in HAML / NHAML / normal human leukocytes.
[0018] Figure 4 The expression of ITGA5 in bone marrow supernatant of HAML / NHAML / normal individuals was detected by ELISA.
[0019] Figure 5 Transcriptome sequencing revealed elevated ITGA5 expression in leukocytes of different HAML patients, with the baseline in the figure representing normal levels. Detailed Implementation
[0020] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0021] The following examples illustrate the acquisition of HAML patient leukocytes: Bone marrow was extracted from HAML patients, cryopreserved, and transported to the laboratory for isolation and culture as soon as possible. Bone marrow fluid was gently added to a 15 mL sterile centrifuge tube containing an equal volume of Percoll working solution (density 1.073 g / L), ensuring the operation was as gentle and smooth as possible. Two distinct layers were observed in the centrifuge tube: the upper layer was bone marrow, and the lower layer was Percoll solution. The centrifuge tube was placed in a centrifuge, set to 500 g, and centrifuged for 25 min. After centrifugation, the centrifuge tube was divided into four layers from top to bottom. The middle white membrane layer was gently aspirated with a pipette and washed twice with PBS buffer containing 2% FBS. The cells were then centrifuged at 250 g for 10 min and 5 min respectively. The supernatant was discarded, and the mononuclear cell pellet remained, which was the HAML patient leukocyte.
[0022] Example 1: Integrin ITGA5 inhibitors inhibit leukocyte migration and invasion in HAML patients
[0023] (1) Cell migration experiment:
[0024] Magnetic beads were used to sort CD34+ cells from HAML patients' white blood cells; 0.1 mL of serum-free cell suspension was added to the upper chamber of the Transwell to bring the final cell concentration to 7.5 × 10⁻⁶ cells / mL. 4Cells / well were cultured, and a certain concentration of the ITGA5 inhibitor ATN161 was added. 0.8 mL of culture medium containing 10% serum was added to the lower chamber of the Transwell as a chemoattractant to attract cell migration and the secretion of matrix proteases for invasion. The cell culture plate was incubated at 37°C and 5% CO2 for 24-48 hours. The culture medium was removed, and the cells were washed twice with PBS. Unmigrated cells were gently wiped away with a cotton swab. 1 mL of 100% methanol was added for fixation at room temperature for 30 minutes, followed by two washes with PBS. 1 mL of 0.1% crystal violet staining solution was added for staining at room temperature for 20 minutes, followed by two washes with PBS. The Transwell was transferred to a glass slide, and the number of migrating cells was counted by randomly observing 6-9 fields of view under a microscope. It was found that the ITGA5 inhibitor ATN161 significantly reduced the number of migrating cells in the lower chamber and significantly inhibited HAML cell migration. Figure 1 ).
[0025] (2) Cell invasion experiment:
[0026] Prepare in advance 0.5× C buffer, 1× A gel, and a Transwell apparatus suitable for 24-well plates; dilute the A gel 15-20 times with C buffer at 37℃, add 0.2 mL of the A gel dilution to the upper chamber of the Transwell based on the bottom area of the upper chamber, and then incubate at 4℃ for 2-3 hours; add 0.1 mL of serum-free cell suspension to the upper chamber of the Transwell to bring the final cell concentration to 7.5×10⁻⁶ cells / well. 4 Cells / well were cultured, and a certain amount of ITGA5 inhibitor ATN161 was added. 0.8 mL of culture medium containing 10% serum was added to the lower chamber of the Transwell as a chemoattractant to attract cell migration and the secretion of matrix proteases for invasion. The cell culture plate was incubated at 37°C and 5% CO2 for 24-48 hours. The culture medium was removed, and the cells were washed twice with PBS. Unmigrated cells were gently wiped away with a cotton swab. 1 mL of 100% methanol was added for fixation at room temperature for 30 minutes, followed by washing twice with PBS. 1 mL of 0.1% crystal violet staining solution was added for staining at room temperature for 20 minutes, followed by washing twice with PBS. The Transwell was transferred to a glass slide, and the number of migrating cells was counted by randomly observing 6-9 fields of view under a microscope. It was found that the ITGA5 inhibitor ATN161 significantly reduced the number of invading cells in the lower chamber and significantly inhibited HAML cell invasion. Figure 2 ).
[0027] Example 2: Detection of ITGA5 expression in HAML patient leukocytes by qPCR:
[0028] 1. RNA extraction and concentration detection: 1×10⁻⁶ RNA samples were collected. 7For leukocytes of [[number]] HAML patients (or NHAML patients, normal individuals), add 1 mL of TRizol and pipette repeatedly to mix evenly. Invert 10 times. After the liquid becomes clear, let it stand at room temperature for 5 min. Add 0.2 mL of chloroform, invert to mix evenly 10 times, then let it stand at room temperature for 5 min, and centrifuge at 12,000 g at 4 °C for 15 min. Take approximately 400 μL of the upper aqueous phase and transfer it to another 1.5 mL RNA-free Ep tube. Add an equal volume of isopropanol, invert to mix evenly, and let it stand at room temperature for 10 min. After centrifuging at 12,000 g at 4 °C for 10 min, discard the supernatant. Add 1 mL of pre-chilled 75% ethanol (diluted with DEPC water), centrifuge at 7500 g at 4 °C for 5 min. Discard the supernatant, air dry for 5 - 10 min, then dissolve in 20 μL of DEPC water and store at -80 °C. Use a nucleic acid concentration detector to measure the concentration of the obtained RNA. The A260 / 280 value around 2.0 is the best.
[0029] 2. cDNA synthesis (1)
[0031]
[0032] 42 °C for 2 min (or 5 min at room temperature), store at 4 °C.
[0033] (2) <TB Green qPCR method>
[0034]
[0035] PCR run on the machine: 37 °C for 15 min - 85 °C for 5 sec - cool at 4 °C - store the synthesized product at -20 °C
[0036] 3. RT-PCR reaction: Taking a 20 μL reaction system as an example.
[0037]
[0038] Among them, the primer sequences for detecting ITGA5 are as follows:
[0039] ITGA5-F: TGGAAGGTCAGCAGCTCCTATAT,
[0040] ITGA5-R: CTGCAGACTTTGGCTCTCTTGTT.
[0041] Reaction conditions (three-step method): Pre-denaturation at 95 °C for 10 min; denaturation at 95 °C for 15 s, annealing at 55 - 64 °C for 30 s, extension at 72 °C for 32 s, 39 cycles.
[0042] The QPCR results are as Figure 3As shown, ITGA5 is highly expressed in HAML patient cells, higher than in AML (NHAML) and normal individuals.
[0043] Example 3: ELISA detection of ITGA5 expression in bone marrow supernatant from HAML patients, NHAML patients, and healthy individuals.
[0044] (1) Prepare reagents, samples and standards.
[0045] (2) Add 100 μL of standard or sample to each well and incubate at 37°C for 2 hours. Aspirate the liquid from each well; do not wash.
[0046] (3) Add 100 μL of biotin antibody (1-fold) to each well. Incubate at 37°C for 1 hour. Aspirate the liquid from each well and wash 3 times.
[0047] (4) Add 100 μL of HRP-avidin (1×) to each well. Incubate at 37°C for 1 hour.
[0048] (5) Absorb the liquid from each hole and wash 5 times.
[0049] (6) Add 90 μL of TMB substrate to each well. Incubate at 37°C for 15–30 minutes. Avoid light.
[0050] (7) Add 50 μL of stop solution to each well. Read the value at 450 nm within 5 minutes.
[0051] See results Figure 4 ITGA5 is highly expressed in the bone marrow supernatant of HAML patients, higher than that in AML (NHAML) and normal individuals.
[0052] Example 4 Transcriptome Sequencing
[0053] (1) Sample preparation: After preparing white blood cells from HAML patients, NHAML patients, and normal individuals, mix the experimental cells with an enzyme-free pipette tip and transfer them to an enzyme-free 1.5mL centrifuge tube. Set the low-temperature high-speed centrifuge to 13000rpm for 10s. After centrifugation, completely aspirate and discard the supernatant, leaving only the cell pellet.
[0054] (2) Total RNA extraction: RNA was extracted using the kit, with enzyme-free pipette tips and EP tubes used throughout the process. ① Gently loosen the precipitate, use an enzyme-free pipette tip to draw 350 μL of lysis buffer, and add it to the cell pellet. Quickly pipette and mix, and vortex for 30 seconds to ensure complete lysis; ② Add 350 μL of 70% ethanol, pipette and mix again, transfer the mixture to the adsorption column of the kit, and centrifuge at 13000 rpm for 30 seconds. After rapid centrifugation, the lower layer of waste liquid will be visible; discard it directly; ③ Add 700 μL of protein removal solution to the adsorption column, do not centrifuge immediately, but let it stand at room temperature for 30 seconds. After timing, centrifuge at 13000 rpm for 30 seconds using a low-temperature high-speed centrifuge, and pour the lower layer of waste liquid into a waste container; ④ Add 500 μL of washing buffer to the adsorption column for rinsing, centrifuge under the same conditions as before, pour the lower layer of waste liquid into a waste container, repeat the washing once more, centrifuge to discard the waste liquid, and then centrifuge at 13000 rpm for 2 minutes; ⑤ Transfer the upper layer of the adsorption column to a new enzyme-free EP tube, and add an appropriate amount of DEPC water to the adsorption column according to the amount of cell pellet, generally 30-50 μL, trying to avoid low extraction concentration due to too much DEPC water. Place the sample at room temperature, time for 1 minute, and centrifuge at 13000 rpm for 1 minute using a low-temperature high-speed centrifuge to obtain the extracted RNA. Aliquot the extracted RNA and store it in a -80℃ freezer, avoiding repeated freeze-thaw cycles.
[0055] (3) Transcriptome sequencing: The extracted RNA is handed over to a commercial sequencing company to complete the sequencing.
[0056] (4) Analysis of differentially expressed genes: The readcount data were standardized using DESeq2 to obtain the results of differentially expressed genes. The screening criteria were a fold change greater than 2 and a corrected p-value less than 0.05 to obtain differentially expressed genes (DEGs). Volcano plots and heatmaps of differentially expressed genes were generated using R language.
[0057] (5) Differential gene enrichment analysis: Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were performed on differentially expressed genes using the DAVID database. Results are shown below. Figure 5 ITGA5 expression is elevated in different HAML patients.
Claims
1. Application of ATN161 in the preparation of drugs that inhibit the migration and invasion of HAML leukocytes.