Engineered dnazyme molecular machines and applications thereof

Abstract

The application provides an engineered DNAzyme molecular machine and its application, including one or two groups of chain group one and chain group two, chain group one: i-motif chain modified DNAzyme and its substrate chain, the chain group one is modified on the surface of cancer cells and T cells, the acid microenvironment of tumor cells is used to make the modified i-motif chain contract, and the distance between the cancer cells and the tumor cells is shortened; chain group two: mitochondria-targeting peptide modified DNAzyme and its substrate chain, intracellular mitochondrial aggregation is used to induce apoptosis. The tumor microenvironment responsive control of cell behavior outside and inside cells based on DNAzyme includes cell recognition, intercellular proximity, separation after treatment and mitochondrial aggregation, which not only provides a useful way for regulating intercellular interaction, but also provides a powerful targeted cancer treatment method without killing normal cells.

Description

Technical Field

[0001] This invention relates to the fields of in vivo cell imaging and nanomaterials technology, and more particularly to engineered DNAzyme molecular machines for cancer treatment. Background Technology

[0002] Cancer is a leading cause of death worldwide, and many are dedicated to developing better treatments. The situation is particularly dire with aggressive tumors, which proliferate rapidly and promote malignant transformation. A typical strategy to improve treatment outcomes in such cases involves high doses of nonspecific chemotherapy drugs, such as doxorubicin, paclitaxel, and methotrexate. However, the widespread use of these drugs can damage normal cells, leading to severe side effects. To reduce side effects while maintaining the effectiveness of cancer treatment, combination therapy offers a way to combine different single therapies. A typical combination therapy strategy combines immunotherapy with nanoparticles as drug carriers, increasing intracellular drug concentrations through nanoparticle delivery to induce immune killing of cancer cells. However, most reported combination therapies focus on inducing recognition between T cells and cancer cells through the use of large amounts of IgG antibodies, but these macromolecules can interfere with the immune response and hinder drug entry into cancer cells. Therefore, despite progress in this area, designing a simple strategy to dynamically manipulate cell-cell interactions between T cells and cancer cells remains challenging, including cell recognition, cell-cell proximity, and post-treatment separation. Furthermore, for a portion of intracellular therapy, it is important to reduce the side effects of drugs on normal cells.

[0003] The first DNAzyme was reported for RNA cleavage in 1994. Since then, many different types of DNAzymes have been reported, catalyzing RNA / DNA cleavage, ligation, phosphorylation, and other reactions. Because DNAzymes are catalytically active DNA molecules obtained through in vitro selection, those with RNA cleavage sites have attracted considerable attention for therapeutic and diagnostic applications due to their excellent programmability, stability, and activity. Many oligonucleotide-based biopharmaceuticals have been used in gene therapy, such as antisense oligonucleotides, small interfering RNA (SIRRNA), ribozymes, and DNAzymes. Compared to ribozymes, DNAzymes offer advantages such as higher cost-effectiveness, easier synthesis, greater stability, and easier labeling, providing a better option for such applications. To date, DNAzymes have shown potential as therapeutic agents for a variety of diseases, including antiviral, antibacterial, anticancer, anti-inflammatory, and atherosclerotic diseases. DNAzymes were initially used for the in vitro detection of HIV RNA cleavage. DNAzymes have also been designed for therapeutic purposes. Although many promising applications have been reported, FDA-approved DNAzyme-based drugs have not yet entered the market. This indicates some challenges in this field. Compared to other gene silencing technologies, DNAzyme has not yet reached the same stage of development. Summary of the Invention

[0004] The first objective of this invention is to provide a combined therapeutic strategy based on engineered DNAzyme molecular machines that induces cancer cell apoptosis through extracellular control of T cell / cancer cell interactions and intracellular control of mitochondrial aggregation.

[0005] A second objective of this invention is to provide the application of engineered DNAzyme molecular machines in the preparation of antitumor drugs.

[0006] To achieve the above objectives, the present invention provides an engineered DNAzyme molecular machine comprising one or both of strand group one and strand group two.

[0007] Chain Group 1: DNA zyme and its substrate chain modified with i-motif chain. The chain group 1 is modified on the surface of cancer cells and T cells, and the modified i-motif chain is contracted by utilizing the acidic microenvironment of tumor cells, thereby shortening the distance between cancer cells and tumor cells.

[0008] Chain group two: DNAzymes modified with mitochondrial-targeting peptides and their substrate chains, which utilize intracellular mitochondrial aggregation to induce apoptosis.

[0009] As a preferred embodiment, the first strand comprises three DNA strands, wherein strand 1 consists of a long lipid strand, an i-motif strand, and a DNAzyme strand; strand 2 consists of a substrate strand corresponding to the protein aptamer that recognizes high expression of tumor cells and the DNAzyme; and strand 3 consists of a complementary strand of the i-motif and a long lipid strand.

[0010] The connected i-motif chains include one or more, and different distances can be regulated by modifying different numbers of them, enabling T cells to kill tumor cells more efficiently.

[0011] As a preferred embodiment, chains 1 and 2 further include a pH-insensitive fluorescent group, and chain 3 further includes a quencher.

[0012] As a preferred embodiment, the fluorescent group includes one of TAMRA, AF 488, CY3, AF 555, AF 532 or AF546.

[0013] As a preferred embodiment, the long lipid chain includes one of cholesterol, C6 spacer, C12 spacer, or C18 spacer.

[0014] As a preferred embodiment, the aptamer for recognizing the protein highly expressed by tumor cells includes one of the following: MUC1 aptamer, PD-L1 aptamer, or EGFR aptamer.

[0015] As a preferred embodiment, the three DNA strands of the first strand group are as follows:

[0016] Chain 1: Cholesteryl-CCCTAACCCTAACCCTAACCCATAGTTTCTCCGAGCCGGTCGAAACTTCTCTACCTGCAA; (SEQ ID NO. 1)

[0017] Chain 2: GCAGTTGATCCTTTGGATACCCTGGTTGCAGGTAGAGAAGTrAGGAAACTAT; (SEQ IDNO.2)

[0018] Chain 3: GTT AGTGTTAGTGTT AG-Cholesteryl (SEQ ID NO. 3).

[0019] As a preferred embodiment, the second chain comprises two DNA chains, wherein chain 4 consists of a mitochondrial targeting peptide and a DNAzyme chain, and chain 5 consists of the substrate chains corresponding to the mitochondrial targeting peptide and the DNAzyme chain.

[0020] As a preferred embodiment, chains 4 and 5 further include fluorescent groups.

[0021] As a preferred embodiment, the mitochondrial targeting peptide comprises one of R8: NH2-(Arg)8-CONH2 or Fmoc-FFFGKsuccG-COOH.

[0022] As a preferred embodiment, the two DNA strands of the second strand are as follows:

[0023] Chain 4: R8-ATAGTTTCTCCGAGCCGGTCGAAACTTCTCTACCTGCAA; (SEQ ID NO.4)

[0024] Chain 5: R8-TTGCAGGTAGAGAAGTrAGGAAACTAT (SEQ ID NO. 5).

[0025] In this invention, the i-motif chain refers to a special DNA secondary structure, a quadruple helix formed by four cytosine repeat sequences with the participation of protons. This structure can only be maintained in an acidic environment. Under acidic conditions, DNA molecules rich in cytosine bases C, which are complementary to guanine, can be maintained through the hemiprotonation of cytosine C bases (CC). + Base pairs form stable parallel double helices, and the C and D pairs on the two parallel double helices form a stable double helix. + Base pairs can form a quadruple helix structure by alternating arrangement and intercalation. Its sequence is as follows, commonly used ones include 5'-CCCTACACCTACACCTACACCTACACCT-3' (SEQ ID NO. 6) and 5'-TCCCTAACCCTAACCCTAACCCAA-3' (SEQ ID NO. 7) (Hongbo Chen, Hongxia Sun, et al. Chelerythrine as a fluorescent light-up ligand for an i-motif DNA structure, New J. Chem., 2021, 45, 28).

[0026] The complementary strand of an i-motif is a DNA sequence that can form a double strand with the i-motif. Common examples include: 5'-GTTAGT GTT AGT GTT AG-3' (SEQ ID NO.8), or 5'-GGA TTC GCC TTT CGC TTA-3' (SEQ ID NO.9).

[0027] DNAzymes are a class of DNA molecules with catalytic functions. Like proteins and RNA catalytic enzymes, DNAzymes can catalyze various types of biochemical reactions. Commonly used sequences include: 5'-ATA GTT TCT CCG AGC CGG TCG AAACTT CTC TAC CTG CAA-3' (SEQ ID NO.10), or 5'-ACA GAC ATC TCT TCT CCG AGC CGGCTG AAA TAG TGA GT-3' (SEQ ID NO.11).

[0028] DNAzyme substrate strands are DNA sequences that can specifically bind to DNAzyme strands and thus dissociate in the presence of specific metal ions. Commonly used sequences include: 5'-TTG CAG GTA GAG AAG T / rA / G GAA ACT AT-3' (SEQ ID NO.12), or 5'-ACT CAC TAT / rA / GGA AGA GAT GTC TGT-3' (SEQ ID NO.13).

[0029] In this invention, TAMRA, AF 488, CY3, AF 555, AF 532, and AF546 refer to the modified fluorescent groups, all of which are pH insensitive and can be used to characterize DNA strands modified on cell membranes.

[0030] Cholesterol: a derivative of cyclopentanoperhydrophenanthrene, with the chemical formula C64-12 ... 27 H 46 O can insert into the cell membrane through hydrophobic interactions.

[0031] C6 Spacer, C12 Spacer, C18 Spacer: Long lipid chains of different lengths can insert into the cell membrane through hydrophobic interactions.

[0032] MUC1 aptamers, PD-L1 aptamers, and EGFR aptamers refer to MUC1 proteins, PD-L1 proteins, or EGFR proteins that are highly expressed on the surface of cancer cells and can specifically bind to their nucleic acid sequences, as screened using SELEX technology.

[0033] This invention provides the application of the engineered DNAzyme molecular machine in the preparation of antitumor drugs. Tumor cells include all zinc-deficient cells, such as PANC-1, PC12, etc. On the one hand, cell-cell interactions between T cells and cancer cells are particularly attractive to researchers because the specific recognition of cancer cells by T cells is crucial for establishing effective immunotherapies. On the other hand, the dispersion of mitochondria in cancer cells increases their invasiveness, while mitochondrial aggregation facilitates cancer cell death by producing excessive reactive oxygen species (ROS). DNAzymes possess the ability to catalyze the cleavage of ribonucleotides in the presence of specific metal ions. Based on the sensitivity of DNAzymes to metal-dependent cleavage, our previous work used metal ion-specific RNA-cleaving DNAzymes and their respective substrate chains as building blocks to design different control switches to manipulate cellular behavior, including cell-to-cell binding and disaggregation of single cells and multicellular spheroids. Building on this, in this work, we construct molecular machines by using RNA-cleaving DNAzymes modified with different functional tags, thereby allowing specific interactions between cells or mitochondria to obtain more effective cancer combination therapy options.

[0034] This invention induces cancer cell apoptosis through extracellular control of T cell / cancer cell interactions or intracellular control of mitochondrial aggregation, or combines these two extracellular and intracellular regulatory mechanisms to achieve a more effective combination therapy for cancer. For external regulation, a set of DNAzyme molecular machines containing aptamers and i-motif sequences were designed to sense and respond to the acidic tumor microenvironment. Tumor markers are used as target proteins, and the corresponding aptamer sequences can specifically recognize cancer cells. The acidic microenvironment triggers the folding of the i-motif sequences, shortening the intercellular distance to induce killing of cancer cells. Subsequently, T cells can release the i-motif through metal ion-activated DNAzyme cleavage. For internal control, cancer cell apoptosis is further induced through mitochondrial aggregation in cancer cells. DNAzyme molecular machines containing mitochondrial-targeting peptides are introduced into cancer cells to induce mitochondrial aggregation and generate excessive toxic ROS. Using PANC-1 cells as an example, we have demonstrated for the first time that the established combination therapy shows better therapeutic effects in cancer treatment.

[0035] The advantage of this invention is that the tumor microenvironment-responsive control based on DNAzyme, which controls extracellular and intracellular cell behaviors, including cell recognition, intercellular proximity, post-treatment separation, and mitochondrial aggregation, not only provides a useful pathway for regulating intercellular interactions, but also offers a powerful and targeted cancer treatment method without killing normal cells. Attached Figure Description

[0036] Figure 1This diagram illustrates the working principle of achieving dynamic control of T cell / cancer cell interactions and mitochondrial aggregation through tumor combination therapy based on engineered DNAzyme molecular machines.

[0037] Figure 2 (a) External regulation of T cell / cancer cell interactions by a DNAzyme molecular machine constructed from strands 1, 2, and 3. Steps 1-5: recognition of muc1, assembly of T cells and cancer cells, cell-cell approach, increased distance between T cells and cancer cells, and post-treatment separation. (b) Cell images showing the dynamic manipulation of cell-cell interactions between T cells and cancer cells corresponding to steps 1-5 in (a). (c) Control of the distance between T cells and cancer cells by pH regulation. (d) Cell images showing changes in cell-cell distance at different pH values.

[0038] Figure 3 (a)Zn 2+ (a) Specific DNAzyme controls extracellular mitochondrial aggregation and dissociation (Group 1: chain 4 modification, Group 2: chain 5 modification). (b) Cell images showing controlled extracellular mitochondrial interactions of Groups 1 and 2 (1:1). (c) TEM image of extracellular mitochondria. (d) Internal regulation of intracellular mitochondrial interactions by DNAzyme molecular machines (chain 4 and chain 5, liposome delivery). (e) Fluorescent images showing PANC-1 cells treated with liposomes containing chains 4 and 5 for 1 hour, then observed at different time points. (f) Three-dimensional cell images showing assembled mitochondria. (g) TEM image of intracellular mitochondria.

[0039] Figure 4 The goal is to ensure that cell recognition and aggregation can still be achieved even after replacing cholesterol on chains 1 and 3 with long lipid chains of C6 and C12.

[0040] Figure 5 By dividing the imotif chain on chain 1 into 2 to 3 chains, intercellular regulation at different distances can be achieved.

[0041] Figure 6(a) DNAzyme molecular machinery kills combined cancer cells. From (i) to (vi): (i) control, (ii) PANC-1 cells mixed with unmodified T cells, (iii) chain-2 modified PANC-1 cells mixed with chain-1 / chain-3 modified T cells (DNAzyme molecular machinery is used for external control of T cell / cancer cell interaction), (v) PANC-1 cells mixed with liposome-encapsulated chain-4 / chain-5 cells (DNAzyme molecular machinery is used for internal control of mitochondrial aggregation), (v) PANC-1 cells mixed with unmodified T cells and liposome-encapsulated chain-4 / chain-5 cells, (vi) chain-2 modified PANC-1 cells mixed with chain-1 / chain-3 modified T cells and liposome-encapsulated chain-4 / chain-5 cells (combined treatment). (b) Fluorescence images of apoptosis, showing PANC-1 cells treated with different methods for 1 h, corresponding to foreign bodies (i) in (a) and (vi). (c) Channel intensities. (d) Histogram comparing fluorescence intensities. (e) Illustration showing the combined treatment process. Detailed Implementation

[0042] The present invention will be further illustrated below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0043] Example 1. External Regulation of Cell-Cell Interactions Between T Cells and Cancer Cells

[0044] DNA strand sequence used:

[0045] Chain 1: Cholesteryl-CCCTAACCCTAACCCTAACCCATAGTTTCTCCGAGCCGGTCGAAACTTCTCTACCTGCAA-AF 488;

[0046] Chain 2: GCAGTTGATCCTTTGGATACCCTGGTTGCAGGTAGAGAAGTrAGGAAACTAT-TAMRA;

[0047] Chain 3: BHQ2-GTT AGTGTTAGTGTT AG-Cholesteryl.

[0048] (1) We annealed chain 1 / chain 3 by heating it at 94°C for 5 minutes and then allowing it to cool naturally to room temperature to form a double chain. The double chain formed by chain 1 / chain 3 was then inserted into the surface of the T cell membrane by the hydrophobic effect of the terminal cholesterol. The aptamer of MUC1 in chain 2 can bind to the overexpressed MUC1 on the surface of cancer cells. Then, T cell / cancer cell assembly was achieved through hybridization between chains 1, 2 and 3.

[0049] like Figure 2 As shown in Figure a, the DNAzyme molecular machine constructed from strands 1, 2, and 3 is applied to the external regulation of T cell / cancer cell interactions through the following five steps: 1. Strand 2 recognizes MUC-1 on the surface of cancer cells; 2. T cell and cancer cell assembly; 3. Cell-cell approach under acidic pH; 4. Increased distance between T cells and cancer cells under neutral pH; 5. Through Zn 2+ Activated lysis leads to intercellular breakdown. Cell microscopic images confirm the dynamic manipulation of cell-cell interactions between T cells and cancer cells corresponding to the five steps described above. Figure 2 b). Cell-to-cell assembly can be achieved immediately after cell-to-cell assembly. Following cell-to-cell assembly, TAMRA fluorescence is quenched by BHQ2 ( Figure 2 b, Step 2). When we lowered the solution pH to 6.0, the TAMRA fluorescence clearly recovered because the acidic pH induced chain-1 folding, causing BHQ2 to leave the 5' end of chain-3 ( Figure 2 b, Step 3). After adjusting the pH back to neutral, the TAMRA fluorescence extinguished again due to the restoration of the chain-1 structure. Figure 2 b, step 4). Next, with Zn 2+ The addition of this component causes substrate chain 2 to be cleaved from its ribonucleotide cleavage site, resulting in immediate cell disintegration. Figure 2 b, Step 5).

[0050] (2) Based on achieving intercellular aggregation, reversible distance control between T cells and cancer cells can be achieved by adjusting the pH value. Figure 2 c). For example Figure 2 As shown in Figure d, the fluorescence of TAMRA on the cancer cell membrane was quenched at a weakly alkaline pH (pH = 7.5). When the pH was adjusted to acidic (pH = 6), TAMRA gradually regained fluorescence. After the pH was gradually adjusted back to weakly alkaline, the fluorescence intensity decreased again. These results indicate that the distance between the coupled T cells and cancer cells can be reversibly and precisely regulated by pH control. In summary, the above results confirm the feasibility of external regulation based on our designed T cell / cancer cell interaction.

[0051] Example 2. Internal Regulation of Mitochondrial Aggregation

[0052] DNA strand sequence used: R8-targeting mitochondrial peptide

[0053] Chain 4: R8-ATAGTTTCTCCGAGCCGGTCGAAACTTCTCTACCTGCAA-TAMRA;

[0054] Chain 5: R8-TTGCAGGTAGAGAAGTrAGGAAACTAT-AF 488.

[0055] R8: NH2-(Arg)8-CONH2

[0056] (1) First, conduct research on extracellular mitochondrial interactions. For example... Figure 3 As shown in figure a, mitochondria extracted from living cells were divided into two groups, the surfaces of which were respectively coated with chain 4 (Zn labeled with AF 488). 2+ The specific DNA enzyme and strand 5 (the substrate strand labeled with TAMRA) are linked. When these two sets of mitochondria mix, mitochondrial aggregates can form. For example... Figure 3 As shown in b, mitochondrial assembly can be clearly observed under a confocal microscope. (Adding Zn) 2+ Following ionization, substrate chain 5 was cleaved, breaking down immediately within 30 minutes. TEM images also confirmed these results. Figure 3 c).

[0057] (2) Subsequently, intracellular mitochondrial interactions were tested in living cells. Chains 4 and 5 were encapsulated in liposomes and then incubated with PANC-1 cells for intracellular delivery. Figure 3 As shown in Figure e, when PANC-1 cells were treated with chain 4 (2 μL, 100 μM) for 1 hour, followed by chain 5 (2 μL, 100 μM) for 1 hour, extensive mitochondrial aggregation was observed. With the addition of Zn... 2+ Following ionization, mitochondrial disconnection could be clearly observed after 30 minutes under red and green fluorescence channels. 3D cell images ( Figure 3 f) and TEM images ( Figure 3 g) This further confirmed the intracellular mitochondrial aggregation under treatment with chains 4 and 5. These results indicate that the degree of mitochondrial aggregation is related to intracellular zinc concentration, as mitochondrial aggregation is more likely to occur in zinc-deficient cancer cells, which is beneficial for precise cancer treatment.

[0058] Example 3. Cell Interactions under Different Chain Compositions

[0059] (1) In Figure 3 In step a, cholesterol at one end of chain 1 and chain 3 was replaced with a C6 spacer. Figure 3 In step b, the cholesterol at one end of chain 1 and chain 3 was replaced with a C12 spacer.

[0060] (2) Finally, following the steps described in Example 1, the DNAzyme molecular machine constructed from chain 1, chain 2 and chain 3 is applied to the external regulation of T cell / cancer cell interactions.

[0061] (3) In Figure 4 In line 'a', the imotif on chain 1 is modified into two, and two complementary chains are also modified on chain 3. Figure 4 In b, the imotif on chain 1 is modified to have 3, and chain 3 is also modified to have 3 complementary chains.

[0062] (4) Finally, following the steps described in Example 1, the DNAzyme molecular machine constructed from chain 1, chain 2 and chain 3 is applied to the external regulation of T cell / cancer cell interactions.

[0063] Example 4. DNA-zyme molecular machines that jointly kill cancer cells

[0064] (1) Finally, a combination therapy trial was conducted in zinc-deficient PANC-1 cells. For example... Figure 6 As shown in a, Annexin-V-FITC / PI staining was performed on surviving tumor cells to detect the killing effect of the following different treatment conditions on tumor cells: (i) control group: untreated PANC-1 cells, (ii) PANC-1 cells mixed with unmodified t cells, (iii) chain-2 modified PANC-1 cells mixed with chain-1 / chain-3 modified t cells (this DNAzyme molecular machine is used for external control of t cell / cancer cell interaction), (v) PANC-1 cells mixed with liposome-encapsulated chain-4 / chain-5 cells (this DNAzyme molecular machine is used for internal control of mitochondrial aggregation), (v) PANC-1 cells mixed with unmodified t cells and liposome-encapsulated chain-4 / chain-5 cells, (vi) chain-2 modified PANC-1 cells mixed with chain-1 / chain-3 modified t cells and liposome-encapsulated chain-4 / chain-5 cells (combined treatment).

[0065] (2) Subsequently, Annexin-V-FITC / PI staining was used to detect the degree of tumor cell apoptosis. Figure 6 b). Microscopic images show that the fluorescence intensity of apoptosis is highest under the combined regulation of the DNAzyme molecular machinery, both internally and externally. Figure 6 The corresponding fluorescence intensity in cd further confirms the above results. Figure 6 e presents a model illustrating the experimental principle, revealing the trend of mutual regulation between internal and external combined therapy. These results indicate that the established combined therapy has an enhanced synergistic effect in killing tumor cells.

[0066] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> East China University of Science and Technology <120> Engineered DNAzyme molecular machines and their applications <130> / <160> 13 <170> SIPOSequenceListing 1.0 <210> 1 <211> 60 <212> DNA <213> Artificial Sequence <400> 1 ccctaaccct aaccctaacc catagtttct ccgagccggt cgaaacttct ctacctgcaa 60 <210> 2 <211> 52 <212> DNA <213> Artificial Sequence <400> 2 gcagttgatc ctttggatac cctggttgca ggtagagaag traggaaact at 52 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <400> 3 gttagtgtta gtgttag 17 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <400> 4 atagtttctc cgagccggtc gaaacttctc tacctgcaa 39 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <400> 5 ttgcaggtag agaagtragg aaactat 27 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 ccctaaccct aaccctaacc c 21 <210> 7 <211> twenty four <212> DNA <213> Artificial Sequence <400> 7 tccctaaccc taaccctaac ccaa 24 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <400> 8 gttagtgtta gtgttag 17 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 ggattcgcct ttcgctta 18 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <400> 10 atagtttctc cgagccggtc gaaacttctc tacctgcaa 39 <210> 11 <211> 38 <212> DNA <213> Artificial Sequence <400> 11 acagacatct cttctccgag ccggctgaaa tagtgagt 38 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <400> 12 ttgcaggtag agaagtragg aaactat 27 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <400> 13 actcactatr aggaagagat gtctgt 26

Claims

1. An engineered DNAzyme molecular machine, characterized in that, Includes one or both of chain groups one and chain group two. Chain Group 1: DNA zyme and its substrate chain modified with i-motif chain. The chain group 1 is modified on the surface of cancer cells and T cells, and the modified i-motif chain is contracted by utilizing the acidic microenvironment of tumor cells, thereby shortening the distance between cancer cells and tumor cells. The first set of chains includes three DNA chains, wherein chain 1 is composed of a long lipid chain, an i-motif chain and a DNAzyme chain in sequence, chain 2 is composed of a substrate chain corresponding to the protein aptamer that recognizes the high expression of tumor cells and the DNAzyme, and chain 3 is composed of the complementary chain of the i-motif and the long lipid chain. Chain group 2: DNAzyme modified with mitochondrial-targeting peptides and its substrate chain, which induces apoptosis by utilizing intracellular mitochondrial aggregation; The second set of chains includes two DNA chains, wherein chain 4 consists of a mitochondrial targeting peptide and a DNAzyme chain, and chain 5 consists of the substrate chains corresponding to the mitochondrial targeting peptide and the DNAzyme chain.

2. The engineered DNAzyme molecular machine according to claim 1, characterized in that, Chain 1 and chain 2 also include a pH-insensitive fluorescent group, and chain 3 also includes a quencher.

3. The engineered DNAzyme molecular machine according to claim 2, characterized in that, The fluorescent group includes one of TAMRA, AF 488, CY3, AF 555, AF 532 or AF546.

4. The engineered DNAzyme molecular machine according to claim 1, characterized in that, The long fatty acid chain includes one of cholesterol, C6 spacer, C12 spacer, or C18 spacer.

5. The engineered DNAzyme molecular machine according to claim 1, characterized in that, The aptamers that recognize proteins highly expressed in tumor cells include one of the following: MUC1 aptamer, PD-L1 aptamer, or EGFR aptamer.

6. The engineered DNAzyme molecular machine according to claim 1, characterized in that, The three DNA strands of the first strand are as follows: Chain 1: Cholesteryl-CCCTAACCCTAACCCTAACCCATAGTTTCTCCGAGCCGGTCGAAACTTCTCTACCTGCAA; Chain 2: GCAGTTGATCCTTTGGATACCCTGGTTGCAGGTAGAGAAGTrAGGAAACTAT; Chain 3: GTT AGTGTTAGTGTT AG-Cholesteryl.

7. The engineered DNAzyme molecular machine according to claim 1, characterized in that, Chains 4 and 5 also include fluorescent groups.

8. The engineered DNAzyme molecular machine according to claim 1, characterized in that, The mitochondrial targeting peptide includes one of R8: NH2-(Arg)8-CONH2 or Fmoc-FFFGKsuccG-COOH.

9. The engineered DNAzyme molecular machine according to claim 1, characterized in that, The two DNA strands of the second strand are as follows: Chain 4: R8-ATAGTTTCTCCGAGCCGGTCGAAACTTCTCTACCTGCAA; Chain 5: R8-TTGCAGGTAGAGAAGTrAGGAAACTAT.

10. The use of the engineered DNAzyme molecular machine according to any one of claims 1-9 in the preparation of antitumor drugs.

Images