Application of MRPS21 Gene and Its RNAi Interference System
By using the MRPS21 gene and its RNAi lentiviral interference system, knockdown of the MRPS21 gene and protein in liver cancer cells, the problem of proliferation, migration and invasion of liver cancer cells was solved, and effective treatment of liver cancer was achieved.
Patent Information
- Application Number
- CN202310213995.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-07
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2043-03-07
AI Technical Summary
The prior art is difficult to effectively solve the treatment of liver cancer, especially in inhibiting the proliferation, migration and invasion of liver cancer cells.
By utilizing the MRPS21 gene and its RNAi lentiviral interference system, drugs for the treatment of liver cancer are prepared, specifically including the design and use of MRPS21-shRNA sequences to knock down or inhibit the expression of the MRPS21 gene and protein in liver cancer cells.
This method can effectively inhibit the proliferation, migration and invasion of liver cancer cells, and provides a new targeted treatment strategy for liver cancer, which is simple to operate and efficient.
Smart Images

Figure CN116500266B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedicine, and more specifically, relates to the application of the MRPS21 gene (Gene ID: 54460, Protein ID: P82921) and its RNAi interference system in the preparation of drugs for treating liver cancer. Background Art
[0002] Hepatocellular carcinoma (HCC) is one of the common malignant tumors globally, with nearly 1 million patients annually, ranking fifth among all malignant tumors. China is a hard-hit area for liver cancer incidence, with approximately 550,000 new patients each year, accounting for about 55% of the global total. Currently, with the introduction of new treatment methods, the treatment effect of liver cancer has been partially improved, but the survival status of current liver cancer patients remains not optimistic. The number of patients who die from liver cancer annually ranks third among all tumors, and the five-year survival rate of advanced liver cancer is less than 10%. With the application of high-throughput technologies such as second-generation and third-generation sequencing, single-cell sequencing, proteomics, and metabolomics, finding tumor differential genes or proteins related to clinical significance has become a common method in the forefront of clinical scientific research. Although there are already a large number of research results on the mechanisms of liver cancer occurrence and development, as well as prognosis, including bioinformatics databases mainly based on transcriptome data, there is an urgent clinical need for protein markers that are convenient for diagnosis and treatment.
[0003] Mitochondrial ribosomal protein S21 (MRPS21) is a mitochondrial ribosomal protein (MRPs) encoded by nuclear genes and is considered a regulator of mitochondrial mRNA translation. The mitochondrial ribosome consists of a 28S small subunit and a 39S large subunit, which is responsible for the translation of 13 proteins on the mitochondrial electron transport chain and is closely related to cell energy metabolism. MRPs are crucial components of the mitochondrial ribosome, and some MRPs play functional roles in the process of tumorigenesis. Since mitochondria are similar to bacterial ribosomes, targeting mitochondrial ribosomes with antibiotics such as azithromycin and doxycycline has shown an inhibitory effect on tumor sphere formation in various cancers, suggesting that targeting mitochondrial ribosomes may be a new method against specific tumors. Recent studies have shown that the abnormal expression of MRPs is closely related to the progression of various diseases including malignant tumors, and it is necessary to find MRPs related to tumors and their mechanisms of action. According to the existing literature, there is no clear report on the relationship between the expression of MRPS21 in liver cancer, its biological function, and clinicopathological parameters. Summary of the Invention
[0004] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide the application of the MRPS21 gene and its RNAi lentiviral interference system for preparing a drug for treating liver cancer.
[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:
[0006] Application of the MRPS21 gene in preparing a drug for treating liver cancer.
[0007] Furthermore, the treatment of liver cancer is to inhibit cell proliferation.
[0008] Furthermore, the treatment of liver cancer is to inhibit cell migration.
[0009] Furthermore, the treatment of liver cancer is to inhibit cell invasion.
[0010] The biomarker for detecting the expression level of MRPS21 protein in the peripheral blood or cancer tissue of a patient is the MRPS21 gene.
[0011] The kit for detecting the expression level of MRPS21 protein in the peripheral blood or cancer tissue of a patient contains the MRPS21 gene.
[0012] Application of the RNAi lentiviral interference system of the MRPS21 gene in preparing a drug for treating liver cancer, and the sequence of the RNAi lentiviral interference system of the MRPS21 gene is as follows:
[0013] MRPS21-shRNA1: GATCAACTTCTTGATGCGAAA,
[0014] MRPS21-shRNA2: GAACGTGGAAAGCGCATACAG.
[0015] Furthermore, the RNAi lentiviral interference system of the MRPS21 gene is to knockdown the MRPS21 gene in liver cancer cells.
[0016] Furthermore, the RNAi lentiviral interference system of the MRPS21 gene is to inhibit the expression of MRPS21 protein in liver cancer cells.
[0017] Compared with the prior art, the beneficial effects of the present invention are:
[0018] 1) The RNAi lentiviral interference of the present invention can efficiently knockdown the MRPS21 gene / protein in liver cancer cells, inhibit the proliferation, invasion and migration of liver cancer cells, and this system is simple to operate and has high efficiency.
[0019] 2) The MRPS21 gene / protein is a target for precision therapy. Kits for diagnosing or predicting the prognosis of high-expression MRPS21 gene / protein in liver cancer and the like are prepared, and are also used for preparing targeted drugs. Description of the Drawings
[0020] Figure 1 It is a figure showing the protein expression results of immunohistochemical detection of MRPS21 in liver cancer and adjacent tissues (A is the immunohistochemical staining figure of MRPS21 in liver cancer tissues; B is the immunohistochemical staining figure of MRPS21 in adjacent tissues);
[0021] Figure 2 It is a figure showing the relationship between high and low expression of MRPS21 and the prognosis of liver cancer patients;
[0022] Figure 3 It is a figure showing the expression of MRPS21 detected by Western Blot in LO2 cells, HepG2 cells, Hep3B cells, SNU-182 cells, and SK-Hep-1 cells;
[0023] Figure 4 It is a figure showing the expression of MRPS21 in HepG2 cells and SK-Hep-1 cells after knocking down and overexpressing the gene;
[0024] Figure 5 It is a figure of the lentiviral knockdown vector plasmid (A) and the lentiviral overexpression vector plasmid (B);
[0025] Figure 6 It is a figure showing the expression of MRPS21 in Hep3B cells and SNU-182 cells after knocking down and overexpressing the gene;
[0026] Figure 7 It is a figure of the proliferation viability of HepG2 cells after knocking down MRPS21 and the proliferation viability of Hep3B cells after overexpressing MRPS21;
[0027] Figure 8 It is a figure of the migration ability of HepG2 cells and SK-Hep-1 cells after knocking down MRPS21 and the migration ability of Hep3B cells and SNU-182 cells after overexpressing MRPS21;
[0028] Figure 9 It is a figure of the invasion ability of HepG2 cells and SK-Hep-1 cells after knocking down MRPS21 and the invasion ability of Hep3B cells and SNU-182 cells after overexpressing MRPS21. Detailed Implementation Modes
[0029] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are all conventional means well-known to those skilled in the art.
[0030] The main reagents and consumables used in the following embodiments:
[0031] Immunohistochemistry kit: Fuzhou Maixin Biotechnology Development Company.
[0032] Rabbit anti-human MRPS21 antibody: orb315617, biorbyt, UK.
[0033] Pre-stained protein Marker: Thermo, USA.
[0034] SDS-PAGE gel preparation kit: Beyotime Biotechnology Co., Ltd.
[0035] Hepatocellular carcinoma cell lines (HEPG2, HEP3B, SNU-182 and SK-HEP-1) and human normal hepatocyte cell line (LO2): Nanjing Kebai Biotechnology Co., Ltd.
[0036] 1640 medium, MEM medium and fetal bovine serum: gibco, USA.
[0037] PVDP membrane (for Western blot test): Millipore, USA.
[0038] ECL developing solution: Suzhou Xinsaimi Company.
[0039] Cell cryopreservation solution: Suzhou Xinsaimi Company.
[0040] CellCounting Kit-8 (CCK8) detection kit: Dalian Meilun Biotechnology Co., Ltd.
[0041] Transwell chamber: Coming, USA.
[0042] The main instruments used in the following embodiments are as follows:
[0043] Tissue microarray maker: Beecher Instruments, USA.
[0044] Inverted phase contrast microscope: Olympus, Japan.
[0045] Gel imaging system: Tianneng, China.
[0046] Multifunctional microplate reader: Thermo, USA.
[0047] Multispectral Pathology Scanning System: Perkin Elmer, USA.
[0048] Example 1
[0049] 1. Paraffin tissue microarray of liver cancer from the biobank of the Affiliated Hospital of Nantong University (surgically treated between 2004 and 2009, patients did not receive immunotherapy, chemotherapy or radiotherapy before surgery, and clinical case data are detailed and complete), including 128 cases of liver cancer tissue and 110 cases of adjacent tissue.
[0050] 2. Immunohistochemical staining
[0051] Place the tissue microarray on a baking instrument and bake at 70 °C for 1 h, then bake at 60 °C for 1 h; Immerse the dried tissue microarray in xylene for 5 min; After taking it out, perform gradient alcohol dehydration, 100% ethanol for 5 min, 95% ethanol for 5 min, 75% ethanol for 5 min, and rinse the tissue microarray with distilled water; Place the tissue microarray on a high-temperature section rack and place it in a citrate repair solution with a pH of 6.0 for high-temperature antigen repair: heat at 100% power for 2.5 min, then heat at 20% power for 15 min; After naturally cooling to room temperature, take out the microarray in distilled water, rinse it 3 times with PBS, 2 min each time, draw a rough tissue range on the tissue microarray with an immunohistochemistry pen, then drop 3% H2O2 inside the circle, incubate for 20 min, and then wash 3 times with PBS, 5 min each time; Drop the primary antibody (mouse anti-human MRPS21 antibody) and incubate at 4 °C overnight; The next day, warm it up at room temperature for 30 min, remove the primary antibody, rinse 3 times with PBS, 5 min each time, drop the polymer enhancer and incubate at room temperature for 20 min; Then wash 3 times with PBS, 5 min each time; Drop the secondary antibody (enzyme-labeled anti-mouse / rabbit IgG polymer) and incubate at room temperature for 30 min, then wash 3 times with PBS, 5 min each time; Drop the freshly prepared DAB reagent, and after color development, rinse the microarray under running water for 5 min to terminate color development; Place the microarray in hematoxylin for staining for 30 s, then put it into hydrochloric acid alcohol to terminate staining, and finally rinse with running water for 10 min; n; Immerse the microarray in 75% ethanol, 95% ethanol, 100% ethanol, and xylene for 5 min each, and air dry it naturally in a fume hood; Finally, seal the section with neutral gum.
[0052] First, the staining was quantified by quantitative software (Vectra 3.0), and then all scoring data and atlases were verified and corrected by pathologists. The staining intensity was divided into 0 (no staining), 1 (weak staining), 2 (moderate staining), and 3 (strong staining). The product of the staining intensity and the percentage of cells with that intensity (0% - 100%) was the final score (0 - 300). Subsequently, the X-tile software was used to convert the protein expression-related data into dichotomous data (low and high) through specific cut-off thresholds. 0 - 92 was low expression or no expression, and 93 - 300 was high expression. All data were processed using the statistical software SPSS V.22.0. The chi-square test was used for inter-group comparison, and the Cox proportional hazards regression analysis was used to analyze the prognostic factors of patients; the Kaplan-Meier method and log-rank test were used for univariate analysis of patient prognosis. All test results with P < 0.05 were considered statistically significant.
[0053] The results were as Figure 1-2 shown. The expression of MRPS21 protein in liver cancer tissues was higher than that in adjacent tissues, and patients with high expression of MRPS21 had a shorter survival period and a poor prognosis.
[0054] Example 2
[0055] 1. Culture of liver cancer cell lines
[0056] Liver cancer cell lines: HepG2 cells, Hep3B cells, and SK-Hep-1 cells were cultured in MEM complete medium; SNU-182 cells were cultured in RPMI-1640 complete medium, and human normal liver cells LO2 cells were cultured in RPMI-1640 complete medium. The temperature was maintained at 37°C, 5% CO2, and relative saturated humidity (95%) in the incubator. Conventional subculture was performed, and the medium was changed every 1 - 2 days. Cells in the logarithmic growth phase were selected for experiments.
[0057] 2. Extraction of total cellular protein
[0058] Various liver cancer cells were cultured in an incubator at 37°C, maintaining a CO2 concentration of 5% and a saturated humidity of 95%. They were cultured in complete medium, and the medium was changed every 1 - 2 days and passaged according to the corresponding density; liver cancer cells were collected, the medium was discarded, and the cells were washed 2 times with pre-cooled PBS; according to the size of the cell culture flask and the growth density of the cells, different volumes of cell lysis buffer were added, and then the cells were scraped clean with a cell scraper and transferred to a clean EP tube; the scraped cell protein was fully lysed on ice for 30 min; centrifuged at 4°C to obtain the supernatant, the concentration of cell protein was measured using an ultraviolet spectrophotometer, and then loading buffer was added and mixed well by pipetting. It was boiled at 95°C for 10 min and stored in a -80°C refrigerator for later use.
[0059] 3. Protein immunoblotting assay (Western blot)
[0060] Prepare polyacrylamide gels (5% stacking gel, 12% separating gel); after loading protein Marker and the extracted protein samples, adjust the running voltage to 100V, and after completion, take out the gel for membrane transfer (PVDF membrane); perform electrotransfer at a constant current of 300 mA for 0.5 h, and the membrane transfer should be carried out in an ice box; after the membrane transfer is completed, put the PVDF membrane into the blocking solution and block it at room temperature for 2 h; dilute the antibody with the primary antibody dilution solution, evenly drip the diluted primary antibody on the PVDF membrane, and incubate it overnight at 4 °C; after washing the membrane, prepare the secondary antibody dilution solution with TBST, evenly drip the diluted secondary antibody on the PVDF membrane, and incubate it at room temperature for 2 h; after washing the membrane again, lay the PVDF membrane flat at the corresponding position of the imaging instrument, evenly drip the ECL luminescent solution on the PVDF membrane, and take a picture and save it with a gel imaging system.
[0061] The results are as Figure 3 shown, MRPS21 is relatively highly expressed in HepG2 and SK-Hep-1 liver cancer cells, and relatively lowly expressed in Hep3B and SNU-182 liver cancer cells.
[0062] 4. Screen positive gene knockout clones
[0063] 1) For the MRPS21 gene sequence, the gene sequence of the RNAi lentiviral interference system specifically targeting the MRPS21 gene is as follows, and construct a lentivirus-mediated RNAi interference system.
[0064] MRPS21-shRNA1: GATCAACTTCTTGATGCGAAA,
[0065] MRPS21-shRNA2: GAACGTGGAAAGCGCATACAG.
[0066] 2) Select an appropriate virus infection concentration, perform lentivirus infection on the target cells, and add a co-infection reagent; after 12 - 16 h of infection, change the medium and continue culturing, and at the same time observe whether there are any abnormalities in the cell state; after 72 - 96 h of infection, observe the fluorescence under an inverted fluorescence microscope, and perform drug screening on the infected cells to collect more successfully infected cells.
[0067] 3) Preparation and growth of monoclonal cells: Dilute the cells by the limiting dilution method into 10 96-well plates; observe the growth of monoclonal cells after one week, and transfer the grown monoclonal cells to 48-well plates for expansion culture after about two weeks; sequentially transfer the grown monoclonal cells to 24-well plates and 12-well plates for expansion culture; when each monoclonal cell is expanded to 2 12-well plates, take out the cells from one well, lyse them to extract proteins, and use Western blot to detect the monoclonal strains with gene knockdown.
[0068] The results are as Figure 4As shown, compared with the control group, the relative protein expression level of MRPS21 in cells treated with the RNAi lentiviral interference system was significantly decreased, indicating that the protein expression of MRPS21 in HepG2 cells and SK-Hep-1 cells was effectively inhibited.
[0069] 5. Construction of overexpression system and screening of stable strains
[0070] 1) Amplify the open reading frame region of MRPS21 mRNA using forward and reverse primers, and use gene recombination technology to recombine the MRPS21 expression fragment into the pCDH-CMV-MCS-EF1-EGFP-2A-puro vector ( Figure 5 ).
[0071] 2) After packaging into virus, select an appropriate virus infection concentration for lentiviral infection of target cells, and add a co-infection reagent; after 12 - 16 h of infection, change the medium and continue culturing; after 72 - 96 h of infection, observe the fluorescence under an inverted fluorescence microscope, and perform drug screening on the infected cells to collect more successfully infected cells.
[0072] 3) Preparation and growth of monoclonal cells: Dilute the cells by the limited dilution method into 10 96-well plates; observe the growth of monoclonal cells after one week, and transfer the grown monoclonal cells to 48-well plates for expansion culture after about two weeks; sequentially transfer the grown monoclonal cells to 24-well plates and 12-well plates for expansion culture. When each monoclonal cell expands to 2 12-well plates, take out the cells from one well, lyse them to extract proteins, and use Western blot to detect the monoclonal strains with overexpressed MRPS21.
[0073] The results are as Figure 6 shown. Compared with the control group, the relative protein expression level of MRPS21 in cells after overexpression treatment was significantly increased, indicating that the protein expression of MRPS21 in Hep3B cells and SNU-182 cells was effectively upregulated.
[0074] 6. Cell proliferation experiment (CCK-8 assay)
[0075] Digest and collect the cells of each group 96 h after transfection, centrifuge and set aside; resuspend the cells with complete medium, adjust the cell density to 20,000 cells / mL; add 100 μL of cell suspension to each well, set 5 replicates for each group, gently tap the 96-well plate to make the cells evenly distributed; after the cells adhere to the wall (about 6 - 8 h), add CCK-8 reagent (10 μL per well) at 0, 24, 48, 72, and 96 h respectively, gently tap the 96-well plate, take it out after 2 h in the incubator, and detect the absorbance value at 450 nm on an enzyme-linked immunosorbent assay (ELISA) reader, paying attention to the linear range of the ELISA reader; statistically process the measured data using Graphpad prism and draw a line graph.
[0076] The results are as follows Figure 7 shown. After knocking down MRPS21 by the RNAi lentiviral interference system, the proliferation activity of HepG2 cells decreased, while the proliferation activity of Hep3B cells significantly increased after overexpressing MRPS21.
[0077] 7. Cell migration experiment (Transwell chamber method)
[0078] Digest and collect the cells of each group with stable transfection, centrifuge and set aside; resuspend the cells with basal medium and adjust the cell density to 4×10 5 / mL; add 800 μL of complete medium to a 24-well plate, place the chamber, soak it thoroughly, take 100 μL of the cell suspension and add it to the upper chamber of the Transwell chamber; after culturing routinely for 24 - 48 h, take it out, wash it twice with 1×PBS, fix it with 4% paraformaldehyde for 20 min, and wash it twice with 1×PBS; add 500 μL of crystal violet staining solution to the 24-well plate, place the chamber, take it out after 10 min, wash it twice with 1×PBS, invert the chamber, gently wipe off the cells that did not pass through the upper chamber with a cotton swab, and observe the results with an inverted microscope.
[0079] The results are as follows Figure 8 shown. After knocking down MRPS21 by the RNAi lentiviral interference system, the migration abilities of HepG2 cells and SK-Hep-1 cells decreased, while the migration abilities of Hep3B cells and SNU-182 cells increased after overexpressing MRPS21.
[0080] 7. Cell invasion experiment (Transwell chamber method)
[0081] (1) First, prepare the hydrogel (mix 50 μL of hydrogel in 350 μL of diluent, and then add 50 μL of basal medium), add it to the upper chamber of the Transwell chamber, 100 μL for each, avoiding air bubbles; (2) Digest and collect the cells of each group 48 h after transfection, centrifuge and set aside; (3) Resuspend the cells with basal medium and adjust the cell density to 8×10 5 / mL; (4) Add 800 μL of complete medium to a 24-well plate, place the chamber, soak it thoroughly, take 100 μL of the cell suspension and add it to the upper chamber of the Transwell chamber; (5) After culturing routinely for 24 - 48 h, take it out, wash it twice with 1×PBS, fix it with 4% paraformaldehyde for 20 min, and wash it twice with 1×PBS; (6) Add 500 μL of crystal violet staining solution to the 24-well plate, place the chamber, take it out after 10 min, wash it twice with 1×PBS, invert the chamber, gently wipe off the cells that did not pass through the upper chamber with a cotton swab, and observe the results with an inverted microscope.
[0082] The results are as follows Figure 9As shown, after knocking down MRPS21 by the RNAi lentiviral interference system, the invasion ability of HepG2 cells and SK-Hep-1 cells decreased, while after overexpressing MRPS21, the invasion ability of Hep3B cells and SNU-182 cells increased.
Claims
1. Use of an RNAi lentiviral interference system for the MRPS21 gene in the preparation of a medicament for treating liver cancer, characterized in that, The sequences of the RNAi lentiviral interference system for the MRPS21 gene are as follows: MRPS21-shRNA1: GATCAACTTCTTGATGCGAAA, MRPS21-shRNA2: GAACGTGGAAAGCGCATACAG.
2. The use according to claim 1, characterized in that, The RNAi lentiviral interference system for the MRPS21 gene is to knockdown the MRPS21 gene in liver cancer cells.
3. The use according to claim 1, characterized in that, The RNAi lentiviral interference system for the MRPS21 gene is to inhibit the expression of MRPS21 protein in liver cancer cells.
Citation Information
Patent Citations
Methods for the identification, assessment, and treatment of patients with cancer therapy
US20060281122A1