Method for inducing expression of a target protein gene based on juvenile hormone and application thereof

By identifying Cad96Ca and FGFR1 as juvenile hormone cell membrane receptors from cotton bollworm, constructing a recombinant expression vector, and applying juvenile hormone to host cells, a controllable switch for protein expression in human and mammalian cells was achieved. This solves the shortcomings of existing technologies in inducing protein expression with juvenile hormone and has applications in disease treatment and novel functions of organisms.

CN116514955BActive Publication Date: 2026-07-03SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310279757.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-21
Publication Date
2026-07-03
Estimated Expiration
2043-03-21

AI Technical Summary

Technical Problem

The lack of effective juvenile hormone cell membrane receptors in existing technologies makes it impossible to induce the expression of target proteins in human cells through juvenile hormone. Furthermore, existing gene expression technologies suffer from insufficient inducers and induction strategies, making it impossible to achieve a controllable switch for protein expression.

Method used

Cad96Ca and FGFR1 were identified as cell membrane receptors for juvenile hormone in cotton bollworm. Recombinant expression vectors were constructed and these receptors were expressed in host cells. The expression of the target protein was induced by the application of juvenile hormone, thus achieving a controllable switch.

Benefits of technology

It enables controllable protein expression in human and mammalian cells, reduces the side effects of protein expression on organisms, and has application value in disease treatment, enhancing immunity, and new functions of organisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116514955B_ABST
    Figure CN116514955B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biotechnology, and particularly relates to a method for inducing expression of a target protein gene based on juvenile hormone and application thereof. The present application provides a method for inducing expression of a target protein gene based on juvenile hormone on the basis of long-term research on juvenile hormone regulating expression of an insect gene. The method induces protein expression by juvenile hormone, realizes controllable switch of protein expression, and reduces side effects of protein expression on organisms. The method is harmless to human and mammals, safe to other organisms and environment, and can be used for disease treatment, immunity enhancement, and new function of organisms. The method has good practical application value in disease treatment, disease resistance of animals and plants, and new function of organisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for inducing the expression of a target protein gene based on juvenile hormone and its application. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] The functions of an organism are regulated by various proteins, which in turn are the result of gene transcription being regulated by various internal and external factors. Abnormal gene transcription leads to abnormal protein expression, thereby causing disease. Conversely, if the expression of a certain endogenous or exogenous gene is induced in an organism, increasing the endogenous or exogenous protein in the organism, the organism's function can be altered. This includes supplementing insufficiently expressed endogenous proteins to treat diseases, or increasing exogenous proteins that were not originally present in the organism to endow the organism with new functions, ultimately achieving the goals of treating diseases, enhancing immunity, and adding new functions to the organism.

[0004] However, gene expression and the proteins produced by the translation of these genes have certain side effects on organisms. Protein expression cannot be sustained indefinitely; therefore, it is necessary to induce real-time switching of gene expression at appropriate times to reduce the side effects on the organism—that is, to establish a molecular switch for inducing gene expression. However, current technologies for inducing gene expression in organisms are inadequate, and innovation is needed in areas such as inducers, induction strategies, and induction mechanisms.

[0005] Juvenile hormone (JH) is a sesquiterpene compound unique to insects, and has not yet been found in humans or human cells. In insects, JH functions by regulating gene transcription, maintaining the larval stage, and inhibiting metamorphosis from larva to pupa and then to adult. It is known that JH regulates gene transcription through the intracellular receptor methoprene-tolerant receptor (MET), but the inventors have found that the gene for the JH cell membrane receptor has not yet been identified, and there are no reports of JH inducing protein expression through the JH cell membrane receptor. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides a method for inducing the expression of a target protein gene based on juvenile hormone and its application. This invention identified two cell membrane receptors for juvenile hormones in cotton bollworms, namely Cad96Ca and FGFR1; constructed plasmids expressing Cad96Ca and FGFR1 in human cells (pcDNA3.1-Cad96Ca-GFP-His, pcDNA3.1-FGFR1-GFP-His); constructed a juvenile hormone-induced expression plasmid (pKr-h1-LUC-RFP-His); and transferred the plasmids into human cells (293T), thereby achieving the induction of target protein expression in human cells using juvenile hormone. In other words, this invention provides a technique for inducing the expression of a target protein gene using juvenile hormone, which can be used to induce the expression of target protein genes in humans, animals, and plant individuals and cells. Based on the above research results, this invention is thus completed.

[0007] Specifically, the present invention relates to the following technical solutions:

[0008] In a first aspect, the invention provides the use of Cad96Ca protein and / or FGFR1 protein as juvenile hormone cell membrane receptors.

[0009] Specifically, this invention identified two cell membrane receptors for juvenile hormones in cotton bollworms, named Cad96Ca (cotton bollworm Cad96Ca / Cadherin 96Ca, NCBI gene number LOC110379194) and FGFR1 (cotton bollworm Fibroblast growth factor receptor homolog 1, NCBI gene number LOC110373728), respectively. It was also demonstrated that Cad96Ca and FGFR1 proteins can bind to juvenile hormones, and the amino acid sequences of Cad96Ca and FGFR1 proteins are found to be conserved in insects.

[0010] A second aspect of the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises at least nucleotides encoding the aforementioned Cad96Ca protein and / or FGFR1 protein, or nucleotides encoding the extracellular domains of the aforementioned Cad96Ca protein and / or FGFR1 protein. Of course, the Cad96Ca protein and FGFR1 protein can also be fusion proteins. Specifically, they can be fused with cell membrane proteins from other species besides *Helicoverpa armigera* (including prokaryotes and eukaryotes, with eukaryotes particularly including animals and plants, preferably mammals, including humans), and ultimately be able to express the Cad96Ca protein and FGFR1 protein or their extracellular domains.

[0011] A third aspect of the present invention provides a host cell containing the recombinant expression vector described in the second aspect of the present invention. Specifically, this can be achieved by transfecting the recombinant expression vector.

[0012] The host cell can be a prokaryotic cell or a eukaryotic cell.

[0013] A fourth aspect of the present invention provides a method for inducing the expression of a target protein gene based on juvenile hormone, the method comprising:

[0014] By applying juvenile hormone to the host cell culture environment, the expression of the target protein can be induced by the juvenile hormone, thereby achieving a controllable switch for the expression of the target protein and reducing the side effects of protein expression on the organism.

[0015] A fifth aspect of the present invention provides the use of the above-described recombinant expression vector, host cell, or method in any one or more of the following:

[0016] (a) Research on novel functions of organisms;

[0017] (b) Disease diagnosis or treatment;

[0018] (c) Control of plant diseases and pests;

[0019] (d) Prepare or screen drugs or pesticides.

[0020] The beneficial technical effects of one or more of the above technical solutions:

[0021] The above technical solution, based on long-term research on the regulation of insect gene expression by juvenile hormone, provides a method for inducing gene expression with juvenile hormone. By inducing protein expression with juvenile hormone, it achieves controllable switching of protein expression, reducing the side effects of protein expression on organisms. It is harmless to humans and mammals, and safe for other organisms and the environment. It can be used for disease treatment, enhancing immunity, and novel functions in organisms. It has good practical application value in disease treatment, plant and animal disease resistance, and novel functions in organisms. Attached Figure Description

[0022] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0023] Figure 1The amino acid sequences of the Cad96Ca protein (gene number LOC110379194) and FGFR1 protein (gene number LOC110373728) from the cotton bollworm, as well as homologous proteins in insects, are conserved in this invention. The black boxes indicate the conserved nature of the Cad96Ca and FGFR1 proteins in several cotton bollworms and representative insects. A represents the Cad96Ca protein, and B represents the FGFR1 protein. The following species are listed: *Bombyx mori* Cad96Ca XP 037868699.1, *Spodoptera frugiperda* CAD96CAXP_035438513.1, *Drosophila melanogaster* Cad96CaNP 651349.1, *Aedes aegypti* CAD96CA XP_021705357.1, *Tribolium castaneum* CAD96CA XP_008200974.1, and *Homo sapiens* Ret NP_001393672.1. Bombyx mori FGFR XP_012553037.2,Spodoptera frugiperda FGFR1 FGFR1XP_008190748.1, Homo sapiens FGFR2 NP_000132.3.

[0024] Figure 2 For this invention, expression plasmids for Cad96Ca and FGFR1 proteins were constructed (pcDNA3.1-Cad96Ca-GFP-His, pcDNA3.1-FGFR1-GFP-His). GFP: Green fluorescent protein; RTK target gene: cDNA sequences of Cad96Ca and FGFR1 proteins; CMV promoter: Cytomegalovirus (CMV) promoter; Kpn I and EcRI: Restriction endonucleases.

[0025] Figure 3To construct this invention, a pKr-h1-luciferase-red fluorescent protein expression plasmid (pKr-h1-LUC-RFP-His) was constructed. pIEx-RFP was inserted into LUC to construct pIEx-LUC-RFP, the promoter was removed, and a leader sequence of Kr-h1 was inserted. Using pIEx-4-His plasmid as the parent, a juvenile hormone-induced expression plasmid was constructed: RFP: red fluorescent protein; Luciferenase; JHRE: juvenile hormone response element; CACGTG: E-box motif; The 5' upstream sequence of Kr-h1 (start codon ATG pre-2217-941): the upstream sequence of the Kr-h1 gene. Sac I and SamI: restriction endonucleases.

[0026] Figure 4 This invention relates to juvenile hormone-induced expression of LUC-RFP protein in 293T cells. Juvenile hormone induces the expression of the target protein gene. A, Cad96Ca-GFP and FGFR1-GFP protein expression plasmids were expressed correctly in 293T cells. B, The pKr-h1-LUC-RFP-His plasmid expressed the target protein LUC-RFP under juvenile hormone (JH III, 2 μM JH III for 48 h) induction, while the control NRK-GFP could not be induced by juvenile hormone to express LUC-RFP. Western blotting using RFP antibody confirmed the correct expression of the target protein. C, The mutants CAD96CA-M3, CAD96CA-M4, FGFR1-M3, and MFGFR1-4-GFPD lost or reduced their responsiveness to juvenile hormone. CAD96CA-M1-M4 and FGFR1-M1-M4-GFP are different mutations. CAD96CA-GFP and FGFR1-GFP are wild-type proteins (unmutated). E and F, CAD96CA-M1-M4 and FGFR1-M1-M4-GFP are schematic diagrams of different mutations. Detailed Implementation

[0027] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0028] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods in the following specific embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or according to the conditions recommended by the manufacturer.

[0029] In a typical embodiment of the present invention, Cad96Ca protein and / or FGFR1 protein are provided for use in juvenile hormone cell membrane receptors.

[0030] Specifically, this invention identified two cell membrane receptors for juvenile hormones in cotton bollworms, named Cad96Ca (cotton bollworm Cad96Ca / Cadherin 96Ca, NCBI gene number LOC110379194) and FGFR1 (cotton bollworm Fibroblast growth factor receptor homolog 1, NCBI gene number LOC110373728), respectively. It was also demonstrated that Cad96Ca and FGFR1 proteins can bind to juvenile hormones, and the amino acid sequences of Cad96Ca and FGFR1 proteins are found to be conserved in insects.

[0031] therefore,

[0032] The nucleotide sequence of the Cad96Ca protein is selected from:

[0033] a1) The nucleotide sequence as shown in NCBI gene number LOC110379194; or,

[0034] a2) A nucleotide sequence as shown in NCBI gene number LOC110379194 has one or more nucleotide substitutions and / or deletions and / or additions that encode a protein with the same function.

[0035] The nucleotide sequence of the FGFR1 protein is selected from:

[0036] b1) The nucleotide sequence as shown in NCBI gene number LOC110373728; or,

[0037] b2) A nucleotide sequence as shown in NCBI gene number LOC110373728 has been modified by substitution and / or deletion and / or addition of one or more nucleotides and encodes a protein with the same function.

[0038] A second aspect of the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises at least nucleotides encoding the aforementioned Cad96Ca protein and / or FGFR1 protein, or nucleotides encoding the extracellular domains of the aforementioned Cad96Ca protein and / or FGFR1 protein. Of course, the Cad96Ca protein and FGFR1 protein can also be fusion proteins. Specifically, they can be fused with cell membrane proteins from other species besides *Helicoverpa armigera* (including prokaryotes and eukaryotes, with eukaryotes particularly including animals and plants, preferably mammals, including humans), and ultimately be able to express the Cad96Ca protein and FGFR1 protein or their extracellular domains.

[0039] More specifically, the recombinant expression vector is obtained by effectively linking the nucleotides encoding the Cad96Ca protein and / or FGFR1 protein to an expression vector. The expression vector can be any one or more of viral vectors, plasmids, bacteriophages, granules, and artificial chromosomes. Viral vectors include, but are not limited to, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors. Artificial chromosomes include, but are not limited to, bacterial artificial chromosomes (BAC), bacteriophage P1-derived vectors (PAC), yeast artificial chromosomes (YAC), and mammalian artificial chromosomes (MAC). By selecting different expression vectors, subsequent expression of different target proteins based on juvenile hormone regulation in different hosts (including prokaryotes and eukaryotes, with eukaryotes particularly including animals and plants, preferably mammals, including humans) can be achieved, expanding its application areas and scope.

[0040] In one specific embodiment of the present invention, the expression vector is a plasmid, specifically pcDNA3.1 and piex-4. More specifically, the present invention provides a recombinant expression vector, which is a recombinant plasmid. The recombinant plasmid may also contain a juvenile hormone response element E-BOX (CACGTG, GCGTG motif) or E-BOX-like, and the gene encoding the target protein. It should be noted that other juvenile hormone response elements are also permitted to be used, and therefore are also within the scope of protection of this application. The target protein is also not specifically limited; in one specific embodiment of the present invention, the target protein is LUC-RFP.

[0041] Of course, the recombinant plasmid can be two, namely, the first plasmid contains nucleotides encoding the Cad96Ca protein and / or FGFR1 protein or nucleotides encoding the extracellular domain of the Cad96Ca protein and / or FGFR1 protein, for expressing the Cad96Ca protein and / or FGFR1 protein in the host, and the second plasmid contains the juvenile hormone response element E-BOX (CACGTG, GCGTG motif) or E-BOX-like and the gene encoding the target protein.

[0042] In one specific embodiment of the present invention, the method for constructing the recombinant plasmid is as follows:

[0043] S1. Amplify the nucleotide sequence encoding the Cad96Ca protein or FGFR1 protein and ligate it into the pcDNA3.1-GFP-His plasmid to obtain pcDNA3.1-Cad96Ca-GFP-His and

[0044] pcDNA3.1-FGFR1-GFP-His expression plasmid;

[0045] S2. The DNA sequence preceding the start codon ATG of the cotton bollworm Kr-h1 gene (-2217-1-ATG) was amplified by PCR and ligated into the pIEx-4-luciferase-RFP plasmid to obtain the pKr-h1-LUC-RFP-His juvenile hormone inducible expression plasmid.

[0046] A third aspect of the present invention provides a host cell containing the recombinant expression vector described in the second aspect of the present invention. Specifically, this can be achieved by transfecting the recombinant expression vector.

[0047] The host cell can be a prokaryotic cell or a eukaryotic cell.

[0048] More specifically, the host cell is any one or more of bacterial cells, fungal cells, plant cells, or animal cells;

[0049] The bacterial cells are any species of Escherichia coli, Agrobacterium, Bacillus, Streptomyces, Pseudomonas, or Staphylococcus.

[0050] More specifically, the bacterial cells are Escherichia coli (such as Escherichia coli DH5α), Agrobacterium tumefaciens (such as GV3101), Agrobacterium rhizogenes, Lactococcus lactis, Bacillus subtilis, Bacillus cereus, or Pseudomonas fluorescens.

[0051] The fungal cells include yeast.

[0052] The plant cells include Arabidopsis thaliana plants, maize plants, sorghum plants, potato plants, tomato plants, wheat plants, rapeseed plants, soybean plants, rice plants, barley plants, or tobacco plants.

[0053] The animal cells can be mammalian cells, including but not limited to cells from rats, mice, rabbits, monkeys, chimpanzees, and humans, with human cells being preferred. In one specific embodiment of the invention, the host cell is a 293T cell.

[0054] A fourth aspect of the present invention provides a method for inducing the expression of a target protein gene based on juvenile hormone, the method comprising:

[0055] By applying juvenile hormone to the host cell culture environment, the expression of the target protein can be induced by the juvenile hormone, thereby achieving a controllable switch for the expression of the target protein and reducing the side effects of protein expression on the organism.

[0056] Specifically, the concentration of the juvenile hormone used is 0.5-5 μM, and the duration of use is 1-72 h, preferably 2 μM for 48 h.

[0057] The juvenile hormone can be any one or more of juvenile hormone 0, juvenile hormone I, juvenile hormone II, and juvenile hormone III.

[0058] The target protein is not specifically limited. In one specific embodiment of the present invention, the target protein is LUC-RFP.

[0059] A fifth aspect of the present invention provides the use of the above-described recombinant expression vector, host cell, or method in any one or more of the following:

[0060] (a) Research on novel functions of organisms;

[0061] (b) Disease diagnosis or treatment;

[0062] (c) Control of plant diseases and pests;

[0063] (d) Prepare or screen drugs or pesticides.

[0064] In (c), plant disease and pest control can specifically be based on transgenic insect-resistant plants to control diseases and pests; wherein, the transgenic insect-resistant plant can be a transgenic insect-resistant crop, and the crop can be a food crop (such as wheat, rice, corn, soybean, etc.) and a cash crop (such as cotton, hemp, tobacco, sugar beet, etc.), wherein, the cash crop is preferred; for example, in a specific embodiment of the present invention, by transferring the above two recombinant plasmids into various cash crops, the expression of the insect-resistant gene (replacing LUC-RFP) is induced by juvenile hormone (or a screened juvenile hormone analog).

[0065] In the application (d), the drug is applied to animals, including humans and non-human animals. Non-human animals may include livestock (such as cattle and sheep) and poultry (such as chickens and ducks) raised in agricultural production, domestic pets (such as cats and dogs), and wild animals, etc., without specific limitations.

[0066] In this invention, the term "pesticide" should be interpreted broadly, specifically referring to a chemically synthesized substance or a mixture of substances derived from organisms, other natural products, or produced using biotechnology, used to prevent, eliminate, or control diseases, insects, weeds, and other harmful organisms that endanger agriculture and forestry, as well as to purposefully regulate, control, and influence the metabolism, growth, development, and reproduction processes of plants and harmful organisms. In one specific embodiment, screening juvenile hormone analogs (activators) or antagonists (inhibitors) can be used to develop environmentally friendly pesticides for regulating pest growth.

[0067] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0068] Example 1

[0069] Obtain the protein and gene sequences of Cad96Ca and FGFR1.

[0070] from https: / / www.ncbi.nlm.nih.gov / Enter the gene ID (LOC110379194) to find the Cad96Ca protein in the cotton bollworm, and then from... https: / / blast.ncbi.nlm.nih.gov / Blast.cgi Searching for similar protein sequences in other insects can yield the amino acid and gene sequences of the Cad96Ca protein in cotton bollworms and other insects.

[0071] Helicoverpa armigera CAD96CA XP_021194412.1, LOC110379194

[0072] (SEQ ID NO.1)

[0073] from https: / / www.ncbi.nlm.nih.gov / Enter the gene ID (LOC110373728), locate the cotton bollworm FGFR1 protein, and then from... https: / / blast.ncbi.nlm.nih.gov / Blast.cgi Searching for similar protein sequences in other insects can yield the amino acid sequence and gene sequence of the FGFR1 protein in cotton bollworms and other insects.

[0074] Helicoverpa armigera FGFR1 XP_021186745.1, LOC110373728

[0075] MNLAAIAFWREMPIAFTLLVATACLVTAKDIVLDKDYTTLEASLNERLRLTCGIKPNGEKSSVLWYKDGLLVDTQKSRVVQQRQWLRIKGFRAKDAGLYSCKTDNDNEKEMTIRLSLKHNGAHDMEDYQADMGVRALPETLSQIKSAALVENNTLDDNITDSKRFIKDEDLDEKGEKDEKEHPNYGHVDEKQEYFPPRFKHPTKLYKMDMKPAGNSIRLRCAAEGNPTPNITWYKNRSTPISRVFFQPSYGKWSMALDELTKADNGNYTCVVCNILGCIEHTVVLHIQERLYAKPVLTQGAENLTVVVGDTARFSCQFLTDLHSSQYWMYFTKNEYIYNETIDTDALIKESVVYPDYSKVVTSENPTDKPEQLTIYNVTKDDEGWYVCVALNSLGNTTAKGYLTVLESQPVQEAPDHGKHTLLINILTVVLGAMFFVAAIIVVMICKKLKREKEQKQLAIETARAVIVTHWTKKVTVEKPQMNGSPTATGEALLMPVVKIEKQKLSQVQNTTSDSMMMSEYELPMDIDWEVPRESLCLGKVLGEGEFGKVVKAECVGILKPGMQSVVAVKMLKEGHTDAEMMALVSEMEMMKMIGKHVNIINLLGCCTQDGPLYVIVEYAPNGNLREFLRNHRPGNRYESPTEELKEKKTLTQKDLVSFSYQVARGMEYLASRRCIHRDLAARNVLVSDDCILKIADFGLAKDVHSNDYYRKKTEGRLPVRWMAPESLYHKVFTTQTDVWSFGVLLWEIMTLGGTPYPTVPGQYMYQHLSAGHRMEKPPCCSLEIYMLMRECWSFSPGDRPSFTELVEDLDKILTVTANQEYLDLGLPQLDTPPSSYDGSGDESDSDFPFIK(SEQ ID NO.2)

[0076] Example 2

[0077] Construct the expression plasmids pcDNA3.1-Cad96Ca-GFP-His and pcDNA3.1-FGFR1-GFP-His that express Cad96Ca protein and FGFR1 protein in human cells.

[0078] The DNA sequences of Cad96Ca and FGFR1 proteins were amplified by PCR using primers Cad96ca-oveF (tcgttaacacgtcaagagctcatgtttctgacaagcgtctggg, SEQ ID NO.3), Cad96ca-oveR (cttcgaaccggtaccgtcgactagtttttctccatccaagtgctg, SEQ ID NO.4), Fgfr1-oveF (tcgttaacacgtcaagagctcatgaatctcgccgccattg, SEQ ID NO.5) and Fgfr1-oveR (cttcgaaccggtaccgtcgactttgatgaaaggaaagtcactgtca, SEQ ID NO.6). The PCR product and pcDNA3.1-GFP-His plasmid were digested with Kpn I and EcRI. The genes of Cad96Ca protein and FGFR1 protein were ligated into the pcDNA3.1-GFP-His plasmid using DNA ligase. The plasmid was then transformed into E. coli (DH5α) for amplification, resulting in the expression plasmids pcDNA3.1-Cad96Ca-GFP-His and pcDNA3.1-FGFR1-GFP-His.

[0079] Example 3

[0080] A juvenile hormone-inducible plasmid pKr-h1-LUC-RFP-His containing the juvenile hormone response element E-BOX (CACGTG, GCGTG motifs) was constructed.

[0081] The DNA sequence preceding the start codon ATG of the cotton bollworm Kr-h1 gene (-2217-1-ATG, SEQ ID NO. 9) was amplified by PCR using primers pKr-h1F (ccatgattacgaattcccgggCTTCGACAATTCAAATGTAAGTCCA, SEQ ID NO. 7) and pKr-h1R (tttggcgtcttccatgagctcCACCATGGTGGCGTTATTCAATGATGATGAT, SEQ ID NO. 8). The PCR product and pIEx-4-luciferase-RFP plasmid were digested with Sac I and SamI enzymes. The PCR product was ligated into the plasmid using DNA ligase and transformed into E. coli DH5α amplification plasmid to form the pKr-h1-LUC-RFP-His juvenile hormone inducible expression plasmid.

[0082]

[0083] Example 4

[0084] The target protein was expressed in human 293T cells using juvenile hormone.

[0085] Cad96Ca protein expression plasmid (pcDNA3.1-Cad96Ca-GFP-His) and FGFR1 protein overexpression plasmid (pcDNA3.1-FGFR1-GFP-His) were transfected into 293T cells using a transfection reagent (Invitrogen Lipofectamin 3000). Simultaneously, the pKr-h1-LUC-RFP-His expression plasmid was also transfected into the same 293T cells. After 12 hours, the expression of the target protein gene was induced with 2 μM juvenile hormone III for 48 hours. The expression of the target protein LUC-RFP was detected by Western blotting using an RFP antibody.

[0086] Based on long-term research on the regulation of insect gene expression by juvenile hormone, this invention provides a method for inducing gene expression with juvenile hormone. By inducing protein expression with juvenile hormone, it achieves controllable switching of protein expression, reducing the side effects of protein expression on organisms. It is harmless to humans and mammals, and safe for other organisms and the environment. It can be used for disease treatment, enhancing immunity, and developing new functions in organisms. It has good practical application value in disease treatment, animal disease resistance, and the development of new functions in organisms.

[0087] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A recombinant expression vector, characterized in that, The recombinant expression vector contains at least nucleotides encoding Cad96Ca protein and / or FGFR1 protein; the nucleotide sequence of Cad96Ca protein is selected from the nucleotide sequence shown in NCBI gene number LOC110379194; the nucleotide sequence of FGFR1 protein is selected from the nucleotide sequence shown in NCBI gene number LOC110373728. The recombinant expression vector was obtained by effectively linking the nucleotides encoding the Cad96Ca protein and / or FGFR1 protein to the expression vector. The expression vector is a plasmid, specifically pcDNA3.1 and piex-4; The recombinant expression vector is a recombinant plasmid, and there are two recombinant plasmids. The first plasmid contains nucleotides encoding the Cad96Ca protein and / or FGFR1 protein, which are used to express the Cad96Ca protein and / or FGFR1 protein in the host. The second plasmid contains the juvenile hormone response element E-BOX or E-BOX-like and the gene encoding the target protein.

2. The recombinant expression vector of claim 1, wherein, The juvenile hormone response element E-BOX is a CACGTG and / or GCGTG motif.

3. The recombinant expression vector of claim 1, wherein, The method for constructing the recombinant plasmid is as follows: S1. Amplify the nucleotide sequences encoding the Cad96Ca protein and FGFR1 protein and ligate them into the pcDNA3.1-GFP-His plasmid to obtain the pcDNA3.1-Cad96Ca-GFP-His and pcDNA3.1-FGFR1-GFP-His expression plasmids. S2. The DNA sequence shown in SEQ ID NO.9 preceding the start codon ATG of the cotton bollworm Kr-h1 gene was amplified by PCR and ligated into the pIEx-4-luciferase-RFP plasmid to obtain the pKr-h1-LUC-RFP-His juvenile hormone inducible expression plasmid.

4. A host cell, characterized in that, The host cell contains the recombinant expression vector as described in any one of claims 1-3 of this invention.

5. The host cell of claim 4, wherein The host cell is a eukaryotic cell.

6. The host cell of claim 5, wherein The host cell was a 293T cell.

7. A method for inducing expression of a protein of interest gene based on juvenile hormone, characterized by, The method includes: Applying juvenile hormone to the host cell culture environment as described in any one of claims 4-6; Specifically, the concentration of the juvenile hormone used is 0.5-5 μM, and the duration of use is 1-72 h; The juvenile hormone mentioned is juvenile hormone III; The target protein is LUC-RFP.

8. The use of the recombinant expression vector according to any one of claims 1-3, the host cell according to any one of claims 4-6, or the method according to claim 7 in inducing the expression of the target protein by juvenile hormone.