Pseudomonas kunmingensis and uses thereof

The extracellular mineralization technology of Pseudomonas Kunmingense TR-21 and its recombinant strains has solved the problem of rare earth resource waste, achieved efficient adsorption and mineralization of rare earth ions, and promoted the green development of rare earth biomining and tailings utilization.

CN116555100BActive Publication Date: 2026-04-24TSINGHUA UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TSINGHUA UNIVERSITY
Filing Date
2023-04-26
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies lack microbial strains with strong adsorption capacity for rare earth ions, leading to the loss and waste of rare earth resources, and the rare earth-rich tailings produced by traditional chemical methods have not been effectively utilized.

Method used

Using Pseudomonas kunmingensis TR-21 and its recombinant strains, nano- or micro-sized rare earth phosphates are produced through extracellular mineralization, thereby improving the adsorption capacity and mineralization ability of rare earth ions, and can be applied to rare earth biomining and tailings utilization.

Benefits of technology

It achieves efficient adsorption and mineralization of various rare earth ions, reduces cultivation costs, has good application prospects, and promotes the green and sustainable development of the rare earth industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004201995510000161
    Figure BDA0004201995510000161
  • Figure BDA0004201995510000171
    Figure BDA0004201995510000171
  • Figure BDA0004201995510000172
    Figure BDA0004201995510000172
Patent Text Reader

Abstract

The present application relates to the field of environment-friendly biological mining technology, and particularly relates to Pseudomonas kunmingensis and application thereof. The present application provides a new Pseudomonas kunmingensis strain capable of recovering rare earth ions through extracellular mineralization of rare earth phosphate crystals, and the strain is genetically modified, which can provide new choices and ways for rare earth biological mining, utilization of rare earth-rich tailings and biosynthesis of rare earth nanoparticles. The strain provided by the present application has low culture cost, fast growth speed, simple adsorption conditions, and has adsorption capacity for various rare earth ions, and has good application prospect in rare earth microbial mining and tailings utilization.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of environmentally friendly biomining technology, specifically to *Pseudomonas kunmingense* and its applications. Background Technology

[0002] Rare earth elements (REEs) possess unique electronic configurations, particularly the unfilled and shielded 4f5d electron shell, which contains abundant electronic energy levels, exhibiting significant characteristics in bonding ability and optical properties. Therefore, rare earths hold immense strategic importance for national security and economic development; they are crucial strategic resources and non-renewable scarce resources. High-purity rare earths are core raw materials for the research and development of high-tech materials, widely used in major fields such as lidar, submarine bearings, turbine blades, turbine disks, wind tunnel temperature measurement, and permanent magnet motors. However, the rare earth-rich tailings produced by traditional chemical methods have not been effectively utilized, leading to severe loss and waste of rare earth resources. Therefore, to meet the demands of green chemistry and sustainable resource utilization, developing clean and efficient new technologies for rare earth separation and utilization, aiming to minimize environmental pollution while ensuring the utilization rate of rare earth elements, is currently a key research focus in the rare earth industry, possessing significant application value and practical significance.

[0003] With the deepening of research on microorganisms, the interaction between microorganisms and various metals has been widely reported and attracted attention. Many soil microorganisms, due to their unique metal ion adsorption capabilities, have been used in fields including biomining and the treatment and recycling of metal-containing wastewater. For example, wild-type and genetically engineered microorganisms have been used for the biosynthesis of inorganic nanomaterials under mild and environmentally friendly conditions. Currently, it has been reported that microorganisms such as *Escherichia coli*, *Bacillus licheniformis*, and *Pseudomonas fluorescens* can biosynthesize lanthanide nanomaterials. However, to date, there is a lack of new strains with strong adsorption capabilities for various rare earth ions. Summary of the Invention

[0004] In view of this, the present invention provides *Pseudomonas kunmingense* and its applications.

[0005] This invention provides *Pseudomonas kunmingense* and its applications. The invention provides a novel strain of *Pseudomonas kunmingense* capable of recovering rare earth ions through extracellular mineralization of rare earth phosphate crystals. Genetic modification of this strain can provide new options and pathways for rare earth biomining, utilization of rare earth-rich tailings, and biosynthesis of rare earth nanoparticles. The strain provided by this invention has low cultivation costs, rapid growth rate, simple adsorption conditions, and adsorption capacity for various rare earth ions, showing promising application prospects in rare earth microbial mining and tailings utilization.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides Pseudomonas kunmingensis TR-21, with accession number CGMCC No. 26447.

[0008] In some specific embodiments of the present invention, the Pseudomonas kunmingensis TR-21 is used in one or more of the following forms: live bacteria, inactivated bacterial cells, fermentation broth, exosomes, or metabolites.

[0009] This invention also provides a method for preparing recombinant strains, based on the aforementioned *Pseudomonas kunmingensis* TR-21, by expressing any of the following:

[0010] (I) Genes encoding molecular chaperones DegP, Skp, or SurA; and / or

[0011] (II) The gene encoding polyphosphokinase 2 and the P_mxaF strong promoter.

[0012] Based on the above research, the present invention also provides a recombinant strain obtained by the preparation method described above.

[0013] The present invention also provides microbial inoculants, including any of the following and acceptable excipients and / or auxiliaries:

[0014] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0015] (II) The recombinant strain.

[0016] This invention also provides the application of any of the following in the recovery of rare earth ions:

[0017] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0018] (II) the recombinant strain; and / or

[0019] (III) The microbial inoculant.

[0020] In some specific embodiments of the present invention, the method of recovering rare earth ions includes extracellular mineralization of nanoscale rare earth phosphates or microscale rare earth phosphates.

[0021] This invention also provides the following applications in biomining and / or the development and utilization of tailings:

[0022] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0023] (II) the recombinant strain; and / or

[0024] (III) The microbial inoculant.

[0025] In some specific embodiments of the present invention, the development and utilization of biomining and / or tailings is achieved by increasing the adsorption capacity and mineralization ability of the recombinant strain for light rare earth elements.

[0026] This invention also provides the application of any of the following in the preparation of rare earth nanoscale or microscale particles:

[0027] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0028] (II) the recombinant strain; and / or

[0029] (III) The microbial inoculant.

[0030] This invention also provides the application of any of the following in increasing the yield of rare earth phosphate minerals:

[0031] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0032] (II) the recombinant strain; and / or

[0033] (III) The microbial inoculant.

[0034] The present invention also provides the application of any of the following in enhancing the ability to specifically adsorb rare earth ions:

[0035] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0036] (II) the recombinant strain; and / or

[0037] (III) The microbial inoculant.

[0038] This invention also provides a method for recovering rare earth ions, based on any of the following:

[0039] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0040] (II) the recombinant strain; and / or

[0041] (III) The microbial inoculant.

[0042] In some specific embodiments of the present invention, the method is based on adsorption by mixing with a rare earth solution using any of the following:

[0043] (I) the aforementioned Pseudomonas kunmingensis TR-21; and / or

[0044] (II) the recombinant strain; and / or

[0045] (III) The microbial inoculant.

[0046] In some specific embodiments of the present invention, the method for recovering rare earth ions includes picking the *Pseudomonas kunmingensis* TR-21 or the recombinant strain into LB liquid medium and culturing overnight as a seed culture; inoculating 1% into LB liquid medium and culturing to the logarithmic phase; centrifuging to collect the bacterial cells and washing them with sterile ultrapure water; adding the washed bacterial cells to a rare earth solution for adsorption; collecting the bacterial cells and washing them with ultrapure water.

[0047] In some specific embodiments of the present invention, the culture conditions are 30°C and 200 rpm;

[0048] The centrifugation speed was 8000 rpm and the time was 5 minutes;

[0049] The adsorption conditions are 30°C and 200 rpm.

[0050] In some specific embodiments of the present invention, the rare earth solution includes fourteen kinds of mixed rare earth solutions and a La,Sm mixed rare earth solution; the volume of the rare earth solution is 100mL.

[0051] This invention provides a strain of *Pseudomonas kunmingense* that can adsorb rare earth ions and mineralize them to produce nano- or micron-sized rare earth salts via its cell wall and extracellular polymeric materials (EPS) such as proteins and polysaccharides. This strain was screened from sediment in the riverbed of the tailings dam at Baogang Mineral Processing Plant. By modifying the chassis of this strain, the adsorption capacity and mineralization ability of the strain for light rare earths are improved, thereby achieving the specific adsorption and mineralization of light rare earths by *Pseudomonas kunmingense*. This strain can be applied to the development and utilization of rare earth mines and tailings, realizing the green and sustainable development of the rare earth industry.

[0052] Biological Preservation Instructions

[0053] Biological material TR-21, classified and named as *Pseudomonas kunmingensis*, was deposited on January 12, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 26447. Attached Figure Description

[0054] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0055] Figure 1 The phylogenetic tree of strain TR-21 in Example 1 is shown;

[0056] Figure 2 Transmission electron microscopy images of different rare earth ions mineralized by strain TR-21 in Example 3 are shown.

[0057] Figure 3 The image shows a transmission electron microscope (TEM) image of a mixture of mineralized La(III) and Sm(III) by strain TR-21 in Example 3. A shows the morphology of the bacterial cells when TR-21 did not adsorb rare earth elements; B shows the size and morphology of the rare earth nanoparticles after 2 hours of adsorption; C shows the size and morphology of the rare earth nanoparticles after 19 hours of adsorption; D shows the size and morphology of the rare earth nanoparticles after 150 hours of adsorption; E shows the size and morphology of the rare earth nanoparticles after 720 hours of adsorption; F shows the selected area electron diffraction pattern of the rare earth nanoparticles; G shows the lattice fringes of the rare earth nanoparticles; and H shows the elemental composition of the rare earth nanoparticle region.

[0058] Figure 4 The image shows a scanning electron microscope image of the mineralized La(III) and Sm(III) mixture by the TR-21 strain in Example 3; where A shows the surface of the bacterial cells when TR-21 did not adsorb rare earth elements; B shows the surface of the bacterial cells after TR-21 interacted with La and Sm for 360 h.

[0059] Figure 5 The molecular chaperone SurA expressed by the engineered TR-21 strain was detected by SDS-PAGE in Example 4.

[0060] Figure 6 The strong promoters of polyphosphokinase 2 and P_mxaF expressed by the engineered TR-21 strain in Example 5 were detected by SDS-PAGE. Detailed Implementation

[0061] This invention discloses *Pseudomonas kunmingense* and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0062] To address the shortcomings of existing technologies, this invention provides a *Pseudomonas kunmingense* strain that, through its cell wall and extracellular polymeric materials (EPS) such as proteins and polysaccharides, can adsorb rare earth ions extracellularly and mineralize them to produce nano- or micron-sized rare earth salts. This strain was screened from sediment in the riverbed of the tailings dam at Baogang Mineral Processing Plant. By modifying the chassis of this strain, its adsorption capacity and mineralization ability for light rare earths are improved, thereby achieving specific adsorption and mineralization of light rare earths by *Pseudomonas kunmingense*. This strain can be applied to the development and utilization of rare earth mines and tailings, realizing the green and sustainable development of the rare earth industry.

[0063] To achieve the above objectives, the present invention adopts the following technical solution:

[0064] (1) A strain of Pseudomonas kunmingensis TR-21 was isolated from sediment in the riverbed of the tailings dam of Baogang Mineral Processing Plant in Baotou City, Inner Mongolia Autonomous Region, using Luria-Bertani (LB) medium. It was deposited at the China General Microbiological Culture Collection Center (CGMCC) on January 12, 2023, with accession number CGMCC NO.26447. The address of CGMCC is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0065] (2) TR-21 was cultured in liquid LB medium to the logarithmic phase (culture temperature was 28℃), centrifuged at 8000 rpm for 5 min to collect the bacterial precipitate, and washed 3 times with ultrapure water.

[0066] (3) The washed TR-21 was placed in a mixed solution of fourteen rare earth elements (excluding promethium, scandium and yttrium) prepared with ultrapure water and incubated (incubation temperature was 28℃ and incubation time was 2h) for the adsorption of rare earth ions in aqueous solution and extracellular biomineralization. After centrifugation at 8000rpm for 5min, cells loaded with rare earth ions were obtained.

[0067] (4) The adsorption capacity of TR-21 for rare earth ions was detected by ICP-OES, and the extracellular mineralization capacity of TR-21 for rare earth ions was observed by TEM-EDS.

[0068] (5) Construct engineered strains to modify TR-21. Insert the target gene fragment into the vector plasmid, and transform the obtained recombinant plasmid into TR-21. By expressing the target gene in TR-21, the expression level of related proteins is upregulated. This enhances the adsorption capacity of TR-21 for rare earth ions and the yield of rare earth phosphate mineralization, or strengthens the specific adsorption of TR-21 for certain rare earth ions (such as light rare earth elements LREE), selectively mineralizing and recovering certain rare earth ions.

[0069] The strain provided by this invention has low cultivation cost, fast growth rate, simple adsorption conditions, and adsorption capacity for a variety of rare earth ions. It has good application prospects in rare earth microbial mining and tailings utilization.

[0070] The sequences used in this invention are as follows:

[0071] SEQ ID No.1:27F:5'-AGRGTTTGATYNTGGCTCAG-3'

[0072] SEQ ID No.2:1492R:5'-TASGGHTACCTTGTTASGACTT-3'

[0073] Vector plasmid pCM62 (SEQ ID No. 3):

[0074]

[0075] Vector plasmid pCM66 (SEQ ID No. 4):

[0076]

[0077] The gene sequence of the P_mxaF strong promoter (SEQ ID No. 5):

[0078] AGGGATGAGGCGATCATCTCTCCCCCTTGGTTCCCCCGCCGGGCGCTCATCCTGAGATACTTTTGGCCCTGCTTGGGTTACCCCTCGCCGCTGTAGGGTACGCTGTGCGTACCTTTCCAACCCCCGATGGTACGCACAGCGCACCCTACAGTTAAAAAAAGGAACTTTTCCCGACTCACACGGAAAAGCCATATACAGGAATTTTTCTT TTCGATTTTTCGGATTTTTTCCTAGCCGAATTACAGGTTATTCCGTAACGCCCGCCTCTCCCGCTCGGCTACCATGTCGCTTGCTCGGATCCGCGCTTCGGTACCCCTGTGAACGTTTTGATCAAGAAGGCCGAATCCAATTTTACCGAGGCGCCGGATCCAGGCTTTTCAAATTCAGCCAATAAAGACAACCCTTGGAGGGGGAATTT

[0079] The *Pseudomonas kunmingense* strain provided by this invention and the raw materials and reagents used in its application are all commercially available.

[0080] The present invention will be further illustrated below with reference to the embodiments:

[0081] Example 1: Isolation and Identification of Pseudomonas kunmingensis TR-21 strain

[0082] (1) Isolation of strains

[0083] Take 1g of sediment from the riverbed of the tailings dam at Baogang Mineral Processing Plant in Baotou City, Inner Mongolia Autonomous Region, stored at -20℃, and resuspend it in 10mL of sterile PBS buffer. Using an inoculation loop in a clean bench, spread the sample resuspension onto LB solid medium using the four-zone streak method, and incubate at 30℃. Observe continuously for 10 days. Inoculate single colonies with different morphological characteristics onto fresh LB solid medium for purification until only a single strain remains on the medium (approximately four purifications). Seal with sealing film and store at 4℃. Pick single colonies and incubate overnight in LB liquid medium. Preserve the cultured strain in 25% (v / v) glycerol solution and store at -80℃.

[0084] (2) Identification of strains

[0085] The isolated strains were cultured in LB liquid medium to the logarithmic growth phase. The bacterial pellet was collected by centrifugation at 8000 rpm for 5 min, and bacterial DNA was extracted. The 16S rRNA sequence in the bacterial genomic DNA was amplified using universal primers and sequenced. The sequencing results were compared with the strain sequences in NCBI, and a phylogenetic tree was constructed using MEGA11 (e.g.,...). Figure 1 The strain TR-21 was identified as Pseudomonas kunmingense.

[0086] Universal primer sequence:

[0087] 27F:5'-AGRGTTTTGATYNTGGCTCAG-3'. (SEQ ID No.1)

[0088] 1492R:5'-TASGGHTACCTTGTTASGACTT-3'. (SEQ ID No.2)

[0089] Example 2: Determination of the rare earth ion adsorption capacity of TR-21 strain

[0090] (1) Determination of the adsorption capacity of fourteen mixed rare earth solutions

[0091] Purified TR-21 single colonies were picked from solid culture medium and added to 4 mL of LB liquid medium, and cultured overnight at 30℃ and 200 rpm as seed culture. 1% was inoculated into LB liquid medium and cultured at 30℃ and 200 rpm until the logarithmic growth phase. The cells were collected by centrifugation at 8000 rpm for 5 min and washed three times with sterile ultrapure water. The washed cells were added to 100 mL of a mixed solution of fourteen rare earth elements and placed in a constant temperature shaking incubator at 30℃ and 200 rpm for 1 h for adsorption. The cells were collected, washed three times with ultrapure water, weighed, and stored at 4℃. The REE content in the cells was characterized using ICP-OES. The results (as shown in Table 1) showed that TR-21 adsorbed the most Sm (597.95 μg / g) and the least La (156.32 μg / g).

[0092] Preparation of the mother liquor containing fourteen rare earth elements: Weigh anhydrous chlorides or hydrated chlorides of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium to prepare a mother liquor with a concentration of 1 mol / L. After passing the mother liquor through a 0.22-micron PES membrane, store it in a clean bench. Take 100 mL of ultrapure water and add 10 μL of each of the fourteen rare earth mother liquors to obtain a mixed rare earth solution with a final rare earth ion concentration of 0.1 mmol / L.

[0093] Table 1. Adsorption capacity of TR-21 strain for fourteen rare earth ions

[0094] Rare earth elements Adsorption capacity of TR-21 (μg / g) La 156.32 Ce 240.78 Pr 261.53 Nd 321.67 Sm 597.95 Eu 553.57 Gd 357.57 Tb 558.08 Dy 468.29 Ho 366.79 Er 324.62 Tm 428.11 Yb 450.21 Lu 502.14

[0095] (2) Determination of the adsorption capacity of La,Sm mixed rare earth solution

[0096] The bacterial cell treatment was the same as the mixed adsorption process described above. The washed bacterial cells were added to 100 mL of a La and Sm mixed rare earth solution and placed in a constant temperature shaking incubator at 30°C and 200 rpm for adsorption. The bacterial cells were collected, washed three times with sterile ultrapure water, weighed, and stored at 4°C. The rare earth element content in the bacterial cells was determined using ICP-OES. The results showed that TR-21 recovered 72% of La and 89% of Sm.

[0097] Preparation of La and Sm mixed rare earth solution: Take 100 mL of ultrapure water and add 10 μL each of the above 1 mol / L La and Sm rare earth mother liquor to obtain a mixed rare earth solution with a final concentration of 0.1 mmol / L for La and Sm.

[0098] Example 3: Determination of the extracellular rare earth ion mineralization ability of TR-21 strain

[0099] (1) Adsorption was performed according to the method in Example 2(1), with the adsorption time extended to 30 days. After collection and washing, the bacteria were resuspended in ultrapure water to obtain TR-21 suspension. 100 μL of TR-21 bacterial suspension was added dropwise onto a copper electron microscope grid covered with a 200-mesh carbon film placed on a wax tray. After the bacteria settled for 15 min, the copper electron microscope grid was removed from the wax tray and placed on filter paper for drying. After drying for 20 min, the sample was prepared for transmission electron microscopy. The sample was observed using a 100 kV transmission electron microscope, and high-resolution TEM-EDS was used to perform elemental analysis on the high electron density points.

[0100] The results are as follows Figure 2As shown, after 30 days of biosynthesis, TR-21 can form stable nanoscale rare earth salts extracellularly using La(III), Ce(III), Pr(III), and Nd(III). Specifically, TR-21 uses crystals mineralized from La(III), Ce(III), and Pr(III) with lengths between 500-900 nm and widths around 50 nm, resembling nanowires. Clear lattice structures can be observed under HRTEM, with lattice spacings of 0.3125 nm, 0.3060 nm, and 0.3081 nm for La, Ce, and Pr, respectively. Comparison with the JCPDS standard card shows that these three crystals are monoclinic phases: LaPO4(120) = 0.3127 nm, CePO4(200) = 0.3040 nm, and PrPO4(120) = 0.3085 nm. The crystals of TR-21 mineralized extracellularly with Nd(III) have lengths between 300-400 nm and widths between 20-30 nm, and their shapes are similar to nanowires. Compared with crystals mineralized with La(III), Ce(III), and Pr(III), the crystals of TR-21 mineralized with Nd(III) are smaller, but a clear lattice structure can still be observed under HRTEM. Its lattice spacing is 0.3022 nm, and comparison with the JCPDS standard card shows that the crystal is a monoclinic NdPO4(200) = 0.3020 nm. The rare earth salts of TR-21 mineralized extracellularly with Sm(III), Eu(III), and Gd(III) have two forms: one is a nanowire-like crystal similar to La(III), with lengths between 300-500 nm and widths between 20-30 nm, and lattice fringe plane spacings of 0.3040 nm, 0.3033 nm, and 0.3025 nm, respectively. Their lattice fringe plane spacings were compared with the JCPDS standard card, and the results showed that the three crystals were monoclinic phases: SmPO4(120) = 0.3043 nm, EuPO4(-120) = 0.3034 nm, and GdPO4(120) = 0.3024 nm. Another type was a fine-line shape, with lengths between 300-500 nm, but the width was too thin to measure, and no obvious lattice structure could be observed under HRTEM. However, the rare earth salts mineralized extracellularly by TR-21 using Tb(III), Dy(III), and Ho(III) were all fine-line shaped, with lengths of approximately 100 nm, and were biosynthesized extracellularly using Er(III), Tm(III), Yb(III), and Lu(III) to form sheet-like or hydrogel-like structures. No obvious lattice structure was observed under HRTEM. HRTEM-EDS elemental analysis of all nanowires, fine wires, and platy / hydrogel-like rare earth minerals mineralized in TR-21 revealed the presence of REE(III), P, O, and C in the mineralization product region. This further indicates that REE(III) interacts with PO4 on the bacterial surface.3- After combining, it forms a mineral phase with PO4. 3- Coexistence. In other words, the synthesized rare earth salt is REEPO4.

[0101] To verify that TR-21 maintains this biosynthetic form for mixed rare earth elements, this invention selected La and Sm elements for mixed adsorption. After 2 hours of adsorption, a rare earth nanoparticle with a diameter of approximately 50 nm and relatively smooth edges appeared on the surface of each bacterium (e.g., ...). Figure 3 As shown in Figure B). After 19 hours, there were no significant changes in the size and morphology of the particles, but two or more particles appeared on the surface of each bacterium (as shown in Figure B). Figure 3 As shown in C). After 150 hours, the edges of the particles exhibited needle-like structures, with a size of approximately 100 nm (as shown in Figure C). Figure 3 As shown in D). After 720 hours, the maximum particle size was approximately 250 nm (as shown in Figure D). Figure 3 As shown in E). Figure 3 The F and shown Figure 3 The HRTEM image shown in Figure G clearly reveals the lattice and lattice fringes of the particles, with planar spacings of 0.3120 nm and 0.3037 nm, consistent with the standard JCPDS card, i.e., monoclinic LaPO4(120) = 0.3127 nm and monoclinic SmPO4(120) = 0.3043 nm. HRTEM-EDS results show that the rare-earth nanoparticle region contains elements of La, Sm, O, and P (e.g., ...). Figure 3 (As shown in H). All the above results indicate that the rare earth nanoparticles mineralized by TR-21 have good crystallinity, and the main components of their core are LaPO4 and SmPO4.

[0102] (2) Adsorption was performed according to the method in Example 2(1). After 360 hours, TR-21 was collected and washed, and resuspended in 2.5% glutaraldehyde for overnight fixation. The fixed bacterial suspension was centrifuged at 5000g for 3 minutes, and the supernatant was discarded. Ultrapure water was added and washed twice, and then fresh ultrapure water was added and mixed. 100 μl of the washed and mixed bacterial suspension was dropped into the center of a coverslip and allowed to settle for 2 hours. The supernatant was aspirated and subjected to gradient dehydration, using 50%, 70%, 80%, and 90% ethanol once each, and 100% ethanol twice for 10 minutes each time. Then, 100% ethanol was replaced with 100% tert-butanol three times for 10 minutes each time, for a total of 30 minutes. After 30 minutes, the sample was dried (natural drying was selected in this invention). The sample was sputter-coated with gold to complete the scanning electron microscope sample preparation. The sample was observed using a scanning electron microscope, and the results are as follows: Figure 4 As shown, when TR-21 does not adsorb rare earth elements, the bacterial cells are smooth, oval-shaped. Figure 4As shown in Figure A, the bacterial edges are more defined. After TR-21 interacted with La and Sm for 360 hours, the aggregation between bacterial cells became more severe, and more spherical nanoparticles with a size of approximately 100 nm appeared on the surface (e.g., ...). Figure 4 (As shown in B). This result indicates that TR-21 biosynthesis of REEs occurs on the surface of bacterial cells.

[0103] Example 4: Improving the yield of rare earth phosphate minerals on the surface of TR-21 using genetic engineering technology

[0104] (1) Insert the target gene fragment into the vector plasmid

[0105] DNA sequences of molecular chaperones DegP (NC_000913.3(180884..182308)), Skp (NC_000913.3(200482..200967)), and SurA (NC_000913.3(53416..54702,complement)) were obtained from the DNA sequence database (GenBank, National Center for Biotechnology Information, and were used as target genes. They are involved in the synthesis of outer membrane proteins. The vector plasmids pCM62 (SEQ ID No. 3) or pCM66 (SEQ ID No. 4) present in Pseudomonas were digested with restriction enzymes (pCM62: HindIII and XbaI; pCM66: XbaI and BamHI). Simultaneously, the molecular chaperones DegP (NC_000913.3(180884..182308)), Skp (NC_000913.3(200482..200967)), or SurA (NC_000913.3(53416..54702,complement)) used as the target gene were digested with the same restriction enzymes to produce identical sticky ends in the target gene. An appropriate amount of DNA ligase was added, and the target gene fragment was inserted into the plasmid cut to form a recombinant plasmid carrying the target gene. To facilitate the detection of whether the target gene can be expressed in TR-21 cells, a 6×His tag gene can be inserted into the plasmid as a marker gene to facilitate the detection of whether the target gene can be expressed in TR-21 cells.

[0106] (2) The recombinant plasmid was transformed and introduced into TR-21 for expression.

[0107] TR-21 strain was treated with CaCl2 to form competent cells. The recombinant vector plasmid was co-incubated with the competent cells, and the target gene and marker gene were transformed and introduced into the cells along with the plasmid. SDS-PAGE was used to detect the expression of the target gene, and the results are as follows: Figure 5As shown, this indicates that the target gene has been successfully introduced into TR-21 cells and can be stably expressed within TR-21 cells. The adsorption capacity of the engineered TR-21 strain for rare earth elements was tested using the method in Example 2. The results are shown in Table 2. The introduction of the recombinant plasmid improved the adsorption capacity of the TR-21 strain, thereby also increasing the mineralization of rare earth phosphates.

[0108] Table 2. Adsorption capacity of engineered TR-21 strain (SurA) for fourteen rare earth ions.

[0109]

[0110]

[0111] Example 5: Enhancing the specificity of TR-21 for certain rare earth ions using genetic engineering techniques

[0112] The gene sequences of polyphosphokinase 2 (ppk2, NC_000962.3(3608870..3609757, complement)) and the strong promoter of P_mxaF (SEQ ID No. 7) were obtained from the DNA sequence database and used as the target gene. ppk2 participates in and catalyzes the synthesis of polyphosphate (polyP). The 6×His gene was selected as a tag to facilitate the detection of whether the target gene can be expressed in TR-21 cells. Following the method in Example 4(1), this target gene and the tag gene were inserted into the vector plasmid pCM62 or pCM66. Then, according to Example 4(2), the recombinant plasmid was transformed into TR-21 cells, and the expression of the target gene was detected by SDS-PAGE. The results are as follows: Figure 6 As shown, this indicates that the target gene has been successfully introduced into TR-21 cells and can be stably expressed within TR-21 cells. The specific adsorption capacity of the engineered TR-21 strain for rare earth elements was tested using the method in Example 2. The results are shown in Table 3. The introduction of the recombinant plasmid improved the specific adsorption capacity of the TR-21 strain for light and medium rare earth elements, and significantly reduced the adsorption capacity of the engineered TR-21 strain for heavy rare earth elements (P < 0.05).

[0113] Table 3. Detection of the specific adsorption capacity of engineered TR-21 strain for fourteen rare earth ions.

[0114]

[0115] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing recombinant bacterial strains, characterized in that, Based on Pseudomonas kunmingensis TR-21 with accession number CGMCC No. 26447, recombinant strains were obtained by expressing any of the following: (I) The gene encoding the molecular chaperone SurA; or (II) The gene encoding polyphosphokinase 2 and P mxaF Strong starter.

2. The recombinant strain obtained by the preparation method according to claim 1.

3. A microbial inoculant, characterized in that, Includes the recombinant strain as described in claim 2, as well as acceptable excipients and / or auxiliaries.

4. The application of the recombinant strain as described in claim 2 or the microbial agent as described in claim 3 in the adsorption of rare earth ions: The rare earth ions adsorbed by the recombinant strain expressing the gene encoding the molecular chaperone SurA are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu. The gene encoding polyphosphokinase 2 and P mxaF The rare earth ions adsorbed by the recombinant strain with the strong promoter are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, and Tb.

5. The application of the recombinant strain as described in claim 2 or the microbial agent as described in claim 3 in biomining and / or tailings development and utilization: The biomining and / or tailings development is for the adsorption of rare earth ions; The rare earth ions adsorbed by the recombinant strain expressing the gene encoding the molecular chaperone SurA are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu. The gene encoding polyphosphokinase 2 and P mxaF The rare earth ions adsorbed by the recombinant strain with the strong promoter are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, and Tb.

6. Any of the following applications in the preparation of rare earth nanoscale or microscale particles: (I) Pseudomonas kunmingensis TR-21 with accession number CGMCC No. 26447; or (II) The recombinant strain as described in claim 2; or (III) The microbial agent as described in claim 3; The rare earth elements are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu.

7. A method for adsorbing rare earth ions, characterized in that, Adsorption is based on any of the following terms: (I) The recombinant strain as described in claim 2; or (II) The microbial agent as described in claim 3; The rare earth ions adsorbed by the recombinant strain expressing the gene encoding the molecular chaperone SurA are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu. The gene encoding polyphosphokinase 2 and P mxaF The rare earth ions adsorbed by the recombinant strain with the strong promoter are selected from La, Ce, Pr, Nd, Sm, Eu, Gd, and Tb.

8. The method as described in claim 7, characterized in that, Adsorption based on any of the following factors when mixed with rare earth solutions: (I) The recombinant strain as described in claim 2; or (II) The microbial agent as described in claim 3.

Citation Information

Patent Citations

  • Pseudomonas kunming and application thereof

    CN116426434A