An SNP molecular marker related to porcine reproductive traits and pig breeding and its application

By discovering SNP molecular markers at the rs345310133 locus in the pig PCCB gene, designing primer pairs for PCR amplification and sequencing analysis, screening individuals carrying T alleles, solving the problem of breeding pig breeding traits and improving the breeding efficiency of pig breeding traits.

CN116590429BActive Publication Date: 2025-08-01HUBEI FENGMEIHE ECOLOGICAL ANIMAL HUSBANDRY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310581611.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-23
Publication Date
2025-08-01
Estimated Expiration
2043-05-23

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve pig breeding traits, especially the total litter count and healthy litter count, and the SNP sites related to the PCCB gene and pig breeding traits have not been reported, resulting in breeding difficulties.

Method used

SNP molecular markers at the rs345310133 locus in the PCCB gene were discovered and used to design primer pairs for PCR amplification and sequencing analysis, individuals carrying T alleles were screened, and individuals carrying C alleles were eliminated to improve pig reproductive traits.

Benefits of technology

Early screening and rapid breeding of pig breeding traits was achieved, the total number of litters and healthy litters were increased, and the screening method was simplified.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116590429B_ABST
    Figure CN116590429B_ABST
Patent Text Reader

Abstract

The present invention discloses an SNP molecular marker related to porcine reproductive traits and pig breeding and its application, which relates to the technical field of porcine molecular markers. The reproductive traits are total litter size and number of healthy piglets; the molecular marker is located in a partial DNA sequence of the porcine PCCB gene, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1 in the sequence listing, and the sequence length is 713bp; the molecular marker includes an SNP at the rs345310133 locus; there is a C / T base mutation at the 387bp of the sequence. The present invention discovers for the first time that an SNP molecular marker in the porcine PCCB gene is related to the traits of total litter size and number of healthy piglets in pigs, so it can be used for pig marker-assisted selection breeding, that is, it provides a new use of an SNP molecular marker in the porcine PCCB gene in marker-assisted breeding of porcine reproductive traits, realizing the early screening of porcine reproductive traits, and the screening method is simple and rapid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of swine molecular markers, and particularly relates to an SNP molecular marker related to swine reproductive traits and swine breeding. Background Art

[0002] The genetic improvement of swine reproductive traits has increasingly attracted the attention of breeders. The total number of piglets born and the number of healthy piglets are several important indicators for evaluating swine reproductive traits. Improving the total number of piglets born and the number of healthy piglets in swine is of great significance for improving the overall economic benefits of the swine industry. However, due to the low heritability of swine reproductive traits, around 0.1, it is relatively difficult to improve them through conventional breeding. Therefore, finding molecular markers that affect reproductive traits and using molecular-assisted breeding is of great significance for improving swine reproduction.

[0003] The PCCB gene (propionyl-CoA carboxylase subunit beta, PCCB) is located on swine chromosome 13 and is involved in the decomposition of lipids, cholesterol, and amino acids. Variations in this gene can cause propionic academia. Currently, there is no report on SNP loci of the PCCB gene related to swine reproductive traits. Therefore, the discovery of this marker has potential important value for the genetic improvement of swine reproductive traits. Summary of the Invention

[0004] The purpose of the present invention is to overcome the defects of the prior art and provide an SNP molecular marker related to swine reproductive traits and swine breeding and its application. The present invention has found that a certain SNP in the PCCB gene is associated with swine reproductive traits and can be used as a molecular marker for screening swine reproductive traits and swine breeding.

[0005] In order to achieve the above technical purpose, the present invention mainly adopts the following technical solutions:

[0006] In the first aspect, the present invention provides an SNP molecular marker related to swine reproductive traits and swine breeding, wherein the reproductive traits are the total number of piglets born and the number of healthy piglets; the molecular marker is located in a partial DNA sequence of the swine PCCB gene, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1 in the sequence listing, and the sequence length is 713 bp; the molecular marker includes an SNP at the rs345310133 locus; there is a C / T base mutation at the 387th bp of the sequence.

[0007] Furthermore, the C or T base polymorphism site at the 387th bp in the sequence SEQ ID NO.1 shows three genotypes: CC, CT, or TT, and the T allele is the dominant allele.

[0008] In the second aspect, the present invention provides an application of the SNP molecular marker as described in the first aspect in screening swine reproductive traits and swine breeding.

[0009] In a third aspect, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, wherein the primer pair comprises: the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3.

[0010] In a fourth aspect, the present invention provides an application of the primer pair as described in the third aspect in the screening of porcine reproductive traits and pig breeding.

[0011] In a fifth aspect, the present invention provides a kit for rapid breeding using the SNP molecular marker related to porcine reproductive traits and pig breeding as described in the first aspect, which contains the primer pair as described in the third aspect.

[0012] In a sixth aspect, the present invention provides a method for pig breeding, which comprises:

[0013] S1. Extracting genomic DNA of pigs;

[0014] S2. Using the genomic DNA obtained in step S1 as a template, performing PCR amplification with the primer pair as described in claim 4 to obtain the molecular marker as described in claim 1 and purifying it;

[0015] S3. Performing sequencing analysis on the molecular marker purified in step S2, retaining the individuals carrying the T allele at the 387th bp of the sequence, and eliminating the individuals carrying the C allele.

[0016] Preferably, in step S1, genomic DNA is extracted from the ear edge tissue of the pigs to be tested.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention has for the first time discovered that a SNP molecular marker (rs345310133) in the porcine PCCB gene is related to porcine reproductive traits, specifically the total number of piglets born and the number of healthy piglets. Therefore, this molecular marker can be used for screening porcine reproductive traits and breeding, that is, it provides a new use of a SNP molecular marker in the porcine PCCB gene for marker-assisted breeding of porcine reproductive traits, realizing the early screening of porcine reproductive traits, and the screening method is simple and rapid. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the agarose gel electrophoresis detection map of the PCR product in Example 1 of the present invention, wherein lane M is DL2000 Marker, and lanes 1-3 are the amplified fragments in black pigs, and the fragment size is 713 bp;

[0019] Figure 2 It is the sequencing map of the g.77221540C>T locus in Example 1 of the present invention; Detailed implementation mode

[0020] The following will combine the embodiments in the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0021] Example 1 Obtaining of SNP detection fragment of porcine PCCB gene and establishment of polymorphism locus detection method

[0022] 1. Extraction of porcine genomic DNA

[0023] The experimental pig breed of the present invention is Large White pigs. The porcine genomic DNA is extracted using the Animal Tissue Genomic DNA Extraction Kit (PureLink TM Pro 96 Genomic DNA Purification Kit, K182104A) produced by Invitrogen Corporation, and the porcine genomic DNA is extracted according to the instructions of this kit. The extracted DNA is detected for concentration and quality, and stored at -20 °C for standby.

[0024] 2. Obtaining of SNP genetic marker detection fragment of porcine PCCB gene

[0025] (1) PCR amplification

[0026] According to the SNP genetic marker detection sequence (as shown in SEQ ID NO.1) in the genomic sequence of porcine PCCB gene (GenBank ID: NC_010447), a pair of primers are designed to amplify the fragment of the polymorphic locus. The primers are as follows:

[0027] Forward primer: 5'AGACCCTTCACAAAGCCTGC 3'

[0028] Reverse primer: 5'GTCAGAGGCACCTTGCACA 3'

[0029] Using the above primers, with large white pig genomic DNA as the template, PCR amplification is carried out. The PCR reaction system is 50 μL, and the components in the system are: genomic DNA 100 ng, PCR mix 25 μL, 1 μL of each of the above upstream and downstream primers, and ddH2O is added to make up the total volume to 50 μL.

[0030] The PCR running program is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 10 min; preservation at 4°C. The PCR products were detected by 1.5% agarose gel electrophoresis, and the detection results are as follows Figure 1 shown, where lane M is DL2000 Marker, and lanes 1-3 are the amplified fragments in Large White pigs. The size of the amplified fragment is 713 bp, and its sequence is as shown in SEQ ID NO.1.

[0031] SEQ ID NO.1:

[0032] AGACCCTTCACAAAGCCTGCTTTAGGTTTCCACCTCCTGCTTCTCCATTCTTCTTTTTGTTGCTCCTTAGGTCTCTAGTAATGTTTATGGAACTAGTTACCTTGTTCCAAGGTCAGGCTCTCCTTACCCCCACGTCTCTCCGGCTTTCCCTCCTACTCTTTTATTTGCCTTCCACGTTAGTGACTCCTGGAGCAGCCTTGGTATCCTTGCTGGCTTAATTCTACTGGTAACTCTTGTCTCTTGGGCAGGATGATGGAATATAGGCTTTCACATGGGGCGGAGGCAAAATCAGCCCTCCTGGCCCTCCCATGACATCACTAAGTGATTTTTGTTGCATTTTAGGGAAAGCTAACGGCCAGAGAACGGATCAGTCTCTTGCTGGACCCCGGCAGTTTTATTGAGAGTGACATGTTTGTGGAACACAGATGTGCAGATTTTGGAATGGCTGCTGACAAGAATAAGGTATCTGTTCACAGTGGTGGTACAAGCCTACAAATTACCCGTAGCAGCTATGGCCCTGCTGGCCTACCCAATAGACAAATGAAGTTCTTCCAGGACTCAGGATACATTGAAAACTTTTCAAGGGTGGGGCCCTGGAATTCTCAAAGTGCCTATTGAGAAGCACTATTGGGGCCTCCCGGTTCCCACTCACCTTTGTCTGCAGATGAAGAATATGGGTAGCCAGCCTATACCTTGTGCAAGGTGCCTCTGAC。

[0033] (2) Purification of PCR products

[0034] The above PCR amplification products were purified using the Gel Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd. For the specific steps, please refer to the kit instruction manual.

[0035] 3. Detection of molecular markers using direct sequencing of PCR products

[0036] The above-obtained PCR purified products were directly sent to AuGCT (Beijing) for sequencing. According to the sequencing results, the genotypes of this locus in the tested population were determined. SeqMan software was used for analysis, and the results are shown in the appendix Figure 2 As shown, a C>T allelic gene mutation was found at the 387bp position in this sequence, namely g.10953632C>T. The above mutation caused polymorphism of the PCCB gene.

[0037] Example 2 Detection of the polymorphism distribution of molecular markers in Large White pigs

[0038] In this example, the polymorphism distribution pattern of the g.10953632C>T locus of the porcine PCCB gene was detected in 1100 Large White pigs. The detection results are shown in Table 1.

[0039] Table 1 Polymorphism distribution pattern of the g.10953632C>T locus of the PCCB gene

[0040]

[0041] As can be seen from the results in Table 1: At the g.10953632C>T locus of the PCCB gene in Large White pigs, there are three genotypes: CC, CT, and TT. Among them, there are more individuals with the CC genotype, and the allelic frequency of CC is 56.27%.

[0042] Example 3 Association analysis between molecular markers and porcine reproductive traits

[0043] To determine whether there is a correlation between the g.10953632C>T locus of the porcine PCCB gene and differences in porcine reproductive traits, the method established in Example 1 was used for polymorphism detection, and the correlation between different genotypes of this polymorphic locus and the traits of total number of piglets born and number of healthy piglets was analyzed. The GLM model of SAS 19.0 software was used for association analysis of the variant locus. The model used was:

[0044] Y ijk = μ + G i + A j + S k + e ijk ,

[0045] Among them: Y ijk represents the phenotypic value; μ represents the population mean; Gi represents the genotype effect; A j represents the year-season effect; S k represents the sire effect; e ijk represents the random residual effect. Differences are considered significant when P < 0.05; differences are considered extremely significant when P < 0.01.

[0046] An association analysis was conducted between different genotypes and the traits of total number of piglets born alive and number of healthy piglets in Large White pigs. The statistical analysis results are shown in Table 2:

[0047] Table 2 Association analysis of the g.10953632C>T locus of the PCCB gene with pig reproductive traits

[0048]

[0049] Note: The trait means in the table are composed of mean ± standard deviation, and A and B indicate extremely significant differences (P < 0.01). [[ID=2,0]]

[0050] As can be seen from Table 2, in Large White pigs, the total number of piglets born alive and the number of healthy piglets of individuals with the TT genotype at the g.10953632C>T locus are extremely significantly higher than those of individuals with the CC genotype (P < 0.01). Therefore, the T allele is the dominant allele, and individuals carrying this dominant allele should be retained in breeding to improve the traits of the total number of piglets born alive and the number of healthy piglets in the population.

[0051] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention should be covered by the protection scope of the present invention.

Claims

1. Application of SNP molecular markers in screening for porcine reproductive traits and pig breeding, wherein the reproductive traits are total number of piglets born and number of healthy piglets; the molecular markers are located in a partial DNA sequence of the porcine PCCB gene, and the nucleotide sequence of the molecular markers is as shown in SEQ ID NO.1 in the sequence listing, and the sequence length is 713bp; the molecular markers include SNPs at the rs345310133 locus; there is a C / T base mutation at the 387bp of the sequence.

2. The application according to claim 1, characterized in that, The C or T base polymorphism locus at the 387bp of the sequence SEQ ID NO.1 shows three genotypes: CC, CT or TT, and the T allele is the dominant allele.

3. The application according to claim 1, wherein A primer pair for amplifying the molecular marker, including: the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.

3.

4. A breeding method for porcine reproductive traits, characterized in that, The reproductive traits are total number of piglets born and number of healthy piglets; the method includes: S1. Extract genomic DNA from pigs. S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification with the primer pair to obtain the molecular marker and purify it. S3. Perform sequencing analysis on the molecular marker purified in step S2, retain the individuals carrying the T allele at the 387bp of the sequence, and eliminate the individuals carrying the C allele. The primer pair includes: the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.

3. The molecular markers are located in a partial DNA sequence of the porcine PCCB gene, and the nucleotide sequence of the molecular markers is as shown in SEQ ID NO.1 in the sequence listing, and the sequence length is 713bp; the molecular markers include SNPs at the rs345310133 locus; there is a C / T base mutation at the 387bp of the sequence.

5. The breeding method according to claim 4, characterized in that, In step S1, genomic DNA is extracted from the ear edge tissue of the pigs to be tested.