KASP molecular marker for watermelon fruit skin mottle trait and use thereof
By developing KASP molecular markers ClM10 and ClM16, the problem of screening for watermelon rind mottled traits was solved, enabling rapid and economical identification and improvement of rind patterns in watermelon breeding.
Patent Information
- Application Number
- CN202411150816.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-21
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-08-21
AI Technical Summary
Existing technologies are insufficient for efficiently screening watermelon rind blemishes, which affects breeding efficiency and the improvement of appearance quality.
KASP molecular markers ClM10 and ClM16 were developed for rapid identification of watermelon rind mottled traits, and genotype identification was achieved through PCR amplification and fluorescence signal analysis.
This technology enables rapid phenotypic screening of watermelon seedlings, reduces breeding costs, improves screening efficiency, shortens the trait identification cycle, and enhances the diversity of fruit rind patterns.
Smart Images

Figure CN118792444B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of vegetable commodity trait molecular marker development and molecular marker assisted breeding, and particularly relates to a KASP molecular marker suitable for rapid screening of watermelon fruit skin mottle traits and use thereof. BACKGROUND
[0002] Watermelon (Citrullus lanatus) is an important horticultural economic crop, which is deeply loved by consumers because of its sweet and juicy flesh. In addition, the surface pattern of the fruit skin is an important appearance quality trait, which will directly affect the consumer's choice (Encinas-Viso et al., 2014). Novel and unique fruit skin patterns can attract more consumers (Wang et al., 2022). With the increasing demand for quality life, appearance quality has become the focus of modern watermelon breeding work. Therefore, clarifying the molecular regulation mechanism of watermelon skin mottle traits and excavating the genes controlling fruit skin pattern formation can provide theoretical support for the molecular improvement of appearance traits.
[0003] The appearance quality of fruit is determined by its skin, which is usually the part of the fruit developed from the tissue differentiation of the ovary wall. The phenotypic formation of different colors and patterns in the skin is mainly caused by the accumulation of pigments, and this growth and development process is regulated by multiple functional genes and transcription factors (Zhao and Liu, 2011). There have been many studies on the molecular regulation of fruit skin pigment accumulation in crops such as citrus (Lu et al., 2018), apple (Telias et al., 2011), tomato (Fernandez-Moreno et al., 2016), and pear (Qian et al., 2014). Watermelon fruit skin patterns are caused by uneven fruit skin cell differentiation, expansion, and pigment deposition, and fruit skin characteristics include stripe width, color, and background color (Zhang et al., 2023). The dominance relationship of five alleles related to watermelon fruit skin pattern traits is G>gW>gM>gN>g (Lou and Wehner, 2016). In previous studies, a series of related loci or genes controlling fruit skin stripes have been identified in watermelon, such as wide and narrow stripes, deep and shallow stripes, and skin color (Kumar and Wehner, 2011; Lou and Wehner, 2016; Zhang et al., 2017). To enrich the diversity of watermelon appearance quality, we developed two molecular markers highly linked to watermelon fruit skin mottle traits in this study, in order to provide technical support for molecular marker-assisted improvement of watermelon fruit skin appearance, and to develop a stable and high-throughput molecular marker method.
[0004] The references involved in the above are as follows:
[0005] Zhang L,Wu JC,Zhang HY,et al.Progress in Functional Genes of Important Traits in Watermelon[J].Acta Horticulturae,2023,
[0006] 50(12):2748-2764.
[0007] Zhao RZ,Liu MT.Relationship between Fruit Color and Pigment Composition in Tomato[J].Henan Agricultural Sciences,2011,
[0008] 40(09):98-100.
[0009] Encinas-Viso F,Revilla T A,van Velzen E,et al.Frugivores and cheap fruits make
[0010] fruiting fruitful[J].Journal of Evolutionary Biology,2014,27(2):313-324.Fernandez-Moreno J P,Tzfadia O,Forment J,et al.Characterization of a new
[0011] pink-fruited tomato mutant results in the identification of a nullallele of the
[0012] slmyb12 transcription factor[J].Plant Physiology,2016,171(3):1821-1836.Kumar R,Wehner T C.Discovery of second gene for solid dark green versuslight
[0013] green rind pattern in watermelon.Journal of Heredity,2011,102(4):489-493Lou L,Wehner T C.Qualitative inheritance of exteral fruit traits inwatermelon[J].
[0014] Hortscience,2016,51(5):487-496.
[0015] Lu S, Zhang Y, Zhu K, et al. The citrus transcription factor CsMADS6 modulates
[0016] carotenoid metabolism by directly regulating carotenogenic genes[J]. Plant
[0017] Physiology, 2018, 176(4): 2657-2676
[0018] Qian M, Sun Y, Allan A C, et al. The red sport of 'Zaosu' pear and its red-striped
[0019] pigmentation pattern are associated with demethylation of the PyMYB10
[0020] promoter[J]. Phytochemistry, 2014, 107: 16-23.
[0021] Telias A, Kui L W, Stevenson D E, et al. Apple skin patterning is associated with
[0022] differential expression of MYB10[J]. BMC Plant Biology. 2011, 11(1): 93. Wang D, Zhang M, Xu N, et al. Fine mapping a ClGS gene controlling dark-green
[0023] stripe rind in watermelon[J]. Scientia Horticulture, 2022, 291: 110583. Zhang Z P, Zhang Y N, Sun L, et al. Construction of a genetic map for Citrullus
[0024] Identification of a major quantitative trait locus for rind pattern based on CAPS markers and mapping of three qualitative traits[J].
[0025] Scientia Horticulturae, 2017, 233: 532-538. SUMMARY
[0026] The purpose of the present application is to provide a KASP molecular marker for rind pattern of watermelon and its use, and the molecular marker ClRP (Rind pattern) obtained in the present application is a gene marker for rind pattern gene of watermelon, which can be used for assisted selection breeding of rind pattern of watermelon.
[0027] In order to achieve the above purpose, as a first aspect, the present application provides a KASP molecular marker for rind pattern of watermelon, which comprises ClM10 and ClM16; ClM10 is located at 32351665bp of watermelon chromosome 2, and the sequence of 50bp before and after is shown as SEQ ID NO. 1 or SEQ ID NO. 2; ClM16 is located at 32250756bp of watermelon chromosome 2, and the sequence of 50bp before and after is shown as SEQ ID NO. 3 or SEQ ID NO. 4.
[0028] Further, the KASP molecular marker ClM10 genotype is A or C, the sequence of 50bp before and after the C genotype is shown as SEQ ID NO. 1, and the corresponding phenotype is rind with stripes; the sequence of 50bp before and after the A genotype is shown as SEQ ID NO. 2, and the corresponding phenotype is rind with flower spots; the ClM16 genotype is C or T, the sequence of 50bp before and after the C genotype is shown as SEQ ID NO. 3, and the corresponding phenotype is rind with stripes; the sequence of 50bp before and after the T genotype is shown as SEQ ID NO. 4, and the corresponding phenotype is rind with flower spots.
[0029] As a second aspect, the present application provides a use of the above KASP molecular marker in identifying rind pattern of watermelon.
[0030] Further, the molecular marker primer is selected from the following primer pairs, and the nucleotide sequence is 5'-3':
[0031] ClM10 (Cla97Chr02:32,351,665):
[0032] The forward primer (F-HEX) is shown as SEQ ID NO. 5:
[0033] GAAGGTCGGAGTCAACGGATTTTTTTGAAAGCCACGACAGCA
[0034] Forward primer (F-FAM) as shown in SEQ ID NO. 6:
[0035] GAAGGTGACCAAGTTCATGCTTTTTTGAAAGCCACGACAGCC
[0036] Reverse primer (R) as shown in SEQ ID NO. 7:
[0037] TGGGAACTTAGGGCTATTTTTTCTC
[0038] ClM16 (Cla97 Chr02: 32,250,756):
[0039] Forward primer (F-HEX) as shown in SEQ ID NO. 8:
[0040] GAAGGTCGGAGTCAACGGATTGTAGATCGCGATAGACTACTATT
[0041] Forward primer (F-FAM) as shown in SEQ ID NO. 9:
[0042] GAAGGTGACCAAGTTCATGCTGTAGATCGCGATAGACTACTATC
[0043] Reverse primer (R) as shown in SEQ ID NO. 10:
[0044] TCACTGTCTACTTGCGATAGATTAC
[0045] Further, the use of the KASP molecular marker in identifying the watermelon fruit peel flower spot trait comprises the following steps:
[0046] (1) extracting the genomic DNA of the watermelon variety to be tested;
[0047] (2) using the KASP molecular marker to perform PCR amplification on the watermelon genomic DNA;
[0048] (3) According to the difference of the fluorescence signal of the PCR amplification result, the genotype of each watermelon to be tested is identified; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence linker color of the forward primer F-HEX, then the watermelon to be tested is a homozygous genotype CC; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence linker color of the forward primer F-FAM, then the watermelon to be tested is a homozygous genotype TT; if the fluorescence signal color of the PCR amplification result is different from the fluorescence linker color of the forward primer F-HEX and the forward primer F-FAM, then the watermelon to be tested is a heterozygous genotype CT.
[0049] Further, in the step (2), the PCR reaction system used for PCR amplification is: 20-50 ng / ul watermelon genomic DNA 5.0 ul, KASP Master Mix 5.0 ul, KASP Assay Mix 0.14 ul, a total of 10.14 ul; the KASP Assay Mix includes forward primer F-HEX, forward primer F-FAM and reverse primer R, and the molar concentration ratio is 2:2:5; the PCR reaction program is: 30 DEG C, read the fluorescence signal for 1 minute; 94 DEG C, pre-denaturation for 15 minutes; 94 DEG C, denaturation for 20 seconds; 61 DEG C, annealing for 60 seconds, 10 cycles; 94 DEG C, denaturation for 20 seconds; 55 DEG C, annealing for 60 seconds, 31 cycles; 30 DEG C, read the fluorescence signal for 1 minute.
[0050] The application also simultaneously provides the use of the above-mentioned molecular marker ClRP: for molecular assisted selection breeding of watermelon fruit peel flower spot lines or their offspring.
[0051] Further, the use of the molecular marker ClRP is specifically: taking the fruit peel pattern gene donor ZJU129 watermelon as the male parent, the fruit peel striped watermelon ZJU132 as the female parent, hybridizing to obtain F1 generation, then backcrossing, self-crossing, combining marker assisted selection, selecting single plants consistent with the genotype of ZJU129 in the segregation population for breeding improvement, and directionally selecting and improving the traits of the outer skin of watermelon.
[0052] The application also simultaneously provides a development method of the above-mentioned molecular marker ClRP, comprising the following steps:
[0053] (1) hybridizing the material ZJU129 with white block-shaped flower spots on the fruit peel surface and the material ZJU132 with deep green regular striped fruit peel surface as the parents, and then self-crossing to obtain F2, F3 genetic populations with fruit peel pattern segregation;
[0054] (2) extracting the genomic DNA of the young plant of the watermelon variety to be tested;
[0055] (3) Selecting the extreme fruit skin pattern materials in F2 population to construct the variegated bulk and striped bulk, and using BSA (Bulked Segregant analysis) to locate the region and gene related to the fruit skin variegation;
[0056] (4) Identifying the SNP variation and InDel insertion and deletion variation closely linked to the fruit skin variegation of watermelon.
[0057] (5) Based on the linked variation, using KASP (Kompetitive Allele Specific Polymerase Chain Reaction) method to screen the molecular marker of watermelon fruit skin variegation;
[0058] (6) Developing the KASP molecular marker ClRP closely linked to the fruit skin variegation of watermelon.
[0059] The beneficial effects of the present application mainly reflect in:
[0060] (1) The present application can replace the phenotype identification of fruit skin pattern of watermelon, and the phenotype screening can be carried out at the seedling stage of watermelon, so that the breeding screening difficulty is reduced, and the breeding cost is saved.
[0061] (2) The KASP marker can be high-throughput and rapid detection, and the breeding screening efficiency is improved.
[0062] (3) The present application can be used to predict the fruit skin pattern phenotype of unknown germplasm at the seedling stage of watermelon, which greatly shortens the trait identification period. BRIEF DESCRIPTION OF DRAWINGS
[0063] The specific embodiments of the present application will be further described in detail below with reference to the accompanying drawings. The following are all taken as an example of ClM16 marker, and the steps of ClM10 marker are the same as follows, wherein the genotype AA shows variegated type, CC shows striped type, and AC shows F1 heterozygous.
[0064] Figure 1 (a) is the fruit skin phenotype of striped parent material ZJU132, variegated parent material ZJU129 and F1; (b) is the fruit skin separation phenotype appearing in F2 population;
[0065] Figure 2 is the genotyping diagram of ClRP molecular marker of parent materials ZJU129 and ZJU132 and F1 thereof; wherein, the blue dot represents the genotype of ZJU132, which shows homozygous CC; the red dot represents the genotype of ZJU129, which shows homozygous TT; the green dot represents the genotype of F1, which shows heterozygous CT; the black represents negative control without fluorescent signal;
[0066] Figure 3 is a genotyping map of ClRP molecular markers of different fruit skin pattern watermelon material hybrid F2 generation population;
[0067] Figure 4 is the fruit skin flower stripe trait phenotype distribution of different genotypes watermelon hybrid F2 population;
[0068] Figure 5 is a genotyping map of ClRP molecular markers of different fruit skin pattern traits in representative watermelon germplasm resources. DETAILED DESCRIPTION
[0069] The application will be further described below in conjunction with specific examples, but the protection scope of the application is not limited to this:
[0070] Example 1, main effect QTL positioning of watermelon fruit skin flower spot trait
[0071] The high-generation inbred line ZJU129 was selected as the male parent, and the phenotype was that the fruit skin surface was covered with flower spots; ZJU132 was selected as the female parent, and the fruit skin had regular stripes. After hybridization of the above-mentioned parents, F2 generation genetic population was constructed and the phenotype of each single plant was observed and recorded.
[0072] The genomic DNA of the watermelon parent and F2, F3 population single seedlings was extracted; the extreme phenotype material of the offspring was selected to construct a BSA pool, and genome resequencing was performed, and correlation analysis was performed by G' value and △SNP-index two methods, and 95% confidence interval was selected, and an interval located at 2, 28,762,338-32,793,200 bp was located.
[0073] Example 2, development of KASP molecular markers of watermelon fruit skin flower spot trait
[0074] According to the gene positioning result of example 1, the SNPs and InDels of the two parent materials in the candidate interval of chromosome 2 were extracted and analyzed, and the related molecular markers were developed by using KASP technology for fine mapping.
[0075] The specific method is as follows:
[0076] I. DNA extraction
[0077] The CTAB (Hexadecyl trimethyl ammonium bromide) method was used to extract the genomic DNA of the watermelon parent seedlings and the hybrid offspring F2, F3 population seedlings.
[0078] II. PCR amplification
[0079] PCR reaction system: 20-50 ng / ul watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (molar concentration ratio FAM:HEX:R=2:2:5, the molar concentration of the above three primers is 10 ng / ul) 0.14 μl, the total volume is 10.14 μl.
[0080] PCR specific amplification procedure: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃-55℃, 1 minute (annealing), 10 cycles of touch down program, each cycle decreases by 0.6℃); 94℃, 20 seconds (denaturation); 55℃, 60 seconds (annealing), continue to amplify for 31 cycles. 30℃, 1 minute (read fluorescence signal).
[0081] PCR amplification was carried out on ABI Step One PCR instrument. The genotyping information can be directly obtained after the instrument detects the fluorescence signal, and the results are shown in Figure 2 The software automatically divides the detected samples into homozygous CC genotype, homozygous TT genotype and heterozygous CT genotype according to different genotypes.
[0082] The forward primers F-FAM and -HEX are respectively provided with their own fluorescent adapters (shown as different colors on the typing chart, for example, TT genotype is red, CC genotype is blue, and CT genotype is green). If the detected material is a homozygous genotype, only one corresponding primer will be selected for amplification during amplification (for example, homozygous TT genotype can only react with F-FAM). Finally, according to the difference in fluorescence, it is determined whether the measured material is homozygous TT genotype or CC genotype. If the detected material is a heterozygous genotype, both primers will be amplified, and the fluorescence signal produced will be different from that of the homozygous genotype, and the genotype is CT, thereby realizing the differentiation of the heterozygous genotype.
[0083] The above method takes ClM16 marker as an example, and for ClM10 marker, the corresponding primers (SEQ ID NO. 5-7) can be used.
[0084] After molecular marker screening, KASP molecular markers ClRP, including ClM10 and ClM16, which are closely linked to the watermelon fruit peel flower spot trait, are finally obtained.
[0085] ClM10 is located at 32351665 bp of watermelon chromosome 2, and the genotype is A or C. The sequence of 50 bp before and after the C genotype is shown in SEQ ID NO. 1, and the corresponding phenotype is fruit peel with stripes.
[0086] ACTAAATTAGGCCTTTTTTTAAAAAAATGGTTTTTGAAAGCCACGACAGCCTTACCACACCTATTTCTAATAACTTTCTTTGATAGAGAAAAAATAGCCCT (SEQ ID NO. 1)
[0087] The sequence of 50bp before and after the genotype A is shown in SEQ ID NO. 2, and the corresponding phenotype is fruit skin with flower spots:
[0088] ACTAAATTAGGCCTTTTTTTAAAAAAATGGTTTTTGAAAGCCACGACAGCATTACCACACCTATTTCTAATAACTTTCTTTGATAGAGAAAAAATAGCCCT (SEQ ID NO. 2)
[0089] ClM16 is located at 32250756bp of watermelon chromosome 2, and the genotype is C or T. The sequence of 50bp before and after the genotype C is shown in SEQ ID NO. 3, and the corresponding phenotype is fruit skin with stripes:
[0090] TAATAGCAAATATCACATTCTATTTGCAGTAGATCGCGATAGACTACTATCTGCTCTATCACAACACACATAGACATATATAGTAATCTATCGCAAGTAGA (SEQ ID NO. 3)
[0091] The sequence of 50bp before and after the genotype T is shown in SEQ ID NO. 4, and the corresponding phenotype is fruit skin with flower spots:
[0092] TAATAGCAAATATCACATTCTATTTGCAGTAGATCGCGATAGACTACTATTTGCTCTATCACAACACACATAGACATATATAGTAATCTATCGCAAGTAGA (SEQ ID NO. 4)
[0093] The molecular marker primer combination sequence is as follows:
[0094] ClM10 (Cla97Chr02:32,351,665):
[0095] Forward primer (F-HEX):
[0096] GAAGGTCGGAGTCAACGGATTTTTTTGAAAGCCACGACAGCA (SEQ ID NO. 5)
[0097] Forward primer (F-FAM):
[0098] GAAGGTGACCAAGTTCATGCTTTTTTGAAAGCCACGACAGCC (SEQ ID NO. 6)
[0099] Reverse primer (R): TGGGAACTTAGGGCTATTTTTTCTC (SEQ ID NO. 7)
[0100] ClM16 (Cla97 Chr02: 32,250,756):
[0101] Forward primer (F-HEX):
[0102] GAAGGTCGGAGTCAACGGATTGTAGATCGCGATAGACTACTATT (SEQ ID NO. 8)
[0103] Forward primer (F-FAM):
[0104] GAAGGTGACCAAGTTCATGCTGTAGATCGCGATAGACTACTATC (SEQ ID NO. 9)
[0105] Reverse primer (R): TCACTGTCTACTTGCGATAGATTAC (SEQ ID NO. 10)
[0106] As shown in Figure 2 , ZJU132 is a striped fruit material, represented as blue in the figure, and the genotype is CC; ZJU129 is a fruit material with flower spots, represented as red in the figure, and the genotype is TT; ZJU132 and ZJU129 hybrid F1 represent the heterozygous CT genotype, represented as green in the figure, and the graphical partition boundary of the genotyping result is obvious, indicating that this KASP marker genotyping is reliable and can be used for screening of different flower pattern materials in offspring.
[0107] As shown in Figure 3 and Figure 4 , using ClRP marker for genotyping in F2 population, the genotype of the material corresponding to ZJU132 as blue is CC; the genotype of the material corresponding to ZJU129 as red is TT; the genotype of the material corresponding to F1 as green is CT; the results show that the genotyping of ClRP marker in F2 population is linked with the fruit skin flower spot phenotype, and the next step of breeding can be carried out by selecting the hybrid or backcross offspring individuals of TT genotype. It is shown that ClRP marker can assist in the breeding of watermelon fruit skin surface patterns.
[0108] Experiment 1, the different watermelon germplasm phenotype and genotype were detected according to the method described in example 2, the results are shown in table 1 and Figure 5 .
[0109] Table 1. The results of 34 watermelon germplasm resources detected by using molecular marker CLRP
[0110]
[0111]
[0112] According to the theoretical speculation, the genotype of CC watermelon peel should be various phenotypes except for the mottle, and the genotype of TT watermelon should be the material with similar mottle to ZJU129. The results show that the theoretical speculation is consistent with the actual results, and the genotype CC and TT can be used to distinguish the mottle phenotype of the peel. The watermelon material with genotype TT is less, which may be related to the type of laboratory germplasm resources. The ClRP molecular marker can distinguish the peel mottle and peel stripe traits in natural population, and can sensitively distinguish different genotypes. Further, the molecular marker can be used for the initial screening of watermelon peel mottle traits to achieve the purpose of molecular marker assisted breeding.
[0113] The KASP molecular marker developed by the application which is closely linked to the watermelon peel mottle trait can be used for the preliminary screening of watermelon peel pattern varieties to achieve the purpose of molecular marker assisted breeding. At the same time, the peel pattern gene donor ZJU129 watermelon (male parent) is crossed with the peel stripe watermelon ZJU132 (female parent) to obtain F1 generation, and then backcross, self-crossing combined with marker assisted selection, and the single plant with the same genotype as ZJU129 is selected for breeding improvement, and a number of watermelon background materials containing peel mottle genes are obtained, which can be used for directional selection and improvement of the commodity traits of the outer skin of watermelon, increase the diversity of consumer selection, and accelerate the molecular breeding process of watermelon peel pattern trait diversification.
[0114] Example 3, polymorphism analysis of molecular markers in peel mottle material ZJU129 and peel stripe material ZJU132 and their offspring population
[0115] According to the nucleotide sequence of ClRP gene, a molecular marker ClRP is designed and developed for detecting the genotype polymorphism of parent materials and their offspring, and the KASP molecular marker primer combination consists of forward primer F-FAM, F-HEX and reverse primer R. The primer (molecular marker) can be entrusted to Shanghai Bioengineering Co., Ltd. for synthesis, and the amplification is carried out on ABI Step One PCR instrument, and the fluorescence signal is detected and analyzed for genotyping.
[0116] PCR reaction system: 20-50 ng / μl, water 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-HEX: F-FAM: R = 2:2:5 molar concentration ratio) 0.14 μl, total 10.14 μl;
[0117] PCR program: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing 60 seconds, 31 cycles. 30℃, 1 minute (read fluorescence signal).
[0118] After amplification, the fluorescence signal is detected on the instrument and the typing is observed. According to the setting of the present application, 31 cycles of amplification according to the above PCR program can achieve complete typing. If the typing is not sufficient, the amplification can be continued. The specific operation method is that on the basis of the above 31 cycles, the fluorescence signal can be read and the typing can be observed according to the same reaction condition, and each additional 3 cycles can achieve complete typing.
[0119] According to the difference of the fluorescence signal of the PCR product, the genotype of each watermelon to be tested is identified; the genotyping results Figure 2 It is shown that: the typing effect of each group of primers on the watermelon to be tested is very good. Taking the ClM16 marker as an example, the homozygous TT genotype (fruit skin flower spot type, red dot in the figure), the homozygous CC genotype (fruit skin stripe type, blue dot in the figure), and the green F1 hybrid genotype CT can be identified.
[0120] Finally, it should be noted that the above enumeration is only a few specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments, and there can be many variations. All variations that can be directly derived or inferred from the content disclosed by those skilled in the art should be considered as the protection scope of the present application.
Claims
1. Use of a reagent of a KASP molecular marker for detecting watermelon fruit skin mottle trait in identifying watermelon fruit skin mottle trait, characterized in that, The KASP molecular marker is ClM16; the sequence of ClM16 is shown as SEQ ID NO. 3 or SEQ ID NO. 4; the sequence of the CC genotype is shown as SEQ ID NO. 3, and the corresponding phenotype is striped pericarp; the sequence of the TT genotype is shown as SEQ ID NO. 4, and the corresponding phenotype is variegated pericarp.
2. Use according to claim 1, characterized in that, The reagent is the following primer pair, wherein the nucleotide sequence is 5'-3': The forward primer F-HEX of ClM16 is shown as SEQ ID NO. 8, the forward primer F-FAM is shown as SEQ ID NO. 9, and the reverse primer R is shown as SEQ ID NO.
10.
3. Use according to claim 2, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the watermelon variety to be tested; (2) performing PCR amplification on the watermelon genomic DNA by using the primer pair; (3) identifying the genotype of each watermelon to be tested according to the difference in the fluorescence signal of the PCR amplification result; the TT genotype is red, the CC genotype is blue, and the CT genotype is green.
4. Use according to claim 3, characterized in that, In the step (2), the PCR reaction system used for PCR amplification is 20-50 ng / ul watermelon genomic DNA 5.0 ul, KASP Master Mix 5.0 ul, KASP Assay Mix 0.14 ul, a total of 10.14 ul; the KASP Assay Mix comprises the forward primer F-HEX, the forward primer F-FAM and the reverse primer R, and the molar concentration ratio is 2:2:5; the PCR reaction program is: 30 DEG C, reading the fluorescence signal for 1 minute; 94 DEG C, pre-denaturation for 15 minutes; 94 DEG C, denaturation for 20 seconds; 61 DEG C, annealing for 60 seconds, 10 cycles; 94 DEG C, denaturation for 20 seconds; 55 DEG C, annealing for 60 seconds, 31 cycles; 30 DEG C, reading the fluorescence signal for 1 minute.
5. Use of a reagent for detecting the KASP molecular marker of claim 1 in the molecular assisted selection breeding of the surface pattern of the pericarp of a watermelon fruit with flowered pericarp strain or its offspring, characterized in that, The fruit pericarp pattern gene donor ZJU129 watermelon is used as the male parent, and the fruit pericarp striped watermelon ZJU132 is used as the female parent to obtain F1 generation, and then backcrossing, self-crossing, and combining the KASP molecular marker assisted selection.
6. Use according to claim 5, characterized in that, The single plant with the genotype consistent with ZJU129 in the segregating population is selected for breeding improvement, and the traits of the outer pericarp of watermelon are directionally selected and improved.
Citation Information
Patent Citations
KASP marker primer combination for detecting light green / dark green character of watermelon peel and application of KASP marker primer combination
CN116179743A
KASP molecular marker for detecting background color of watermelon peel and application of KASP molecular marker
CN118086567A