InDel marker, primer and application thereof for identifying the sex of Paulownia tung plants

By designing InDel marker primers on chromosome 2 of Millennium Tung Xiong Plant, combined with fluorescent labeled capillary electrophoresis, the rapid and accurate identification of the gender of Millennium Tung Plant was achieved, and the problem of long time and labor-consuming in the existing technology was solved, and breeding efficiency was improved and costs were reduced.

CN116590461BActive Publication Date: 2025-08-22CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202310762599.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-27
Publication Date
2025-08-22
Estimated Expiration
2043-06-27

AI Technical Summary

Technical Problem

In the prior art, the gender identification of millennium tung plants requires the development of mature flower organs, which is long and labor-intensive, making it difficult to achieve accurate and rapid gender identification during the seedling stage, affecting breeding efficiency and cost.

Method used

A pair of InDel marker primers were designed to be located at specific sites on chromosome 2 of the genome of Millennium Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung Tung T

Benefits of technology

It has achieved accurate and rapid identification of the gender of the millennium tung plant, with high identification accuracy, simple operation and low cost. It is suitable for seedling gender screening, shortening the breeding cycle and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116590461B_ABST
    Figure CN116590461B_ABST
Patent Text Reader

Abstract

The present invention discloses an InDel marker, primers, and applications thereof for identifying the sex of Tung oil plants. The primers can be used to screen the sex of any Tung oil tissue other than seeds. The marker has an identification accuracy of 100% for male plants, 96% for female plants, and an overall identification accuracy of 98%. The marker has the advantages of simple operation, small sample size, high sensitivity, fast separation speed, low cost, and high detection accuracy, and has high market reference value. The present invention provides an accurate, simple, and rapid method for screening female / male Tung oil materials using InDel molecular markers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to an InDel marker, a primer and an application thereof for identifying the sex trait of Paulownia oleifera plants, and belongs to the technical field of molecular biology. Background Art

[0002] Vernicia montana Lour. is a woody oil-bearing tree with high economic and ornamental value. Its main economic product is tung oil extracted from its seeds. Tung oil has excellent properties such as fast drying, light specific gravity, good gloss, insulation, cold and heat resistance, acid and alkali resistance, and corrosion and rust prevention. It is widely used in the production of high-quality and safe waterproof coatings, insulating layers in electronic components, environmentally friendly printing inks, and biodiesel, and has high development and utilization value. If the main goal of Vernicia montana Lour. is fruit production, then the optimal economic benefits can be achieved by configuring male and female plants in an appropriate ratio; if used for landscape planting, male plants are more aesthetically pleasing. However, Vernicia montana Lour. is a dioecious plant with a long juvenile period, requiring 3 to 4 years of growth before flowering. In the process of directed breeding, the sex of the plants currently needs to be determined through mature floral organs, which takes a long time. In addition, adult trees are tall, and it is difficult and labor-intensive to remove unwanted individuals after sex determination. Therefore, the development of sex-specific molecular markers for Tung oil plants for accurate and rapid identification of sex at the seedling stage is of great significance for shortening the Tung oil plant breeding cycle, improving breeding efficiency, and saving breeding costs.

[0003] InDel (Insertion / Deletion polymorphism) markers are a new generation of molecular markers based on whole-genome DNA sequences. They are based on the insertion and deletion of small nucleotide fragments (at least 1 bp) of varying sizes within homologous genomic sequences across individuals. InDel markers offer advantages such as high abundance, wide distribution, and rich variation. Using InDel markers for genotyping species offers advantages such as good stability and polymorphism, and holds significant potential for application in sex identification. Summary of the Invention

[0004] In view of the deficiencies in the prior art and actual needs, the purpose of the present invention is to provide an InDel marker and primers for identifying the sex traits of Tung oil plants, as well as the application of the InDel marker primers in identifying the female / male sex of Tung oil. The primers can be used to screen the sex of any tissue of Tung oil except seeds, and have the advantages of high accuracy, good repeatability, and fast identification speed, providing an accurate, simple and fast method for the screening of female / male Tung oil materials with the assistance of InDel molecular markers.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] An InDel marker for identifying the sex of Tung oil plants. The InDel site is located at 102,799,917bp to 102,799,933bp on chromosome 2 of the genome of male Tung oil plants. The genotype of female Tung oil plants at the InDel site is heterozygous ID, while the genotype of male oil plants at the InDel site is insertion homozygous II.

[0007] The InDel marker for identifying the sex of Tung oil plant was amplified using the forward primer BASS4-F: CAAATTACCAGAATAGTATGCC and the reverse primer BASS4-R: GACCTCTAACAATGTTTTCAAC.

[0008] The InDel marker for identifying the sex of the Paulownia tung plant is used to detect the amplified product by fluorescent-labeled capillary electrophoresis. If there are two peaks in the electrophoresis spectrum and the genotypes displayed by the peak graph are 249bp and 253bp, the genotype of the InDel site is heterozygous type ID; if there is only one peak and the genotype displayed by the peak graph is 253bp, the genotype of the InDel site is insertion homozygous type II.

[0009] The InDel marker for identifying the sex of Tung oil plant, the 5' end of the forward primer is modified with a fluorescent group.

[0010] The InDel marker for identifying the sex of the Paulownia oleifera plant has a primer pair concentration of 10 μM.

[0011] The InDel marker for identifying the sex of Paulownia oleifera plants has a genomic DNA concentration of 50 to 100 ng / μL.

[0012] The present invention also provides an InDel marker primer for identifying the sex of Tung oil plant.

[0013] Forward primer BASS4-F: CAAATTACCAGAATAGTATGCC, SEQ ID NO. 1;

[0014] Reverse primer BASS4-R: GACCTCTAACAATGTTTTCAAC, SEQ ID NO.2.

[0015] The present invention also provides the InDel marker for identifying the sex of the Tung tree plant, or the application of the InDel marker primer for identifying the sex of the Tung tree plant, for identifying the sex of the Tung tree plant.

[0016] Beneficial effects of the present invention:

[0017] (1) The method for genotyping InDel sites provided by the present invention is to perform genome resequencing based on 25 female and 25 male Tung trees, and perform genome-wide association analysis based on a mixed linear model using sex traits to obtain InDel sites that are significantly associated with sex. PCR amplification primers are designed based on the screened InDel sites, including a forward primer and a reverse primer, wherein the 5' end of the forward primer is modified with a fluorescent group. Then, PCR amplification is performed on the genomic DNA of the sample to be tested to obtain an amplified product, and the amplified product is detected by fluorescent-labeled capillary electrophoresis to determine the genotype of the InDel site in the sample to be tested. The identification standard is: when there are two peaks in the capillary electrophoresis spectrum and the genotype displayed by the peak graph is 249 / 253, the Tung tree to be tested is a female plant; when there is only one peak in the capillary electrophoresis spectrum and the genotype displayed by the peak graph is 253, the Tung tree to be tested is a male plant.

[0018] (2) The present invention successfully screened an InDel molecular marker closely related to the sex of Tung oil tree by using the above primer pair. By randomly selecting 50 female and male materials for verification, the marker had an identification accuracy of 100% for male plants and 96% for female plants, with a comprehensive identification accuracy of 98%. It has the advantages of simple operation, small sample amount, high sensitivity, fast separation speed, low cost and high detection accuracy, and has high market reference value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the phylogenetic relationship and population structure analysis of 178 sequenced individuals in the early stage of this invention;

[0020] Figure 1 a is the system evolution relationship;

[0021] Figure 1 b is the population structure of each plant when the cross-validation error value is the lowest, where each color represents an ancestral component;

[0022] Figure 1 c indicates the samples used for GWAS analysis, where pink triangles indicate the selected female plant samples and blue triangles indicate the selected male plant samples.

[0023] Figure 2 These are the 18 most significant InDels screened out in the early stage of this invention, namely Figure 1 Points above the middle red dashed line.

[0024] Figure 3 This is the fluorescence-labeled capillary electrophoresis pattern in Example 1 of the present invention. DETAILED DESCRIPTION

[0025] The present invention provides a method for identifying the sex of Tung oil plant by using an InDel site genotyping, wherein the site screening and application comprises the following steps: (1) performing whole-genome resequencing on male and female individuals of Tung oil plant and identifying the mutation site; (2) carrying out InDel-based genome-wide association analysis with sex as a trait, and screening InDels significantly associated with sex; (3) designing PCR amplification primers according to the screened InDel site, including a forward primer and a reverse primer, wherein the 5' end of the forward primer is modified with a fluorescent group; (4) The PCR amplification primers are used to amplify the DNA of the sample to be tested, and the obtained amplification products are detected by fluorescent labeling capillary electrophoresis, and the images are collected and the amplification size is analyzed using GeneMapper software; if there are two peaks in the capillary electrophoresis spectrum, and the fragment length displayed by the peak graph is 249bp / 253bp, then the Tung oil tree to be tested is a female plant, and its genotype is heterozygous type ID; if there is only one peak in the capillary electrophoresis spectrum, and the fragment length displayed by the peak graph is 253bp, then the Tung oil tree to be tested is a male plant, and its genotype is homozygous type II.

[0026] The genomic DNA of the sample to be tested in the present invention is obtained by a conventional plant genomic DNA extraction method. Specifically, in the embodiment of the present invention, a kit method is used to extract DNA, specifically the Qiagen DNeasy Plant Pro Kit; the genomic DNA concentration is preferably 50-100 ng / μL.

[0027] Example 1

[0028] This example screens for InDel molecular markers linked to the sex of Tung oil tree and uses the InDel molecular markers to identify the sex of Tung oil tree plants, including the following steps:

[0029] (1) Identify the sex of Tung trees based on their phenotype and collect leaves:

[0030] The test materials used in the present invention were adult millennia-old tung trees distributed in Hunan, Hubei, Guangxi Zhuang Autonomous Region, Yunnan, Guangdong, Zhejiang, Sichuan, and other regions, with different genetic backgrounds. The sex of these trees was determined during the flowering period from March to May. Plants with all female flowers were identified as female, while those with all male flowers or a majority of male flowers were identified as male. Young leaves from 88 male and 90 female plants were collected, dried on silica gel, and used for genomic DNA extraction.

[0031] (2) Genomic DNA extraction (Qiagen DNeasy Plant Pro Kit).

[0032] ① Weigh 50 mg of dry leaves into a 2 mL centrifuge tube, grind thoroughly with liquid nitrogen, add 500 μL of CD1 solution, and vortex briefly to mix.

[0033] ② Vortex vigorously at maximum speed for 10 minutes.

[0034] ③ Centrifuge at 12,000 x g for 2 minutes at room temperature. Aspirate the supernatant and transfer it to a new 1.5 mL centrifuge tube. Add 200 μL of CD2 solution and vortex for 5 seconds to mix.

[0035] ④ Centrifuge at 12,000 x g for 1 min at room temperature. Aspirate the supernatant and transfer it to a new 1.5 mL centrifuge tube. Add 500 μL of APP buffer and vortex for 5 seconds to mix.

[0036] ⑤ Transfer the lysate to an MB spin column and centrifuge at 12,000 x g for 1 minute.

[0037] ⑥ Place the MB spin column in a clean 2 mL collection tube. Add 650 μL of AW1 buffer to the MB spin column. Centrifuge at 12,000 x g for 1 minute, discard the waste liquid, and return the MB spin column to the collection tube.

[0038] ⑦Add 650 μL of AW2 buffer to the MB spin column. Centrifuge at 12,000 x g for 1 min. Discard the waste liquid and return the MB spin column to the collection tube.

[0039] ⑧ Centrifuge at 16,000 x g for 2 min. Place the MB spin column into a new 1.5 mL elution tube.

[0040] ⑨ Add 50 μL of EB buffer to the center of the filter membrane of the MB spin column.

[0041] ⑩ Centrifuge at 12,000 x g for 1 min to collect genomic DNA.

[0042] (3) Determine the sex-linked InDels of Tung oil tree.

[0043] The present invention used the Illumina Novaseq 6000 sequencing platform to perform whole-genome resequencing on 178 strains of Tung oil plant (88 male and 90 female) at a sequencing depth of approximately 10× (calculated based on a 1.3 Gb gene size standard). Using the reference genome of the Tung oil plant, which was generated by our research group, we performed mutation detection. After filtering, we obtained 38,359,821 high-quality SNPs and 4,266,202 high-quality InDels. Using SNPs located in single-copy genes, we constructed an phylogenetic tree using the neighbor-joining method and analyzed the population structure using maximum likelihood estimation ( Figure 1 According to the analysis results, 25 male and 25 female plants with different genetic backgrounds were selected ( Figure 1c) Perform genome-wide association studies (GWAS) based on InDels. VCFtools was used to extract InDel information of the samples. GEMMA software based on mixed linear models was used to perform GWAS analysis with sex as the trait. Wald method was used for P value detection. Genetic Type I error calculator was used for significance threshold screening. A total of 18 highly significant InDels were screened out ( Figure 2 ), of which there are 4 InDels with length differences greater than 2 bp, namely InDel1, InDel2, InDel3, and InDel4; the InDel1 is located at 102 799 917 bp to 102 799 933 bp on chromosome 2, the InDel2 is located at 102 806 294 bp to 102 806 337 bp on chromosome 2, the InDel3 is located at 102 813 678 bp to 102 813 682 bp on chromosome 2, and the InDel4 is located at 102 816 555 on chromosome 2.

[0044] (4) Genotyping verification was performed using fluorescent-labeled capillary electrophoresis.

[0045] The present invention utilizes a VCF file recording InDel information, combined with reference genome information, to extract 300bp of sequence upstream and downstream of the InDel site. SnapGene is then used to design primers based on the extracted sequence, including forward and reverse primers. The designed primers are synthesized at Sangon Biotech (Shanghai) Co., Ltd., and the 5' end of the forward primer is modified with a FAM fluorescent group. Preferably, the primers designed for InDel1 are forward primer SEQ ID NO. 1 and reverse primer SEQ ID NO. 2; preferably, the primers designed for InDel2 are forward primer SEQ ID NO. 3 and reverse primer SEQ ID NO. 4; preferably, the primers designed for InDel3 are forward primer SEQ ID NO. 5 and reverse primer SEQ ID NO. 6; and preferably, the primers designed for InDel4 are forward primer SEQ ID NO. 7 and reverse primer SEQ ID NO. 8.

[0046] SEQ ID NO.1: CAAATTACCAGAATAGTATGCC;

[0047] SEQ ID NO.2: GACCTCTAACAATGTTTTCAAC;

[0048] SEQ ID NO.3:GGAAACTACTGCAGAGTC;

[0049] SEQ ID NO.4: CAATGACAACAAGTTCTCC;

[0050] SEQ ID NO.5: TGTGGCTGATTCGAAATC;

[0051] SEQ ID NO.6: CAACTTTCATACTCCCTTTG;

[0052] SEQ ID NO.7: TCAATCTTAGCCAACAGC;

[0053] SEQ ID NO.8: GCTAGAGTGTAGCTTCAT;

[0054] Fifty female and 50 male plants were randomly selected, and their genomic DNA was amplified by PCR using the designed primer pairs. The amplification reaction procedure was a preliminary denaturation at 94°C for 1 minute; denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 68°C for 30 seconds, for 35 cycles; and a final extension at 68°C for 5 minutes. The samples were then stored at 4°C in the dark. The PCR amplification products were detected by fluorescent capillary electrophoresis, with one individual tested per lane. LIZ500 was used as the internal molecular weight standard. The fragment size of the amplified products was analyzed using GeneMapper software, with an error of 0 to 1 bp. The genotype of the tested individuals was determined based on the test results. A relatively stable primer pair with good genotyping performance was ultimately selected, and this InDel molecular marker can be used to identify the sex of Tung trees. The InDel molecular marker is the aforementioned InDel1, located at 102 799 917 bp to 102 799 933 bp on chromosome 2 of the Millennium Tongxiong strain genome. The nucleotide sequences of the primer pair for identifying the InDel site are shown in SEQ ID NOs. 1-2.

[0055] SEQ ID NO.1: CAAATTACCAGAATAGTATGCC;

[0056] SEQ ID NO. 2: GACCTCTAACAATGTTTTCAAC.

[0057] The peak diagram of fluorescence labeling capillary electrophoresis results is as follows Figure 3As shown, PCR amplification of genomic DNA from male and female Tung trees using primers SEQ ID NOs. 1-2 revealed a single peak in the amplified product of male trees, with a fragment length of 253 bp, indicating a homozygous II genotype. The amplified product of female trees showed a double peak, with a fragment length of 249 bp / 253 bp, indicating a heterozygous ID genotype. The test results showed that 50 male and 2 female trees had a genotype II, while 48 female trees had a genotype ID. The identification accuracy for male trees was 100%, for female trees was 96%, and for the overall identification accuracy was 98%.

[0058] In summary, this example successfully screened out an InDel molecular marker closely related to the sex of Tung oil tree, as well as a primer pair that can amplify the above InDel molecular marker, which can be used to identify the sex of Tung oil tree seedlings and improve their cultivation and utilization efficiency.

Claims

1. An InDel marker primer for identifying the sex of Tung oil plants, characterized in that: Forward primer BASS4-F: CAAATTACCAGAATAGTATGCC Reverse primer BASS4-R: GACCTCTAACAATGTTTTCAAC.

2. Use of the InDel labeled primers for identifying the sex of Paulownia tung plants according to claim 1 for identifying the sex of Paulownia tung plants.

Citation Information

Cited By

  • Molecular marker related to male and female identification of aleurites montana as well as primer group and application of molecular marker

    CN120330312A

  • A molecular marker for sex identification of *Dendrobium nobile* and its primer set and application

    CN120330312B