Cingulin as a marker for early diagnosis of pancreatic cancer and a new target for anti-cancer drugs
By using antibodies and downregulators of button protein CGN, the problems of inaccurate early diagnosis and poor treatment outcomes of pancreatic cancer have been solved, enabling early diagnosis and effective treatment of pancreatic cancer, especially by detecting the transcriptional and protein expression levels of CGN and using CGN downregulators to inhibit cancer cell activity.
Patent Information
- Application Number
- CN202310422451.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-19
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2043-04-19
AI Technical Summary
Current technologies are insufficient for early diagnosis and treatment of pancreatic cancer, leading to inaccurate diagnosis and treatment difficulties, especially for patients with pancreatic ductal adenocarcinoma (PDA), who have poor prognosis and limited treatment outcomes.
Antibodies against button protein CGN are used as early diagnostic markers. Early diagnosis is achieved by detecting the transcriptional and protein expression levels of CGN and combining the primer sequences of quantitative real-time polymerase chain reaction. Downregulators of button protein CGN, such as short interfering RNA, are used to inhibit CGN expression in order to treat pancreatic cancer.
It enables early diagnosis of pancreatic cancer, determines whether a patient is in an early stage by detecting CGN levels, and inhibits cancer cell proliferation, migration and invasion by suppressing CGN expression, thereby reducing tumor growth and improving treatment efficacy.
Smart Images

Figure CN116609528B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedical technology and pharmaceutical technology. Specifically, it relates to button protein CGN antibody as an early diagnostic marker for malignant pancreatic cancer and button protein CGN downregulators as drugs for treating malignant pancreatic cancer. Background Technology
[0002] Pancreatic cancer is a highly aggressive malignant tumor of the digestive system, characterized by difficulties in early diagnosis and a poor prognosis. Pancreatic ductal adenocarcinoma (PDA) is the most common type of pancreatic cancer. The 5-year survival rate for PDA is less than 9.3% across all cases, and less than 2.9% in patients with metastatic disease. PDA is currently the fourth leading cause of cancer-related deaths in the United States and is projected to become the second leading cause by 2030. Many PDA patients have distant metastases at diagnosis and are unresponsive to current surgical and chemotherapy treatments. Therefore, new early diagnostic and therapeutic techniques are needed for further improvement and development.
[0003] CGN (Clock Gland Protein) is a tight junction family protein first discovered in the brush border cells of chicken intestinal epithelium. Its subcellular localization and tissue distribution show that it is located at tight junctions, as well as in various polarized epithelial and endothelial cells. Under physiological and pathological conditions, CGN participates in maintaining the integrity of certain epithelial and endothelial barriers. Knock down It can increase the permeability of colon cancer epithelial cells, as well as neurons and Purkinje cells, and decrease epithelial resistance. However, knocking out CGN in MDCK and embryonic stem cell-derived embryoids does not affect tight junction barrier function, indicating that buttonin CGN does not always maintain the epithelial and endothelial barrier. Similarly, buttonin CGN is also involved in many cellular processes by regulating cell motility, cell proliferation, cell cycle, and gene expression. Summary of the Invention
[0004] To overcome the inaccuracies and lack of specificity in existing diagnoses, the present invention aims to provide an early diagnostic biomarker. To overcome the unsatisfactory effects of existing treatment techniques, another objective of the present invention is to provide a drug for treating cancer.
[0005] To achieve the first objective mentioned above, the technical solution adopted by the present invention is as follows:
[0006] This invention provides an early cancer diagnostic biomarker, comprising an antibody against button protein CGN and a fluorescent quantitative polymerase chain reaction primer sequence.
[0007] Furthermore, the button protein CGN antibody is an antibody that blocks amino acid residues 7-356 or 307-412 of button protein CGN.
[0008] Furthermore, the primer sequence for the button protein CGN fluorescence quantitative polymerase chain reaction is the reverse complementary sequence of the coding sequence CDS that binds to the button protein CGN messenger ribonucleic acid mRNA.
[0009] Furthermore, when the transcriptional and protein expression levels of the button protein CGN were upregulated, the subjects were in the early stages of pancreatic cancer development.
[0010] Furthermore, the early diagnostic reagent for pancreatic cancer includes reagents for detecting the transcriptional and protein levels of button protein CGN.
[0011] To achieve the second objective mentioned above, the technical solution adopted by the present invention is as follows:
[0012] The present invention also provides a medicament for treating malignant tumors, including a downregulator of button protein CGN.
[0013] Furthermore, the buttonin downregulator is a designed buttonin CGN short interfering RNA.
[0014] The short interfering RNA sequence for button protein is its downregulatory sequence for human button protein CGN: GTCCAGATTCGCTTCATCACA, downregulatory sequence 1 for mouse button protein Cgn: GTGAGGAGGAAAGTTAGTTTG; and downregulatory sequence 2 for mouse button protein Cgn: TGGAGTTCAAATTCGATTTAT.
[0015] This invention provides a drug that can treat malignant pancreatic cancer, inhibiting the expression of button protein CGN, inhibiting the proliferation, migration and invasion of malignant pancreatic cancer cells, and inhibiting tumor growth in vivo.
[0016] The downregulator of button protein CGN inhibits the proliferation of malignant tumor cells, downregulates the clonogenic ability of malignant pancreatic cancer cells, downregulates the expression level of Ki67, an antigen related to mitosis and cell proliferation in malignant pancreatic cancer cells, downregulates the tumor-promoting MAPK / ERK signaling pathway, and downregulates the growth of pancreatic cancer cells in mice.
[0017] The downregulator of buttonin CGN inhibits the migration and invasion of malignant tumor cells, downregulates the wound healing ability of malignant tumors, and weakens the ability of cells to migrate and invade.
[0018] Compared with the prior art, the advantages of the present invention are as follows:
[0019] This discovery is the first to propose the differential expression of button protein CGN in the development and progression of malignant pancreatic cancer. By detecting the transcriptional and protein levels of the button protein CGN, it is possible to determine whether a subject is in the early stage of pancreatic cancer, providing a molecular means for the early diagnosis of malignant pancreatic cancer.
[0020] The malignant tumor treatment drug provided by this invention inhibits the proliferation, migration, and invasion of pancreatic cancer cells, as well as tumor growth in vivo, by reducing the level of button protein (CGN). Using button protein as a target can lead to the development of drugs that inhibit tumor cell growth and metastasis, thereby enhancing the therapeutic effect on tumors. Attached Figure Description
[0021] Figure 1-A Immunohistochemical (IHC) assays were used to show the expression levels of Cingulin (Cingulin [Homo sapiens]) in pancreatic cancer tissue, adjacent normal tissue, acinar duct metaplasia (ADM), and pancreatic intraepithelial neoplasia (PanIN). Scale bar = 50 μm.
[0022] Figure 1-B A graph showing the statistical results of Cingulin (Cingulin [Homosapiens]) expression levels in pancreatic cancer tissue, adjacent normal tissue, ADM, and PanIN.
[0023] Figure 1-C Real-time PCR and Western blotting were used to detect the transcriptional expression levels of CGN (Homo sapiens cingulin (CGN), CDS) and the protein expression levels of Cingulin (Cingulin [Homo sapiens]) in various pancreatic cancer cell lines and pancreatic duct cell lines.
[0024] Figure 1-D Analysis of the GSE62452, GSE32676, and GSE71729 datasets revealed the expression levels of CGN (Homo sapienscingulin (CGN), CDS) in the pancreas and pancreatic cancer.
[0025] Figure 2-A For IHC assay, the expression levels of cingulin (cingulin isoform 1 [Mus musculus]) in normal pancreas, ADM and PanIN of C57BL / 6 mice are shown, scale bar = 50 μm;
[0026] Figure 2-BReal-time PCR and Western blotting were used to detect the transcriptional expression levels of Cgn (Musmusculus cingulin (Cgn), transcript variant 1, CDS), CK19 (Mus musculus keratin19 (Krt19), transcript variant 1, mRNA), and Amy2a (Mus musculus amylase 2a1 (Amy2a1), mRNA) and the protein expression levels of cingulin (cingulin isoform 1 [Mus musculus]), Sox9 (transcription factor SOX-9 [Mus musculus]), and Amylase (amylase 2a1 precursor [Mus musculus]).
[0027] Figure 2-C The expression level of cingulin (cingulin isoform 1 [Musmusculus]) in mice with ADM was determined by immunofluorescence (IF).
[0028] Figure 3-A Analysis of the GSE155698 dataset showed that CGN (Homo sapiens cingulin (CGN), CDS) was expressed higher in tumor cells and metaplastic cells than in acinar cells.
[0029] Figure 3-B Analysis of the GSE141017 dataset shows that Cgn (Mus musculus cingulin (Cgn), transcript variant 1, CDS) in Ptf1a-CreER, LSL-Kras G12D ,LSL-tdTomato The expression pattern of (KC) in the pancreatic cancer model is mainly observed in ductal cells and metaplastic cells;
[0030] Figure 4-A The expression levels of CGN (Homo sapiens cingulin (CGN), CDS) at various levels in human pancreatic cancer tissue microarrays and the GSE62452 dataset;
[0031] Figure 4-B To perform Kaplan-Mayer curve analysis using the GSE71729 dataset to demonstrate the relationship between CGN (Homo sapienscingulin (CGN), CDS) and patient survival;
[0032] Figure 4-C To use human pancreatic cancer tissue microarrays for Kaplan-Mayer curve analysis to demonstrate the relationship between Cingulin (Cingulin [Homo sapiens]) protein expression and patient survival;
[0033] Figure 5 To perform multivariate Cox regression analysis using the TCGA pancreatic cancer dataset, this study aimed to demonstrate the correlation between CGN (Homo sapienscingulin (CGN), CDS) expression and prognostic survival in pancreatic cancer.
[0034] Figure 6 Analysis of the relationship between CGN and clinicopathological parameters in human pancreatic cancer tissue microarrays showed that Cingulin (Cingulin [Homo sapiens]) expression was significantly correlated with N grade.
[0035] Figure 7-A Real-time PCR and Western blotting were used to detect the transcriptional expression levels of CGN (Homo sapiens cingulin (CGN), CDS) and the protein expression levels of Cingulin (Cingulin [Homosapiens]) after CGN overexpression and knockdown.
[0036] Figure 7-B To investigate the effects of overexpression and knockdown of CGN (Homo sapiens cingulin (CGN), CDS) on the proliferation of pancreatic cancer cells using the CCK8 assay;
[0037] Figure 8 To detect the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on Ki67 expression using cell fluorescence assays;
[0038] Figure 9-A To assess the effects of overexpression and knockdown of CGN (Homo sapiens cingulin (CGN), CDS) on the clonogenic ability of pancreatic cancer cells;
[0039] Figure 9-B We analyzed the GSE32676 dataset and performed differential expression analysis on the two groups with high and low CGN (Homo sapiens cingulin (CGN), CDS) expression to identify the main enrichment pathways of differentially expressed genes that were upregulated.
[0040] Figure 9-CWestern blot analysis was performed to show the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on the MAPK / ERK signaling pathway.
[0041] Figure 10-A The effect of knocking down CGN (Homo sapiens cingulin (CGN), CDS) on the size of pancreatic cancer xenografts / allogeneic tumors;
[0042] Figure 10-B The tumor volume changes of xenograft / allogeneic pancreatic cancer in mice over time;
[0043] Figure 10-C The effect of CGN (Homo sapiens cingulin (CGN), CDS) knockdown on the weight of pancreatic cancer xenografts / allogeneic tumors;
[0044] Figure 10-D IHC assays were performed to show the effects of CGN (Homo sapiens cingulin (CGN), CDS) knockdown on xenografts / allogeneic xenografts on MAPK / ERK signaling pathway activation and Ki67 expression.
[0045] Figure 11-A The cell scratch assay was used to detect the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on the wound healing ability of human pancreatic cancer cell lines. Scale bar = 100 μm.
[0046] Figure 11-B Quantitative results on the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on the wound healing ability of human pancreatic cancer cell lines;
[0047] Figure 12-A Transwell assays were performed to show the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on the migration and invasion abilities of human pancreatic cancer cell lines. Scale bar = 100 μm.
[0048] Figure 12-B A graph showing the quantitative results of the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on the migration and invasion abilities of human pancreatic cancer cell lines;
[0049] Figure 12-CWestern blotting was used to detect the effects of CGN (Homo sapiens cingulin (CGN), CDS) overexpression and knockdown on vimentin (vimentin [Homo sapiens]).
[0050] Figure 13-A Real-time PCR and Western blotting were used to detect the overexpression and knockdown levels of Cgn (Mus musculus cingulin (Cgn), transcript variant 1, CDS); and CCK8 assays were used to detect the effects of overexpression and knockdown of Cgn (Mus musculus cingulin (Cgn), transcript variant 1, CDS) on the proliferation of pancreatic cancer cells.
[0051] Figure 13-B The results of the cell scratch assay show the effects of Cgn (Mus musculus cingulin (Cgn), transcript variant 1, CDS) overexpression and knockdown on the wound healing ability of mouse pancreatic cancer cell lines. Scale bar = 100 μm.
[0052] Figure 13-C Quantitative results on the effects of Cgn (Mus musculus cingulin (Cgn), transcript variant 1, CDS) overexpression and knockdown on wound healing ability of mouse pancreatic cancer cell lines. Detailed Implementation
[0053] This invention provides an early diagnostic marker for pancreatic cancer and a therapeutic agent for malignant tumors. To make the objectives, techniques, and effects of this invention clearer, the invention is further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0054] hTERT-HPNE cells, HPDE6-C7 cells, HPAC cells, and PL45 cells were purchased from Guangzhou Shenhua Biotechnology Co., Ltd.; AsPC-1 cells, BxPC-3 cells, CaPan-2 cells, CFPAC-1 cells, MIA Paca-2 cells, PANC-1 cells, PK-59 cells, and SW1990 cells were purchased from Guangzhou Saiku Biotechnology Co., Ltd.; 266-6 cells were purchased from Beijing Zhongyuan Heju Biotechnology Co., Ltd.; and Panc02 cells were purchased from Zhejiang Meisen Cell Technology Co., Ltd. All cell lines were cultured in medium containing 5% or 10% fetal bovine serum and penicillin / streptomycin at 37°C and 5% CO2.
[0055] Anti-Cingulin (Cat# 21369-1-AP) and GAPDH (Cat# 60004-1-Ig) antibodies were purchased from Proteintech; anti-Cingulin (Cat# ab244406), anti-Ki67 (Cat# ab15580), anti-pERK (Cat# ab47339), and anti-ERK (Cat# ab184699) antibodies were purchased from Abcam; anti-Vimentin (Cat# 5741S) antibody was purchased from CellSignaling Technology; anti-Amylase (Cat# PA5-117115) antibody was purchased from Invitrogen; anti-ELA3B (Cat# MAB14788) antibody was purchased from Abnova; and anti-SOX9 (Cat# AB5535-25UG) antibody was purchased from Sigma-Aldrich.
[0056] The specific targeting siRNAs were synthesized by Gemma Biotechnology Co., Ltd. The downregulatory sequence for human button protein CGN is: GTCCAGATTCGCTTCATCACA; the downregulatory sequence 1 for mouse button protein Cgn is: GTGAGGAGGAAAGTTAGTTTG; and the downregulatory sequence 2 for mouse button protein Cgn is: TGGAGTTCAAATTCGATTTAT. Primers for real-time PCR are detailed in Table 1.
[0057] Human CGN transcription plasmid (overexpression plasmid) and CGN shRNA (knockdown plasmid, with the same sequence as siRNA) were purchased from Guangzhou Aiji Biotechnology Co., Ltd. The CGN ORF region was subcloned into the pCDH-CMV-MCS-EF1-puro vector, containing a Flag tag; the CGN shRNA was constructed into the pLKO.1-U6-EF1a-coGFP-T2A-puro plasmid, containing a Flag tag. The Cgn transcription plasmid (overexpression plasmid) was purchased from Nanjing Genscript Biotech Co., Ltd., and the Cgn ORF region was subcloned into the pcDNA3.1(+)-C-DYK vector.
[0058] C57BL / 6J mice and nude mice were procured and bred by the Animal Experiment Center of South China University of Technology, sourced from Guangzhou Sijiajingda Biotechnology Co., Ltd. All laboratory mice were housed within SPF-grade barriers. Animal experiments were conducted with the approval of the Experimental Animal Ethics Committee of South China University of Technology, and animal welfare principles were followed throughout the process.
[0059] Example 1: Experiment on mouse pancreatic cancer xenografts
[0060] In xenograft / allogeneic tumor models, human pancreatic cancer cells (1×10⁻⁶) 6 ) / Mouse pancreatic cancer cells (5×10 5 The tumor was resuspended in 0.1 mL of PBS containing matrix gel (BD, #356234) and injected subcutaneously into the right groin of nude mice. Tumor length and width were measured with calipers every three / four days. Tumor-bearing mice were euthanized at a predetermined time after inoculation or when near death, and the tumor was removed and weighed. Tumor volume (mm²) 3 The calculation formula is: minor diameter 2 × major diameter / 2.
[0061] The experimental results are shown in Figure 10, which describes the mouse xenograft / allogeneic pancreatic cancer model. Figure 10-A This is a morphological image of a tumor after the subcutaneous tumor-bearing experiment in mice. Figure 10-B This shows the changes in the volume of subcutaneous tumors in mice. Figure 10-C The image shows the weight of the transplanted tumor after the completion of a subcutaneous tumor transplantation model in mice. The results regarding the morphology, volume, and weight of the transplanted tumor indicate that CGN downregulators can inhibit tumor growth of pancreatic cancer cells in mice.
[0062] Example 2: Three mouse models of acinar duct metaplasia (ADM)
[0063] Under standardized conditions, a mouse pancreatitis model (i.e., PDL mouse ADM model) was induced by duct ligation surgery using 6-8 week old wild-type mice. One week after duct ligation, pancreatic tissue was harvested from the mice. Another mouse pancreatitis model (i.e., CAE mouse ADM model) was induced by intraperitoneal injection of 80 μg / kg of lysimachia alafenamide, administered eight times daily for eight consecutive hours with one injection every hour for two days. Pancreatic tissue was harvested two days after injection. Pancreatic tissue was also harvested from 2-month-old KC mice with existing ADM lesions (i.e., KC mouse ADM model).
[0064] The experimental results are shown in Figure 2-B and Figure 2-C . Figure 2-B The expression level of Cgn in mice with ADM / pancreatitis was detected by Real-time PCR and Western blotting. Figure 2-C The expression level of Cgn in rat ADM was determined by IF assay. The results showed that compared with the normal pancreas of C57BL / 6 rats, Cgn expression was increased in ADM, and the expression was increased in the apical cavity of ADM.
[0065] Example 3: Pancreatic cancer cell line migration and invasion experiment
[0066] CGN overexpression was performed using a lentiviral system: First, the target plasmid was packaged virally using pSPAX2 packaging plasmid and pMD2.G capsid plasmid. Then, PANC-1 and PL45 cells were infected, with 8 μg / ml polybrene (Beyotime, #C0351) added. Stable cell lines were selected using puromycin (InvivoGen, #QLL-40-03) and verified by real-time PCR and Western blotting. One day in advance, 5 × 10⁶ cells were added. 5 PANC-1 and PL45 cells were seeded into 6-well plates, and 2 mL of cell culture medium containing 10% FBS was added. After 24 hours, when the cells reached 90% confluence, cell scratching was performed. The cells were washed three times with PBS, and 2 mL of cell culture medium containing 1% FBS was added. Cell images were taken at 0 hours and 24 hours after scratching. The scratch area was calculated using ImageJ.
[0067] CGN knockdown, Cgn overexpression, and Cgn knockdown were performed using the Lipo3000 liposome transient transfection system: 3 × 10⁻⁶ mcg / mL transfection was performed the day before transfection. 5CFPAC-1 and PK-59 cells were seeded into 6-well plates and 2 mL of cell culture medium containing 10% FBS was added. siRNA was transfected within 18-24 hours. Two sterile 1.5 mL EP tubes (tubes A and B) were used. 125 μL of serum-free OPTI-MEM medium was added to each tube, followed by 5 μL of Lipofectamine 3000 (tube A) and 100 pmol siRNA or 2 μg DNA (tube B). The mixture was gently mixed and incubated at room temperature for 5 minutes. The tubes A and B were then mixed thoroughly and incubated at room temperature for 15 minutes. 250 μL of the mixture from tubes A and B was added to a 6-well plate. The plate was replaced with fresh complete culture medium after 6-8 hours. Forty-eight hours after transfection, scratching was performed. The cells were washed three times with PBS, and 2 mL of cell culture medium containing 1% FBS was added. Cell images were taken at 0 hours and 24 hours after scratching. The scratch area was calculated using ImageJ.
[0068] Matrigel and serum-free DMEM were mixed at a 1:10 ratio on an ice pack, and then 60 μl was added to the upper chamber of a Transwell cell culture chamber. The chamber was incubated at 37°C with 5% CO2 for 4 hours. Cells from both the control and experimental groups were digested with trypsin, washed once with serum-free medium, resuspended in serum-free medium, counted, and diluted to a density of 1 × 10⁻⁶ cells / mL. 6 / ml. Take 1×10 4 (Transfer experiment) or take 1×10 5 (Invasion Assay) Cells were seeded in the upper chamber of a Transwell cell culture chamber, and 600 μl of the corresponding 10% FBS-DMEM complete medium was added to the lower chamber. The chambers were incubated at 37°C in a 5% CO2 incubator for 24-48 hours. The upper chamber was then removed and inverted to remove the medium. A 24-well plate was prepared by adding 600 μl of 4% paraformaldehyde. The top of the upper chamber was gently blotted dry with a cotton swab, and the plate was placed in the 24-well plate and fixed for 20 minutes. The chamber was then immersed in crystal violet staining for 20 minutes, washed twice with PBS for 3 minutes each time, and air-dried. Cells were observed and counted under an inverted microscope.
[0069] The experimental results are shown in Figure 11-A , Figure 11-B , Figure 12-A , Figure 12-B , Figure 13-B and Figure 13-C . Figure 11-A CGN was overexpressed and knocked down in human pancreatic cancer cell lines, and the wound healing ability of pancreatic cancer cells was observed through a scratch assay. Figure 11-B Quantitative results of experimental migration in wound healing calculated for imageJ. Figure 12-ACGN was overexpressed and knocked down in human pancreatic cancer cell lines, and the migration and invasion abilities of the cells were observed using Transwell assays. Figure 12-B The results of cell counting were obtained for observation under an inverted microscope. Figure 13-B Cgn was overexpressed and knocked down in mouse pancreatic cancer cell lines, and the cell migration ability was observed through wound healing experiments. Figure 13-C Quantitative results of wound healing assay migration calculated for imageJ. All experimental results showed that pancreatic cancer cells CFPAC-1 and PK59, which highly express CGN, exhibited reduced migration and invasion abilities after CGN expression was knocked down by siRNA; while pancreatic cancer cells PANC-1 and PL-45, which low express CGN, exhibited enhanced migration and invasion abilities after CGN overexpression.
[0070] Example 4: Cell Growth Experiment
[0071] CGN overexpression was performed using a lentiviral system, with the same implementation scheme as in Example 2. One day in advance, 3000 PANC-1 and PL45 cells overexpressing CGN were seeded into 96-well plates and cultured for 5 days in cell culture medium containing 1% FBS. The relative growth of the cells was measured by adding CCK8 (Dojindo, #CK04) and measuring the absorbance value under a microplate reader every day.
[0072] CGN knockdown was performed using the Lipo3000 liposome transient transfection system. One day in advance, 3000 CFPAC-1 and PK-59 cells were seeded into 96-well plates, following the same implementation scheme as in Example 2. After transfection, the cells were cultured for 5 days in cell culture medium containing 1% FBS. The relative growth of the cells was measured by adding CCK8 each day and measuring the absorbance value under a microplate reader.
[0073] The experimental results are shown in Figure 7-B and Figure 13-A . Figure 7-B CGN overexpression promotes the proliferation of PANC-1 and PL45 pancreatic cancer cells, while CGN knockdown inhibits the proliferation of CFPAC-1 and PK-59 pancreatic cancer cells. Figure 13-A Cgn overexpression promotes the proliferation of Panc02 mouse pancreatic cancer cells; Cgn knockdown inhibits the proliferation of Panc02 C57BL / 6 mouse pancreatic cancer cells. All experimental results show that CGN overexpression promotes the in vitro proliferation of pancreatic cancer cells, while CGN knockdown inhibits the in vitro proliferation of pancreatic cancer cells.
[0074] Example 5: Immunofluorescence (IF) and Immunohistochemistry (IHC)
[0075] Paraffin sections or pancreatic cancer tissue microarrays were dewaxed with xylene, rehydrated with graded alcohols, and then subjected to antigen retrieval using sodium citrate buffer or EDTA buffer. Sections were treated in 3% H₂O₂ methanol for 10 minutes (this step was skipped for immunofluorescence), blocked with 5% goat serum at room temperature for 1 hour, and then incubated overnight at 4°C with anti-Cingulin antibody. The expression levels of these antigens were then detected using HRP-bound DAB or fluorescent secondary antibody.
[0076] The experimental results are shown in Figure 1-A , Figure 2-A , Figure 2-C , Figure 10-D . Figure 1-A This study shows the expression of CGN in pancreatic cancer tissue microarrays in adjacent normal cells, ADM, PanIN, and pancreatic cancer. Figure 2-A The expression of CGN in normal mice (a and e) and KC mice (b, c, d, f, g, and h) is shown. Figure 2-C The expression of CGN in ADM induced by taurine. Figure 10-D This study investigated the expression of CGN, Ki67, and pERK in xenografts / allogeneic pancreatic cancer in mice. Results showed that CGN was lowly expressed in adjacent normal acini and ducts of human pancreatic cancer tissue microarrays, with gradually increasing expression in ADM, PanIN, and pancreatic cancer. In normal C57BL / 6 mouse pancreas, CGN was lowly expressed in acini, ducts, and islets, while ADM and PanIN expression gradually increased in KC. In viridin-induced ADM, expression increased in the apical lumen of the ADM. Conversely, in CGN-knockdown pancreatic cancer xenografts / allogeneic tumors, the expression levels of Ki67 and pERK were decreased.
[0077] Example 6: Cell fluorescence
[0078] CGN overexpression and knockdown were performed using a lentiviral system, with the same implementation scheme as in Example 2. Cells were seeded one day in advance into 12-well plates with adhesive slides, and 2 mL of cell culture medium containing 10% FBS was added. The plates were then incubated at 37°C with 5% CO2 for 48 hours. After fixation with 4% paraformaldehyde at room temperature, the cells were permeabilized with 1‰ Triton X-100 permeabilization buffer at room temperature and blocked with 2% BSA at room temperature for 1 hour. The cells were then incubated overnight at 4°C with anti-Ki67 antibody, and the antigen expression level was detected using a fluorescent secondary antibody.
[0079] The experimental results are shown in Figure 8 Overexpression and knockdown of CGN in pancreatic cancer cells increased and downregulated Ki67 expression.
[0080] Example 7: Western blotting
[0081] Using the transfection protocol described in Example 2, CGN was overexpressed and knocked down in pancreatic cancer cells. Protein was collected, culture medium was discarded, and cells were washed three times with pre-cooled PBS (4°C). Cells were lysed with an appropriate amount of protease inhibitor-SDS lysis buffer (Boyotime, #P0013G). Cells were sonicated at 40 Hz for 10 seconds, and protein concentration was measured using a Beyotime BSA protein assay kit (#ST025). Then, 5×SDS-PAGE was performed, followed by boiling for 10 minutes. The loading volume was adjusted to 10 μg, and a standard Western blotting procedure was performed. The expression levels of the corresponding antigens (Cingulin, Elastase, Amylase, SOX9, pERK, ERK, Vimentin, and GAPDH antibodies) were detected. Protein bands were detected using a highly sensitive chemiluminescent substrate (Millipore, #WBKLS0500). Western blot results were quantified using ImageJ software; GAPDH expression levels were standardized. In a single imprint, its ratio to the internal reference represents a multiple change in its expression.
[0082] The experimental results are shown in Figure 1-C , Figure 2-B , Figure 7-A , Figure 9-C , Figure 12-C and Figure 13-A . Figure 1-C The expression levels of CGN in various pancreatic cancer cell lines and pancreatic duct cell lines were shown. Compared with duct cells, CGN was expressed at a higher level in pancreatic cancer cells. Figure 2-B The expression levels of CGN in normal mouse pancreas, ductal ligation, and taurine models were measured. The results showed that CGN expression was increased in all three ADM models compared to normal pancreas. Figure 7-A and Figure 13-A To test the transfection efficiency of CGN / Cgn by overexpression and knockdown, the results showed that both overexpression and knockdown of CGN / Cgn increased and decreased the amount of CGN / Cgn, respectively. Figure 9-C The activation of the MAPK / ERK signaling pathway was examined after CGN overexpression and knockdown. The results showed that CGN overexpression promoted the MAPK / ERK signaling pathway. Figure 12-C To investigate the effects of CGN overexpression and knockdown on Vimentin expression, the results showed that CGN overexpression promoted an increase in Vimentin expression.
[0083] Example 8: Real-time PCR
[0084] Total RNA was extracted from tissues or pancreatic cancer cell lines using TRIzol reagent (Invitrogen, #15596018), and the concentration was measured spectrophotometrically. First-strand cDNA was synthesized using ReverTra Acea reverse transcriptase (Takara, #RR047A) according to the manufacturer's instructions and used as a template in the following real-time PCR. The levels of CGN, CK19, Amylase, 18S, and GAPDH genes were measured using TB Green PremixEx Taq (Takara, #RR420A) reagent.
[0085] The experimental results are shown in Figure 1-C , Figure 2-B , Figure 7-A and Figure 13-A . Figure 1-C The transcriptional expression of CGN in various pancreatic cancer cell lines and pancreatic duct cell lines is shown. Compared with duct cell lines HPNE and HPDE, CGN has a higher expression level in pancreatic cancer cells. Figure 2-B The expression levels of CGN in normal pancreas, ductal ligation, viviparin, and KC models in C57BL / 6 mice were shown. The results indicated that CGN expression was increased in all three ADM models compared to normal pancreas. Figure 7-A and Figure 13-A To assess the transfection efficiency of CGN / Cgn through overexpression and knockdown, the results showed that both overexpression and knockdown of CGN / Cgn increased and decreased the transcriptional expression of CGN / Cgn, respectively.
[0086] Example 9: Cell Cloning
[0087] Using the stable transfection protocol described in Example 2, CGN was overexpressed and knocked down in pancreatic cancer cells. 500 PANC-1 and PL45 cells, and 1000 CFPAC-1 and PK-59 cells were seeded into 6-well plates and cultured for 2 weeks in cell culture medium containing 10% FBS. Cells were fixed with methanol for 20 minutes, stained with crystal violet (Beyotime, #C0121) for 30 minutes, and then washed three times with PBS. The number of colonies formed was observed and counted, and the 6-well plates were photographed against a white background.
[0088] The experimental results are shown in Figure 9-A , Figure 9-A Overexpression and knockdown of CGN in pancreatic cancer cells enhanced and weakened the clonogenic ability of pancreatic cancer cells.
[0089] Example 10: Bioinformatics Analysis
[0090] Single-cell transcriptome sequencing data:
[0091] The data used in this experiment were single-cell transcriptome sequencing data from the Gene Expression Omnibus (GEO) dataset: Dataset 1: GSE141017 used single-cell RNA-seq to analyze the development of pancreatic cancer in a KC mouse model from the pre-invasive stage to the tumor stage through seven stages before and after tumor formation. Dataset 2: GSE155698 contained 16 PDA tissue samples and 3 adjacent normal pancreatic samples. After mechanical dissection of the tissues and enzymatic digestion with collagenase P, single cells were obtained and sequenced using a 10x genome platform. Dataset 3: GSE180212 pancreatic tissues were collected from C57BL / 6J wild-type mice at different time points before and after acute inflammation (WT Day 1, Day 7, and Day 28). After digestion, single-cell suspensions were obtained and libraries were prepared using 10X single-cell 3' V3 chemical reagents.
[0092] Data quality control and preprocessing
[0093] The Seurat package in R was used to perform cell quality control on the downloaded dataset according to the following filtering criteria: cells were screened based on the raw transcription count of the cell matrix to remove cells with fewer than 200 transcriptions and more than 6000 transcriptions; and cells containing more than 5% or 10% mitochondrial genes. Additionally, genes expressed in fewer than 3 cells were removed from the analysis. Subsequently, the NormalizeData function was used to normalize the data based on the library size, and the ScaleData function was used to standardize the data based on the median size of all cell libraries.
[0094] Data dimensionality reduction and clustering
[0095] We used the Seurat package to screen for highly variable genes for calculating principal components (PCs). The genes with the highest variance were used for linear dimensionality reduction (principal component analysis), and Seurat's PCHeatmap and Elbowplot were considered to select the number of principal components used in downstream analyses. Cell clustering and UMAP dimensionality reduction visualization were performed using the FindClusters and RunTSNE functions, respectively. Each cell cluster was labeled with its uniquely expressed genes, and cell type annotation for each cluster was performed using known markers.
[0096] Forest diagram of subgroup analysis:
[0097] Transcriptome sequencing data and clinical information data from the TCGA pancreatic cancer dataset were downloaded from the UCSC XENA database. All samples were divided into two groups based on mean CGN expression values: high and low CGN expression. Subgroup analysis and survival analysis were performed on the two groups using the R package "Survival". Forest plots were then visualized using the R package "Forestplot".
[0098] The experimental results are shown in Figure 1-D , Figure 3-A , Figure 3-B , Figure 4-A , Figure 4-B , Figure 5 , Figure 9-B . Figure 1-D The expression of CGN in the pancreas and pancreatic cancer was analyzed in the GSE62452, GSE32676 and GSE71729 datasets. The results showed that the expression of CGN in the tumor was significantly increased compared with normal tissue. Figure 3-A Analysis of the GSE155698 single-cell transcriptome sequencing dataset showed that CGN was expressed higher in tumor cells and metaplastic cells than in normal acinar cells in epithelial cells. Figure 3-B Analysis of the GSE141017 single-cell transcriptome sequencing dataset showed that CGN was mainly highly expressed in metaplastic cells and ductal cells, and lowly expressed in normal acinar cells at various stages before and after tumor formation in the KC mouse model. Figure 4-A Analysis of the GSE62452 dataset shows that CGN expression is significantly higher in phases G2 and G3 compared to the normal group. Figure 4-B Survival analysis of the GSE71729 dataset showed that high CGN expression was significantly associated with shorter patient survival. Figure 5 Multivariate Cox regression analysis using the TCGA pancreatic cancer dataset showed that CGN expression is associated with prognostic survival in pancreatic cancer. Figure 9-B To perform differential expression analysis on the CGN expression groups of the GSE32676 dataset, the upregulated differentially expressed genes were mainly enriched in these pathways. The results showed that CGN positively regulates the MAPK signaling pathway and cell migration.
[0099] Table 1. Primers and peptides
[0100]
Claims
1. A biomarker for early diagnosis of pancreatic cancer, characterized in that, The assay includes an antibody against buttoninic protein (CGN) and a quantitative real-time polymerase chain reaction (qPCR) primer sequence. The CGN antibody is an antibody that blocks amino acid residues 7-356 or 307-412 of buttoninic protein CGN. The qPCR primer sequence is the reverse complementary sequence of the coding sequence CDS of the buttoninic protein CGN messenger ribonucleic acid mRNA. When the transcriptional and protein expression levels of buttoninic protein CGN are upregulated, the subject is in the early stage of pancreatic cancer. The qPCR primer sequence includes human CGN primer sequences: forward TGGAGTCCAGATTCGCTTCAT, reverse CCCGTAGGTACTGGCTCTTG; or mouse CGN primer sequences: forward CAGGCTGAGCTTACCCGAAA, reverse GTGGCACTCTTCAGCCTTCT.
2. The use of the early diagnostic biomarker for pancreatic cancer as described in claim 1 in the preparation of a kit for the early diagnosis of pancreatic cancer.
3. The application according to claim 2, characterized in that, The kit includes a downregulator of buttonin CGN, which is a designed short interfering RNA of buttonin CGN.
4. The application according to claim 3, characterized in that, The short interfering RNA sequence for button protein CGN has the following downregulatory sequences for human button protein CGN: GTCCAGATTCGCTTCATCACA; downregulatory sequence 1 for mouse button protein Cgn: GTGAGGAGGAAAGTTAGTTTG; and downregulatory sequence 2 for mouse button protein Cgn: TGGAGTTCAAATTCGATTTAT.
5. The application according to claim 4, characterized in that, The downregulator inhibited the proliferation, migration, and invasion of pancreatic cancer cells, as well as tumor growth in vivo.