A QTL gene for tolerance to salt stress and drought stress in corn and its application

Abstract

The invention discloses a QTL gene for corn tolerance to salt stress and drought stress, and the nucleotide sequence thereof is shown in SEQ ID No. 1. The overexpression material of the gene enhances the salt resistance and drought resistance of corn, and the mutant material weakens the salt resistance and drought resistance of corn. The corn salt and drought resistance QTL of the invention can be used to regulate the salt and drought resistance of corn and breed salt and drought resistant corn varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural gene engineering, and specifically relates to a gene related to corn salt resistance and drought resistance and an application thereof. Background Art

[0002] Drought is one of the most common and most serious natural disasters in agricultural production. Nearly two-thirds of my country's arable land is located in arid and semi-arid areas. Coupled with the scarcity and uneven distribution of water resources, drought has become the most important environmental factor restricting my country's agricultural production. In addition, saline-alkali land is widely distributed in my country, with nearly 100 million hectares of salinized land, and one-quarter of the arable land has varying degrees of salinization. The reduction in grain production caused by salinization of arable land is second only to drought. Therefore, the negative impact of drought and salt stress on the development of agriculture in my country and even the world is becoming increasingly prominent, seriously threatening global food security.

[0003] Corn is one of the three major crops, and is a crop that can be used as food, feed, and fuel. The high and stable yield of corn is of great significance to my country's food security and social development. Corn is very sensitive to salt stress and drought stress. Salinization of cultivated land and drought stress during the growth period are the main abiotic stresses that lead to reduced corn production in my country. It is worth noting that in the main corn-producing areas in the north where rainfall is insufficient and reliance on groundwater irrigation, salinization of cultivated land is often more serious and has a trend of increasing. Therefore, my country's corn industry has an urgent need for multi-resistant varieties that are both salt-resistant and drought-resistant. An effective measure to meet this demand is to explore the basic laws of corn salt and drought resistance, tap the potential of corn genetic resources, synergistically improve corn salt and drought resistance, and cultivate multi-resistant varieties.

[0004] ABA is an important plant hormone. Studies have shown that ABA plays an important role in a variety of physiological processes such as stomatal closure, cuticle wax accumulation, leaf senescence, bud dormancy, seed germination, osmotic regulation and growth inhibition (Kumare et al., 2019; Zhu, 2016), and can regulate downstream genes to respond to biotic and abiotic stresses including osmotic stress through transcriptional and post-transcriptional regulatory mechanisms (Sah et al., 2016; Yang and Guo, 2018b; Yoshida et al., 2014). The ABA signaling pathway is an important component of plant drought and salt stress responses (Zhu, 2002, 2016). In the past 20 years, ABA biosynthesis and related signal transduction pathways have been well studied. Under ABA deficiency conditions, the ABA receptor PYL cannot interact with PP2C, PP2C is in a highly active state and inhibits the activity of its downstream functional component SnRK2s; when salt stress comes, ABA content increases, and PYL bound to ABA can interact with PP2C, relieving the inhibitory effect of PP2C on SnRK2s. The activated SnRK2s activates downstream transcription factors through protein phosphorylation on the one hand, and directly acts on related proteins to respond to salt stress on the other hand. The maize genome ZmPYL1 has the highest homology with the Arabidopsis genome AtPYL1. The identification of these proteins provides more research ideas for the response mechanism of ABA to osmotic stress.

[0005] In order to explore the key genes of the common mechanism of salt and drought resistance, the inventors constructed overexpression and mutant materials of ZmPYL1 and found that ZmPYL1 is related to salt and drought resistance of corn at the seedling stage. The relevant research results are expected to reveal important common molecular mechanisms of corn salt and drought resistance, and lay an important theoretical and material foundation for the coordinated improvement of corn salt and drought resistance. Summary of the invention

[0006] On the one hand, the present application provides a corn QTL gene for tolerance to salt stress and drought stress, whose nucleotide sequence is SEQ ID NO.1.

[0007] Furthermore, the corn salt resistance and drought resistance QTL gene is located at positions 112,961,005-112,965,316 on chromosome 9 of corn.

[0008] On the other hand, the present application provides a protein encoded by the gene according to claim 1, whose amino acid sequence is shown in SEQ ID NO.2.

[0009] On the other hand, the present application provides the use of the above-mentioned corn salt-resistance and drought-resistance QTL genes in regulating corn salt-resistance and drought-resistance properties.

[0010] Furthermore, in the application, the above-mentioned corn salt-resistance and drought-resistance QTL genes in the starting corn plants or varieties are knocked out to obtain corn plants or varieties with lower salt-resistance and drought-resistance than the starting corn plants or varieties.

[0011] Furthermore, the knockout is performed using the CRSPR-Cas9 method.

[0012] Furthermore, in the application, the above-mentioned corn salt-resistance and drought-resistance QTL genes in the starting corn plants or varieties are overexpressed to obtain corn plants or varieties with higher salt tolerance and drought tolerance than the starting corn plants or varieties.

[0013] On the other hand, the present application provides the application of the above-mentioned corn salt-resistance and drought-resistance QTL genes in salt-resistance and drought-resistance corn breeding.

[0014] Furthermore, in the application, the expression level of the above-mentioned corn salt-resistance and drought-resistance QTL gene is detected, and corn plants or varieties with high expression levels of the above-mentioned corn salt-resistance and drought-resistance QTL gene are selected for breeding.

[0015] Furthermore, in the application, the above-mentioned maize salt-resistance and drought-resistance QTL genes are overexpressed in maize.

[0016] The methods for overexpressing genes and available vectors and other tools can be obtained by those skilled in the art based on the common knowledge in the art or existing materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 (A) Schematic diagram of the pBUE411-ZmPYL1 vector structure of the salt- and drought-resistant gene ZmPYL1; (B) comparison of the gene sequence after knockout using CRSPR-Cas9 and the original gene sequence; (C) Schematic diagram of the PbCXUN-Myc-ZmPYL1 vector structure; (D) detection of overexpression levels of overexpression strains.

[0018] Figure 2 Schematic diagram of the structure of the ZmPYL1 gene.

[0019] Figure 3 The wild-type and ZmPYL1 knockout plants (ZmPYL1) were grown in control soil for 7 days and treated with 300 mM NaCl and water, respectively. crispr -1,ZmPYL1 crispr -2), ZmPYL1 gene overexpression plants (ZmPYL1 OE -1,ZmPYL1 OE -2) (A) Water content phenotype photo, (B) Water content measurement results. Scale bar in A: 15 cm.

[0020] Figure 4Wild-type and ZmPYL1 knockout plants (ZmPYL1 crispr -1,ZmPYL1 crispr -2), ZmPYL1 gene overexpression plants (ZmPYL1 OE -1,ZmPYL1 OE -2) drought phenotype diagram. DETAILED DESCRIPTION

[0021] The following examples are provided to facilitate a better understanding of the present invention, but are not limited thereto. These examples are only used for illustrative purposes and in no way limit the scope of protection of the present invention.

[0022] Unless otherwise specified, the equipment and reagents used in each example are commercially available.

[0023] Example 1 Cloning and functional analysis of corn salt resistance genes

[0024] The ABA signaling pathway is an important component of plant drought and salt stress responses and has been well studied in Arabidopsis. ZmPYL1 in the maize genome has the highest homology with AtPYL1 in the Arabidopsis genome and may also play a role in maize's resistance to salt and drought stress. In order to verify the function of ZmPYL1, CRSPR-Cas9 mutants and overexpression materials of ZmPYL1 were constructed.

[0025] In order to obtain mutants of ZmPYL1, the inventors (1) designed CRSPR-Cas9 knockout targets, such as Figure 1 B (gRNA sequences are SEQ ID NO.3 and SEQ ID NO.4); (2) The PCR fragment containing the target sequence and the pBUE411 vector were digested and ligated with BsaI, and the ligation product was transferred into Escherichia coli. The colony PCR amplification was performed with universal primers FD3 / RD. The colonies with the target size bands detected by electrophoresis were positive clones. The corresponding bacterial liquid was sent to Beijing Sanbo Yuanzhi Biotechnology Co., Ltd. for sequencing to obtain the correct pBUE411-ZmPYL1 vector ( Figure 1 A, B), pBUE411-ZmPYL1 was transferred into Agrobacterium EHA105; (3) transgenic plants were obtained by embryo infection; (4) transgenic positive plants were confirmed by PCR amplification and sequencing of gene fragments including the target site. Finally, two knockout materials of ZmPYL1 candidate genes were obtained (named ZmPYL1 crispr -1 and ZmPYL1 crispr -2)( Figure 1A, B). The wild type and mutant materials were grown in the control soil for 7 days, treated with 300mM NaCl and water respectively, and the aboveground biomass was measured as W1. The aboveground part was dried in an oven at 80℃ for 48h, and the dry weight W2 was measured. The leaf water content Leaf WC (% of FW) = (W1-W2) / W1 was calculated. Figure 3 As shown in A and B, under 300 mM NaCl conditions, the leaf water content of the wild type was 86%, and that of the mutant was 85%, with a T test ≤ 0.0002. Compared with the wild type, the ZmPYL1 gene knockout plants were more sensitive to salt stress and had reduced water content, indicating that this gene can indeed regulate the salt stress tolerance of corn.

[0026] In order to obtain ZmPYL1 overexpressing plants, the inventors (1) predicted the structure of the ZmPYL1 gene based on the MaizeGDB website. The full length of the gene (from the start codon to the stop codon) is 618 bp and contains only one exon, such as Figure 2 (2) To clone the full-length coding sequence of ZmPYL1, 10-day-old salt-resistant maize inbred line B73 seedlings were used as materials, and total RNA was extracted using the plant total RNA extraction kit (Cat.# DP432) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and cDNA was obtained by reverse transcription using M-MLV reverse transcriptase of Promega (Beijing) Biotechnology Co., Ltd., and ZmPYL1-specific primers (forward primer ZmPYL1-gene-F: ATGGACCAGCAGGGTGCGGGC (SEQ ID No. 5); reverse primer ZmPYL1-gene-R: CTACTCCGACGGCGGCGGGG (SEQ ID No.6) was used for PCR amplification, and a product with the expected size (618 bp) was obtained. The tailed PCR product was recovered and purified using the gel recovery kit (Cat.#DP105-3) of Tiangen Biochemical Technology (Beijing) Co., Ltd.; (3) The recovered PCR fragment was connected to the pBCXUN-Myc vector digested with XcmⅠ, and the ligation product was transferred into Escherichia coli. The primers Ubip-seq-F (TTTTAGCCCTGCCTTCATACGC SEQ ID No.7) and NosR-seq-R (AGACCGGCAACAGGATTCAATC SEQ ID No.8) on the vector were used for colony PCR amplification. The colonies with the target size bands detected by electrophoresis were positive clones, and the corresponding bacterial liquid was sent to Beijing Sanbo Yuanzhi Biotechnology Co., Ltd. for sequencing to obtain the correct pBCXUN-Myc-ZmPYL1 vector ( Figure 1C), transferring pBCXUN-Myc-ZmPYL1 into Agrobacterium EHA105; (3) obtaining transgenic plants by infection of immature embryos; (4) detecting the expression level of ZmPYL1 gene in the plants ( Figure 1 D), and sequencing confirmed the transgenic positive plants. Finally, two ZmPYL1 candidate gene overexpression materials (named ZmPYL1 OE -1 and ZmPYL1 OE -2). The wild type and overexpression materials were grown in control soil for 7 days, treated with 300 mM NaCl and water respectively, and the aboveground biomass was measured as W1. The aboveground part was dried in an oven at 80°C for 48 h, and the dry weight W2 was measured. Leaf water content Leaf WC (% of FW) = (W1-W2) / W1 was calculated. Figure 3 As shown in A and B, under 300 mM NaCl conditions, the leaf water content of the wild type was 86%, and that of the overexpressed material was 88.13%, with T test ≤ 0.002. Compared with the wild type, the ZmPYL1 gene overexpression material significantly enhanced its tolerance to salt stress.

[0027] Example 2 Functional analysis of maize drought resistance gene ZmPYL1

[0028] The wild-type and ZmPYL1 knockout plants (ZmPYL1 crispr -1,ZmPYL1 crispr -2), ZmPYL1 gene overexpression plants (ZmPYL1 OE -1,ZmPYL1 OE -2) Seeds are sown in 400g of soil that has absorbed enough water. Six seeds are planted in each plastic pot. A layer of soil is then covered on the top layer, flattened, and grown under normal conditions. When the corn seedlings grow to the three-leaf stage, seedlings with consistent growth are selected, watered sufficiently, and excess water is removed after the soil has fully absorbed the water. Drought treatment begins. After about 2 weeks of treatment, the wilting phenotype of the corn seedling leaves can be observed, and photos can be taken at an appropriate time. Figure 4 As shown in the figure, compared with the wild type, the drought resistance of ZmPYL1 overexpressing materials was significantly enhanced, while the drought resistance of ZmPYL1 mutant materials was significantly weakened, indicating that this gene can indeed regulate the drought tolerance of maize.

Claims

1. An application of a corn QTL gene tolerant to salt stress and drought stress in regulating corn salt and drought tolerance, wherein the nucleotide sequence of the corn QTL gene is SEQ ID NO.1; in the application, the corn QTL gene in the starting corn plant or variety is knocked out to obtain a corn plant or variety with lower salt and drought tolerance than the starting corn plant or variety.

2. The use according to claim 1, wherein the knockout is performed using the CRSPR-Cas9 method.

3. An application of a corn QTL gene that tolerates salt stress and drought stress in regulating corn salt and drought tolerance, wherein the nucleotide sequence of the corn QTL gene is SEQ ID NO.1; in the application, the corn QTL gene in the starting corn plant or variety is overexpressed to obtain a corn plant or variety with higher salt and drought tolerance than the starting corn plant or variety.

Images