Lactobacillus delbrueckii and application thereof

Abstract

The present invention relates to the field of bioengineering technology, and more particularly to a Lactobacillus delbrueckii strain and its use. The present invention isolates a strain of Lactobacillus delbrueckii, Mafic1501, from pig feces and deposits it with a biological deposit number of CGMCC No. 26198. The Lactobacillus delbrueckii strain Mafic1501 provided by the present invention can effectively improve the intestinal health and growth performance of pigs, particularly low-birth-weight pigs. It can effectively improve the growth performance of low-birth-weight pigs, improve their physiological health, and enhance pig production efficiency, which is of great significance in the pig farming industry.

Description

Technical Field

[0001] The present invention relates to the technical field of bioengineering, in particular to a Lactobacillus delbrueckii and an application thereof. Background Art

[0002] As living standards improve, the demand for pork is also increasing. This has not only fueled the development of the pig farming industry but also placed higher demands on pig farms. For producers, improving pig farm production translates to increasing annual output. However, congenitally low birth weight pigs are common, resulting in low survival rates and high mortality rates, severely impacting the profitability of the pig farming industry. Therefore, improving the survival rate and postnatal growth performance of low birth weight pigs is key to reducing economic losses.

[0003] Relevant studies have found that compared with normal pigs, low-birth-weight pigs have many developmental defects, such as damaged intestinal barrier, increased intestinal inflammation levels, abnormal physiological metabolic processes, and poor digestive ability. These defects will also affect weaned piglets and growing pigs, and ultimately affect the pigs' market weight. These defects are significantly correlated with changes in their intestinal microbial composition and structure.

[0004] The extensive use of antibiotics has led to increasingly prominent problems such as livestock product safety and bacterial resistance. Therefore, finding efficient alternatives to antibiotics in piglet production to improve their growth performance is an urgent task. At present, the growth-promoting methods commonly used in production are mainly aimed at healthy and normal pigs, and there are few intervention methods used for low-birth-weight pigs. The incidence of low-birth-weight pigs in production can reach 15-20%, causing huge economic losses to the pig industry. Therefore, fundamentally improving the survival rate and growth performance of low-birth-weight pigs in lactation and improving their physiological health status are key to improving pig production efficiency and reducing economic losses. There are many commonly used growth promoters in production, such as probiotics, prebiotics, plant extracts, etc. How to select effective intervention methods to improve piglet growth performance and intestinal health has become a technical problem that needs to be solved urgently in this field. Summary of the Invention

[0005] In order to solve the problems in the prior art, the present invention provides a Lactobacillus delbrueckii and application thereof.

[0006] Currently, producers are pursuing high sow productivity, especially litter size, to obtain more commercial pigs. However, high litter size is accompanied by a high number of low-birth-weight pigs. Low-birth-weight pigs also have poor growth performance, high morbidity and mortality rates, which directly impact the economic benefits of the pig farming industry.

[0007] At present, researchers have found that the occurrence of low-birth-weight pigs is affected by a variety of factors. On the one hand, the nutrients that can be provided in the sow's uterus during pregnancy are limited. Therefore, the more fetuses there are, the less intrauterine nutrition each fetus can be allocated, and the more likely it is that the fetus will have developmental problems. Therefore, as the number of piglets born by sows increases during production, the number of low-birth-weight pigs will also increase. On the other hand, compared with normal pigs and low-birth-weight pigs, there are many key differences in microorganisms between the two, and there is a significant correlation between these key differences in microorganisms and intestinal inflammation and metabolic disorders in low-birth-weight pigs. Therefore, starting from the key differences in microorganisms, looking for microorganisms that promote the growth performance and intestinal health of low-birth-weight pigs can develop growth-promoting feed additives for low-birth-weight pigs.

[0008] Furthermore, probiotics are widely used in the livestock industry as a growth-promoting alternative to antibiotics. Currently used probiotics include Lactobacillus, Bacillus, and Clostridium butyricum. These are primarily used in healthy and normally developing animals, with few examples targeting low-birth-weight animals. Therefore, developing potential probiotics specifically for low-birth-weight pigs holds great promise.

[0009] In this study, a Lactobacillus delbrueckii Mafic1501 with potential probiotic function was invented. Targeted at the physiological background of low birth weight pigs with poor growth performance, impaired intestinal health and high morbidity, it can significantly improve the growth performance of low birth weight pigs during lactation, increase the weaning weight of piglets, promote colon barrier development, reduce the level of colon inflammation and regulate the composition and structure of intestinal microorganisms, thereby achieving the expected reduction in economic benefits losses in the pig farming industry, and has broad development prospects.

[0010] In a first aspect, the present invention provides a Lactobacillus delbrueckii Mafic1501, wherein the deposit number of the Lactobacillus delbrueckii Mafic1501 is CGMCC No.26198.

[0011] The present invention isolated a strain from pig feces. Through verification of its physicochemical properties and detection of its 16S rRNA gene, it was confirmed that it is identical to Lactobacillus delbrueckii. Therefore, it was named Lactobacillus delbrueckii Mafic1501 and a biological deposit was made. The specific deposit information is as follows:

[0012] Deposit number: CGMCC No.26198; Classification name: Lactobacillus delbrueckii; Deposit unit: General Microbiology Center of China Culture Collection Administration; Deposit address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101; Deposit date: December 14, 2022.

[0013] The present invention further provides a bacterial agent comprising the Lactobacillus delbrueckii Mafic1501 or a fermentation product thereof.

[0014] Furthermore, the total viable count of Lactobacillus delbrueckii Mafic1501 in the bacterial agent is 1×10 7～10 cfu / mL.

[0015] In a second aspect, the present invention provides the use of the Lactobacillus delbrueckii Mafic1501 or the bacterial agent in improving the intestinal health of animals.

[0016] The present invention further provides the use of the Lactobacillus delbrueckii Mafic1501 or the bacterial agent in the preparation of a medicine for improving the intestinal health of animals.

[0017] Furthermore, improving the intestinal health of animals includes:

[0018] Improve the composition and structure of microorganisms in the intestine of an animal, promote the development of the intestinal barrier, or reduce the level of intestinal inflammation.

[0019] Furthermore, the above-mentioned improvement of the composition and structure of microorganisms in the intestine of an animal includes: increasing the abundance of Lactobacillus and Bifidobacterium.

[0020] Furthermore, the above-mentioned promotion of intestinal barrier development includes: increasing the expression of Mucin-2 protein and ZO-1 protein.

[0021] Furthermore, the aforementioned alleviation of intestinal inflammation levels includes: reducing the levels of pro-inflammatory factors, and the pro-inflammatory factors preferably include IFN-γ, IL-8 and IL-12.

[0022] The present invention further provides the use of the Lactobacillus delbrueckii Mafic1501 or the bacterial agent in improving the growth performance of animals.

[0023] Furthermore, the animal is a pig.

[0024] Furthermore, the animal is a low birth weight suckling piglet.

[0025] The incidence of low birth weight pigs in production can reach 15-20%, causing huge economic losses to the pig farming industry. The Lactobacillus delbrueckii Mafic1501 provided by the present invention can effectively address the many developmental defects of low birth weight suckling piglets, such as damaged intestinal barrier and increased intestinal inflammation levels, effectively improve the intestinal health of piglets, and significantly enhance their growth and development status.

[0026] The present invention has the following beneficial effects:

[0027] The present invention isolates a Lactobacillus delbrueckii Mafic1501 from pig feces, which has an excellent effect on improving the growth and intestinal health of low-birth-weight pigs. Feeding newborn piglets with this strain can effectively improve the microbial composition and structure of the piglet's intestine, promote the development of the piglet's intestinal barrier, reduce the level of intestinal inflammation in the piglet, and thus improve the health level of low-birth-weight pigs. This is of great significance for improving the production level of the pig farming industry and increasing economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 Schematic diagram of the colony of Lactobacillus delbrueckii Mafic1501 provided in Example 1 of the present invention.

[0030] Figure 2 This is a schematic diagram of the morphological observation of Lactobacillus delbrueckii Mafic1501 provided in Example 1 of the present invention.

[0031] Figure 3 This is a schematic diagram of the growth of Lactobacillus delbrueckii Mafic1501 provided in Example 2 of the present invention.

[0032] Figure 4 This is a schematic diagram of the sugar fermentation test results of Lactobacillus delbrueckii Mafic1501 provided in Example 2 of the present invention.

[0033] Figure 5 3 is a schematic diagram comparing the growth performance of piglets in each group provided in Example 3 of the present invention.

[0034] Figure 6 This is a schematic diagram comparing the immunoglobulin levels of piglets in each group provided in Example 3 of the present invention.

[0035] Figure 7 This is a schematic diagram of the quantitative results of Lactobacillus and Lactobacillus delbrueckii in the intestines of each group of piglets provided in Example 3 of the present invention; the upper left is the quantitative results of Lactobacillus in the ileum, the lower left is the quantitative results of Lactobacillus in the colon, the upper right is the quantitative results of Lactobacillus delbrueckii in the ileum, and the lower right is the quantitative results of Lactobacillus delbrueckii in the colon.

[0036] Figure 8 This is a schematic diagram of the composition and structure of microorganisms in the intestines of each group of piglets provided in Example 3 of the present invention.

[0037] Figure 9 Schematic diagram of the expression of Mucin-2 and ZO-1 in each group of piglets provided in Example 3 of the present invention; wherein, the left figure shows the expression of Mucin-2, and the right figure shows the expression of ZO-1.

[0038] Figure 10 This is a schematic diagram of the levels of various pro-inflammatory factors in the intestines of each group of piglets provided in Example 3 of the present invention; the left figure is IFN-γ, the middle figure is IL-8, and the right figure is IL-12. DETAILED DESCRIPTION

[0039] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0040] Example 1

[0041] This example provides a process for the isolation and identification of Lactobacillus delbrueckii Mafic1501, as follows:

[0042] 1. Isolation of Lactobacillus delbrueckii Mafic1501

[0043] Lactobacillus delbrueckii Mafic1501 was isolated from feces of weaned piglets from a hybrid of Duroc, Chang, and Dayuan. The piglets were raised at the Animal Experimental Base of the Ministry of Agriculture and Rural Affairs' Feed Industry Center in Dacaoping Village, Tanghe Township, Fengning Manchu Autonomous County, Chengde City, Hebei Province. The specific isolation method is as follows:

[0044] 1. Plate coating and streaking: Take 2g of feces from three-way hybrid weaned piglets and dilute them in a gradient manner with sterile PBS buffer. 4 -10 6 100 μL of the dilution solution was evenly spread on MRS plate culture medium. After anaerobically incubated at 37°C for 24 h, single colonies were picked on the plate according to the colony morphology (size, color, etc.), inoculated onto MRS plate culture medium for streak purification, and anaerobically incubated.

[0045] 2. Liquid culture and seed preservation: Pick a purified single colony and inoculate it into MRS liquid culture medium. After anaerobically incubating at 37°C for 24 hours, use 50% sterile glycerol for seed preservation.

[0046] 3. 16S rRNA gene sequencing and identification: The bacterial culture of Lactobacillus delbrueckii Mafic1501 was taken, and after DNA extraction and PCR amplification, 16S rRNA gene sequencing and identification were performed using bacterial universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT).

[0047] The 16S rRNA gene sequence of the strain Lactobacillus delbrueckii Mafic1501 was compared with the 16S rRNA gene sequences of all determined bacteria in the NCBI database. The 16S rRNA gene sequence of the strain Lactobacillus delbrueckii Mafic1501 had the highest homology similarity with Lactobacillus delbrueckii subsp. Bulgaricus B37, which was 99.86%. The strain was determined to be Lactobacillus delbrueckii.

[0048] This example further deposited the strain, and the deposit information is as follows:

[0049] Deposit number: CGMCC No.26198; Classification name: Lactobacillus delbrueckii; Deposit unit: General Microbiology Center of China Culture Collection Administration; Deposit address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101; Deposit date: December 14, 2022.

[0050] 2. Morphological and physiological and biochemical characteristics of the strain

[0051] This example further performed morphological and physiological and biochemical identification on the Lactobacillus delbrueckii Mafic1501 isolated above.

[0052] 1. Colony morphology observation: Figure 1 As shown, a single colony of Lactobacillus delbrueckii Mafic1501 is about 1 mm in diameter, white in color, opaque, with a slightly convex surface and regular edges.

[0053] 2. Observation of bacterial morphology: Figure 2 As shown in the figure, Gram staining and optical microscopy showed that Lactobacillus delbrueckii Mafic1501 was a Gram-positive bacterium, slender rod-shaped, without flagella, and non-motile.

[0054] Example 2

[0055] This example provides a characteristic evaluation process for Lactobacillus delbrueckii Mafic1501:

[0056] Seed liquid activation: strain Lactobacillus delbrueckii Mafic1501 was inoculated into sterilized MRS liquid culture medium, cultured anaerobically at 37°C for 12 hours, and then taken out for use.

[0057] 1. Growth curve determination

[0058] A certain amount of bacterial liquid was drawn from the seed liquid at a 2% inoculum volume and inoculated into MRS liquid medium, and cultured anaerobically at 37°C. The culture liquid was measured at OD 0. 600 The result is as follows Figure 3 The results showed that Lactobacillus delbrueckii Mafic1501 entered the logarithmic growth phase at 4 h and the plateau phase at 12 h.

[0059] 2. Acid resistance test

[0060] A 2% inoculum of seed culture of Lactobacillus delbrueckii Mafic1501 was inoculated into MRS medium at a pH of 3. Viable bacteria were counted at 0 and 3 hours, and the bacterial survival rate was calculated. As shown in Table 1, the survival rate of Lactobacillus delbrueckii Mafic1501 was 77.5% at 3 hours in an acidic environment, indicating that Lactobacillus delbrueckii Mafic1501 has good acid resistance and can survive for 3 hours in a pH of 3 environment.

[0061] Table 1 Acid resistance test of Lactobacillus delbrueckii Mafic1501

[0062]

[0063] 3. Bile salt tolerance test

[0064] The seed culture of Lactobacillus delbrueckii Mafic1501 was inoculated into MRS medium with 0.3% bile salt at a 2% inoculation rate, and the OD value was measured after 3 h of culture. 600 The inhibition rate of bacterial growth under 0.3% bile salt conditions was calculated. The results are shown in Table 2. Under 0.3% bile salt conditions for 3 hours, the growth inhibition rate of Lactobacillus delbrueckii Mafic1501 was 59.31%, indicating that the strain of Lactobacillus delbrueckii Mafic1501 has a certain bile salt tolerance.

[0065] Table 2 Bile salt tolerance test of Lactobacillus delbrueckii Mafic1501

[0066]

[0067] 4. Sugar fermentation test

[0068] Lactobacillus delbrueckii Mafic1501 was inoculated into the biochemical identification tube and cultured anaerobically at 37°C for 24 hours. Figure 4As shown, Lactobacillus delbrueckii Mafic1501 can utilize lactose, sorbitol, inulin, raffinose, sucrose, cellobiose, salicin, mannitol and maltose as fermentation substrates.

[0069] Example 3

[0070] This example provides the effects of Lactobacillus delbrueckii Mafic1501 on growth performance and intestinal health of low birth weight pigs, as follows:

[0071] 1. Experimental Design

[0072] Twelve newborn piglets weighing about 1.4 kg were selected as the control (CON) group and given sterile saline on the 1st to 7th day after birth; 24 newborn piglets weighing about 1.0 kg were selected and randomly divided into two groups (the IUGR group was a low birth weight group and given sterile saline on the 1st to 7th day after birth; the L.del group was a Lactobacillus delbrueckii group and given a 2×10 9 Each group of 12 piglets received a 2 mL Lactobacillus delbrueckii Mafic1501 bacterial solution containing 100 CFU / mL of Lactobacillus delbrueckii. The solution was administered orally once daily from day 1 to day 7. The experimental pig house maintained a constant temperature and humidity, and the piglets had free access to breast milk and water. During the experiment, the piglets' condition, survival, and clinical abnormalities were observed and recorded daily.

[0073] 2. Sample collection and index testing

[0074] (1) During the experiment, the body weights of piglets were recorded at 8 and 21 days of age.

[0075] (2) When the piglets were 8 days old, 4 piglets were randomly selected from each group for slaughter and sampling, including intestinal tissue samples and chyme samples; when the piglets were 21 days old, the anterior vena cava blood was collected from the piglets.

[0076] 3. Test results

[0077] (1) Growth performance: Figure 5 As shown in the results, after Lactobacillus delbrueckii intervention from day 1 to day 7 after birth, the growth performance of piglets in the L.del group was significantly improved compared with the IUGR group.

[0078] (2) Immunoglobulin levels: Figure 6 As shown in the results, compared with the IUGR group, Lactobacillus delbrueckii can improve the serum immunoglobulin (IgA and IgG) levels of piglets to a certain extent. This result shows that Lactobacillus delbrueckii intervention in low birth weight piglets in the early lactation period can effectively improve the immune function of piglets.

[0079] (3) Absolute quantification of Lactobacillus delbrueckii in the ileum and colon: Figure 7As shown in the results, Lactobacillus delbrueckii significantly increased the abundance of Lactobacillus in the piglet colon, and the abundance of Lactobacillus delbrueckii in the ileum and colon was also significantly increased. This result shows that Lactobacillus delbrueckii can effectively colonize the piglet intestine, and that Lactobacillus delbrueckii intervention in low-birth-weight piglets during early lactation can significantly increase the abundance of the core Lactobacillus genus in the intestine.

[0080] (4) Colonic microbial composition and structure: By comparing the results of different species composition ( Figure 8 ) found that compared with normal pigs, the important intestinal microbial genus Oscillospira was significantly reduced in low-birth-weight pigs; however, after Lactobacillus delbrueckii intervention, the abundance of Lactobacillus and Bifidobacterium genera was significantly increased. These results suggest that Lactobacillus delbrueckii intervention in low-birth-weight piglets during early lactation can alter the composition of colonic microbes, increase the abundance of beneficial bacteria, and thus alleviate intestinal disorders.

[0081] (5) Colonic barrier development: Figure 9 As shown in the results, Lactobacillus delbrueckii significantly increased the expression of tight junction-related protein genes (Mucin-2 and ZO-1) in the colon of low-birth-weight suckling piglets. This result indicates that Lactobacillus delbrueckii can improve the intestinal barrier integrity of low-birth-weight piglets during lactation.

[0082] (6) Level of colon inflammation: Figure 10 As shown in the results, compared with the IUGR group, Lactobacillus delbrueckii significantly reduced the levels of pro-inflammatory factors such as IFN-γ, IL-8, and IL-12 in the colon of low-birth-weight piglets. This result indicates that Lactobacillus delbrueckii intervention in low-birth-weight piglets during early lactation can effectively alleviate colon inflammation and promote intestinal health.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A Lactobacillus delbrueckii ( Lactobacillus delbrueckii ) Mafic1501, characterized in that, The deposit number of the Lactobacillus delbrueckii Mafic1501 is CGMCC No. 26198.

2. A bacterial agent, characterized in that The bacterial agent includes the Lactobacillus delbrueckii Mafic1501 described in claim 1.

3. The microbial agent according to claim 2, characterized in that The total viable count of Lactobacillus delbrueckii Mafic1501 in the bacterial agent is 1×10 7~10 cfu / mL.

4. Use of the Lactobacillus delbrueckii Mafic1501 according to claim 1, or the bacterial agent according to claim 2 or 3, in the preparation of a feed additive for improving the intestinal health of animals; The animals are low birth weight suckling piglets.

5. The use according to claim 4, characterized in that Improving the intestinal health of animals includes: Improve the composition and structure of microorganisms in the intestine of an animal, promote the development of the intestinal barrier, or reduce the level of intestinal inflammation.

6. The use according to claim 5, characterized in that The improving the composition and structure of microorganisms in the intestinal tract of the animal comprises: increasing the abundance of Lactobacillus and Bifidobacterium; and / or, The promoting the development of the intestinal barrier comprises: increasing the expression of Mucin-2 protein and ZO-1 protein; and / or, The said reducing the level of intestinal inflammation includes: reducing the level of pro-inflammatory factors.

7. The use according to claim 6, characterized in that The pro-inflammatory factors include one or more of IFN-γ, IL-8 or IL-12.

8. Use of the Lactobacillus delbrueckii Mafic1501 according to claim 1, or the bacterial agent according to claim 2 or 3, in the preparation of a feed additive for improving the growth performance of animals; The animals are low birth weight suckling piglets.

Images