Nucleic acid constructs and their use in treating spinal muscular atrophy

Abstract

This application discloses a nucleic acid comprising a first nucleic acid region and a second nucleic acid region, wherein the first nucleic acid region contains a nucleic acid sequence encoding an SMN protein or a variant thereof; and the second nucleic acid region contains one or more target segments of one or more endogenous microRNAs, wherein the second nucleic acid region is located at the 3' of the first nucleic acid region.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of PCT patent application No. PCT / CN2020 / 107173 filed on August 5, 2020 and PCT patent application No. PCT / CN2020 / 138056 filed on December 21, 2020, each of which is incorporated herein by reference in its entirety.

[0003] References to sequence listings submitted electronically

[0004] This application contains a sequence listing, which is electronically submitted via EFS-Web in an ASCII formatted sequence listing together with the file "14652-017228_SEQ_LISTING.txt", which was generated on July 21, 2021 and is 108,587 bytes in size. The sequence listing submitted via EFS-Web is part of this specification and is incorporated herein by reference in its entirety. 1. Technical Field

[0006] The present disclosure relates to nucleic acid constructs, gene therapy based on such constructs, and methods of use thereof. 2. Background technology

[0008] Spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disease characterized by progressive muscle weakness and hypotonia due to loss of lower motor neurons. Four clinical phenotypes have been described, depending on the age of onset and the severity of neuromuscular symptoms (Lunn and Wang, Lancet, 371(9630):2120-33 (2008)). The most severe type, type 1 SMA, is a devastating childhood disease also known as Werdnig-Hoffmann disease. The gene responsible for most cases of SMA, survival motor neuron (SMN), has been identified at chromosome locus 5q13 (Lefebvre et al., Cell, 80(1):155-65 (1995)). The human gene is composed of telomeric and centromeric copies, SMN1 and SMN2, respectively. SMA is caused by mutations or deletions in the SMN1 gene, which results in depletion of SMN protein due to the inability of SMN2 to produce sufficient amounts of the full-length protein.

[0009] Based on enhancing the expression of the SMN gene, therapeutic strategies including gene therapy have been generated. However, currently available treatments face various challenges, including, for example, insufficient expression levels of the SMN gene and off-target toxicity. Therefore, there is a need in the art to improve gene therapy for SMA, optimize SMN expression and reduce off-target toxicity.

[0010] 3. Overview

[0011] In one aspect, the present invention provides a nucleic acid comprising (i) a first nucleic acid region comprising a nucleic acid sequence encoding an SMN protein or a variant thereof; and (ii) a second nucleic acid region comprising one or more target segments of one or more endogenous microRNAs (miRNAs), wherein the second nucleic acid region is located 3' to the first nucleic acid region.

[0012] In some embodiments, the SMN protein or a variant thereof comprises an amino acid sequence as set forth in SEQ ID NO:33, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:33.

[0013] In some embodiments, the first nucleic acid region comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:34 and SEQ ID NO:35.

[0014] In some embodiments, the second nucleic acid region comprises at least one target segment of an endogenous miRNA in the heart. In some embodiments, the endogenous miRNA in the heart is selected from the group consisting of hsa-mir-1-5p, hsa-mir-208a-5p, hsa-mir-208b-5p, hsa-mir-133a-1 and hsa-mir-488-5p. In some embodiments, the endogenous miRNA in the heart comprises a nucleic acid sequence selected from the group consisting of the following items: a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 6.

[0015] In some embodiments, the second nucleic acid region comprises at least one target segment of an endogenous miRNA in the liver. In some embodiments, the endogenous miRNA in the liver is hsa-mir-122. In some embodiments, the endogenous miRNA in the liver comprises a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4.

[0016] In some embodiments, the second nucleic acid region comprises two or more target segments of hsa-mir-133a-1. In some embodiments, the second nucleic acid region comprises at least three target segments of hsa-mir-133a-1. In some embodiments, the second nucleic acid region comprises at least one target segment of hsa-mir-208a-5p, at least one target segment of hsa-mir-208b-5p, at least one target segment of hsa-mir-122, and at least one target segment of hsa-mir-133a-1. In some embodiments, the second nucleic acid region comprises two target segments of hsa-mir-208a-5p, two target segments of hsa-mir-208b-5p, three target segments of hsa-mir-122, and three target segments of hsa-mir-133a-1.

[0017] In some embodiments, the target segment of hsa-mir-1-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7; the target segment of hsa-mir-208a-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:8; the target segment of hsa-mir-208b-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: NO:9 has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical; the target segment of hsa-mir-122 comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10; the target segment of hsa-mir-133a-1 comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1 NO:11 has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical; and / or the target segment of hsa-mir-488-5p contains a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0018] In some embodiments, the second nucleic acid region comprises at least 3 repeats of the nucleic acid sequence as shown in SEQ ID NO: 11. In some embodiments, the second nucleic acid region further comprises at least one or more target segments of endogenous miRNA in the liver.

[0019] In some embodiments, the second nucleic acid region comprises (i) 2 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:8, (ii) 2 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:9, (iii) 3 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:10, and (iv) 3 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:11.

[0020] In some embodiments, the second nucleic acid region further comprises one or more linkers between the target segments. In some embodiments, the linker comprises 1 to 10 nucleotides. In some embodiments, the linker comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0021] In some embodiments, the second nucleic acid region comprises: (i) a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:18; (ii) a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:19; (iii) a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:19; NO:20 has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:21; or (iv) has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:21.

[0022] In some embodiments, the first nucleic acid region further comprises a promoter. In some embodiments, the promoter comprises a nucleic acid sequence as shown in SEQ ID NO:36 or SEQ ID NO:37. In some embodiments, the promoter comprises a CMV enhancer and an hSyn promoter. In some embodiments, the promoter comprises a proC3 enhancer and an hSyn promoter. In some embodiments, the promoter comprises a proA5 enhancer and an hSyn promoter. In other embodiments, the promoter comprises a proB15 enhancer and an hSyn promoter. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:39. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:40. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:41. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:42.

[0023] On the other hand, a vector is provided herein, which comprises the nucleic acid provided herein. In certain embodiments, the vector is a viral vector. In certain embodiments, the viral vector is an adeno-associated virus (AAV) vector. In certain embodiments, the AAV vector is derived from AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, AAV44-9, or a combination or variant thereof. In a specific embodiment, the vector is a recombinant AAV9 (rAAV9) vector or a variant thereof.

[0024] In another aspect, the present invention provides a recombinant AVV (rAAV) vector comprising (i) a first nucleic acid region comprising a transgene; and (ii) a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs, wherein at least one target segment is a target segment of an endogenous miRNA in the heart, and at least one target segment is a target segment of an endogenous miRNA in the liver; wherein the second nucleic acid region is located 3' to the first nucleic acid region; and wherein the rAAV vector comprises an inverted terminal repeat (ITR) derived from AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74 or AAV44-9.

[0025] In some embodiments, the first nucleic acid region comprises a nucleic acid sequence encoding a SMA protein or a variant thereof, wherein the SMA protein or a variant thereof comprises an amino acid sequence as set forth in SEQ ID NO:33 or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:33.

[0026] In some embodiments, the first nucleic acid region comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:34 and SEQ ID NO:35.

[0027] In some embodiments, the endogenous miRNA in the heart is selected from the group consisting of hsa-mir-1-5p, hsa-mir-208a-5p, hsa-mir-208b-5p, hsa-mir-133a-1 and hsa-mir-488-5p; and / or wherein the endogenous miRNA in the liver is hsa-mir-122.

[0028] In some embodiments, (i) the endogenous miRNA in the heart comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:6; and / or (ii) the endogenous miRNA in the liver comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4.

[0029] In some embodiments, the second nucleic acid region comprises two or more target segments of hsa-mir-133a-1. In some embodiments, the second nucleic acid region comprises at least three target segments of hsa-mir-133a-1. In some embodiments, the second nucleic acid region comprises at least one target segment of hsa-mir-208a-5p, at least one target segment of hsa-mir-208b-5p, at least one target segment of hsa-mir-122, and at least one target segment of hsa-mir-133a-1. In some embodiments, the second nucleic acid region comprises two target segments of hsa-mir-208a-5p, two target segments of hsa-mir-208b-5p, three target segments of hsa-mir-122, and three target segments of hsa-mir-133a-1.

[0030] In some embodiments, (i) the target segment of hsa-mir-1-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7; (ii) the target segment of hsa-mir-208a-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7 NO:8 has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical; (iii) the target segment of hsa-mir-208b-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9; (iv) the target segment of hsa-mir-122 comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9 NO:10 has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical; (v) the target segment of hsa-mir-133a-1 comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11; and / or (vi) the target segment of hsa-mir-488-5p comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: NO:12 has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical nucleic acid sequence.

[0031] In some embodiments, the second nucleic acid region comprises at least 3 repeats of the nucleic acid sequence shown in SEQ ID NO:11.

[0032] In some embodiments, the second nucleic acid region further comprises: (i) 2 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:8, (ii) 2 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:9, (iii) 3 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:10, and (iv) 3 repeats of a target segment having a nucleic acid sequence as shown in SEQ ID NO:11.

[0033] In some embodiments, the second nucleic acid region further comprises one or more linkers between target segments; and wherein optionally, the linkers comprise 1 to 1500 nucleotides, 1 to 500 nucleotides, 1 to 100 nucleotides, 1 to 50 nucleotides, or 1 to 10 nucleotides.

[0034] In some embodiments, the linker comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17.

[0035] In some embodiments, the second nucleic acid region further comprises: (i) a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18; (ii) a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19; (iii) a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19; NO:20 has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:21; or (ii) has a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:21.

[0036] In some embodiments, the first nucleic acid region further comprises a promoter. In some embodiments, the promoter comprises a nucleic acid sequence as shown in SEQ ID NO:36 or SEQ ID NO:37. In some embodiments, the promoter comprises a CMV enhancer and an hSyn promoter. In some embodiments, the promoter comprises a proC3 enhancer and an hSyn promoter. In some embodiments, the promoter comprises a proA5 enhancer and an hSyn promoter. In other embodiments, the promoter comprises a proB15 enhancer and an hSyn promoter. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:39. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:40. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:41. In some embodiments, the promoter comprises a region of SEQ ID NO:38 and a region of SEQ ID NO:42.

[0037] In some embodiments, the rAAV vectors provided herein include ITRs derived from AAV9.

[0038] On the other hand, the present invention provides a nucleic acid comprising a nucleic acid region comprising a nucleic acid sequence encoding an SMN protein or a variant thereof and a synthetic promoter, wherein the synthetic promoter comprises an enhancer and a core promoter, wherein optionally, (i) the synthetic promoter comprises a CMV enhancer and an hSyn promoter; (ii) the synthetic promoter comprises a proC3 enhancer and an hSyn promoter; (iii) the synthetic promoter comprises a proA5 enhancer and an hSyn promoter; or (iv) the synthetic promoter comprises a proB15 enhancer and an hSyn promoter.

[0039] In some embodiments, the hSyn promoter comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38.

[0040] In some embodiments, the CMV enhancer comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:39.

[0041] In some embodiments, the proC3 enhancer comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:40.

[0042] In some embodiments, the proA5 enhancer comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:41.

[0043] In some embodiments, the proB15 enhancer comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:42.

[0044] In some embodiments, the SMN protein or a variant thereof comprises an amino acid sequence as set forth in SEQ ID NO:33, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:33.

[0045] In some embodiments, the nucleic acid sequence encoding the SMN protein or a variant thereof comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:34 and SEQ ID NO:35.

[0046] On the other hand, provided herein is a rAAV vector comprising a nucleic acid sequence as shown in SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53, or a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53.

[0047] On the other hand, the present invention provides an rAAV vector comprising a nucleic acid sequence as shown in SEQ ID NO:22 or SEQ ID NO:23, SEQ ID NO:24 or SEQ ID NO:25, or a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24 or SEQ ID NO:25.

[0048] In yet another aspect, a recombinant AAV (rAAV) particle is provided herein, comprising (a) a nucleic acid or rAAV vector provided herein; and (b) a capsid protein of AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, AAV44-9, or a variant thereof. In some embodiments, the capsid protein is an AAV9 capsid protein or a variant thereof.

[0049] In yet another aspect, provided herein is a pharmaceutical composition comprising a nucleic acid, a vector or an rAAV vector, or an rAAV particle provided herein, and a pharmaceutically acceptable excipient.

[0050] In yet another aspect, provided herein is a method for enhancing expression of SMN protein in a cell, the method comprising contacting the cell with a nucleic acid, a vector or a rAAV vector, or a rAAV particle, or a pharmaceutical composition provided herein.

[0051] On the other hand, there is provided herein a method for treating a disease or condition in a subject, the method comprising administering to the subject a nucleic acid, a vector or a rAAV vector, a rAAV particle, or a pharmaceutical composition provided herein. In some embodiments, the disease or condition is an SMN-related disease or condition. In some embodiments, an SMN-related disease or condition is a disease or condition associated with insufficient expression of the SMN protein. In some embodiments, wherein the disease or condition is associated with a defective SMN protein. In other embodiments, the disease or condition is associated with smn1 gene deletion and / or mutation. In some embodiments, the disease or condition is spinal muscular atrophy (SMA). In some embodiments, the disease or condition is SMA-I, SMA-II, SMA-III or SMA-IV. In some embodiments, the subject is under 2 years old. 4. Description of the drawings

[0053] Figure 1A The designs of exemplary rAAV vectors provided herein are described. Figure 1B Exemplary nucleic acid regions of nucleic acid constructs or rAAV vectors of the present disclosure comprising multiple target segments are described.

[0054] Figure 2A The SMN protein expression levels of the various rAAV vectors provided herein are illustrated. Figure 2B Shown are the results of transcriptome analysis of the codon-optimized constructs provided herein.

[0055] Figure 3 Survival results from in vivo efficacy testing of the rAAV particles of the present disclosure are presented.

[0056] Figure 4 The open field activity results of in vivo efficacy testing of the rAAV particles of the present disclosure are presented.

[0057] Figure 5 Body weight results from in vivo efficacy testing of the rAAV particles of the present disclosure are illustrated.

[0058] Figure 6 Comparison of survival outcomes between rAAVs containing different miRNA target segments is illustrated.

[0059] Fig. 7A and 7B Exemplary constructs provided herein comprising synthetic promoters are described.

[0060] Fig. 8A Shown are the results of in vivo efficacy experiments comparing constructs comprising the synthetic promoters provided herein to constructs comprising other promoters.

[0061] Figure 8B The in vivo efficacy of lower doses of constructs with various synthetic promoters and different enhancers is shown.

[0062] 5. Detailed description

[0063] The present disclosure is based in part on novel nucleic acid constructs (eg, nucleic acid constructs encoding SMN proteins and comprising target sequences of tissue-specific microRNAs), AAV vectors comprising the novel nucleic acid constructs, and improved properties thereof.

[0064] 5.1. Definitions

[0065] The techniques and procedures described or referenced herein include those conventional methods that are generally understood and / or commonly used by those skilled in the art, for example, the widely used methods described in the following references: Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molecular Biology (Ausubel et al., 2003); Therapeutic Monoclonal Antibodies: From Bench to Clinic (An, 2009); Monoclonal Antibodies: Methods and Protocols [Monoclonal Antibodies: Methods and Laboratory Guide] (Albitar, ed., 2010); and Antibody Engineering, Volumes 1 and 2 (Kontermann and Dübel, ed., 2nd ed., 2010).

[0066] Unless otherwise defined herein, technical and scientific terms used in this specification have the meanings commonly understood by those of ordinary skill in the art. For the purpose of interpreting this specification, the following description of terms shall apply, and where appropriate, terms used in the singular shall also include the plural, and vice versa. If any description of the listed terms conflicts with any document incorporated herein by reference, the description of the terms listed below shall prevail.

[0067] The terms "polypeptide" and "peptide" and "protein" are used interchangeably herein and refer to polymers of amino acids of any length. The polymer may be linear or branched, it may include modified amino acids, and may be interrupted by non-amino acids. These terms also include amino acid polymers modified by nature or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification. Also included in the definition are, for example, polypeptides containing one or more analogs of an amino acid, including but not limited to non-natural amino acids, as well as other modifications known in the art.

[0068] "Polynucleotide" or "nucleic acid", used interchangeably herein, refers to a polymer of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or analogs thereof, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may include modified nucleotides, such as methylated nucleotides and their analogs. "Oligonucleotide" as used herein refers to a short, usually single-stranded, synthetic polynucleotide, which is usually but not necessarily less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" do not exclude each other. The above description of polynucleotides is also fully applicable to oligonucleotides. The cells producing binding molecules disclosed herein may include parent hybridoma cells, as well as bacterial and eukaryotic host cells into which nucleic acids encoding polypeptides have been introduced. Unless otherwise specified, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of addition from 5' to 3' of the nascent RNA transcript is called the transcription direction; the sequence region on the DNA chain that has the same sequence as the RNA transcript and is 5' to the 5' end of the RNA transcript is called the "upstream sequence"; the sequence region on the DNA chain that has the same sequence as the RNA transcript and is 3' to the 3' end of the RNA transcript is called the "downstream sequence".

[0069] As used herein, "nucleobase" refers to a heterocyclic moiety capable of base pairing with another nucleic acid.

[0070] As used herein, "nucleotide" refers to a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0071] As used herein, "nucleoside" refers to a nucleobase linked to a sugar.

[0072] The asymmetric ends of DNA and RNA chains are called the 5' end (5' terminus) and the 3' end (3' terminus), with the 5' end having a terminal phosphate group and the 3' end having a terminal hydroxyl group. The 5' end has the fifth carbon from the sugar ring of a deoxyribose or ribose at its terminus. Nucleic acids are synthesized in vivo in a 5' to 3' direction because the polymerase used to assemble the new chain attaches each new nucleotide to the 3'-hydroxyl (-OH) group via a phosphodiester bond.

[0073] "Isolated nucleic acid" refers to nucleic acid (e.g., RNA, DNA) or mixed nucleic acid that is generally separated from genomic DNA sequences and proteins or complexes (e.g., ribosomes and polymerases) of natural sequences that are generally present simultaneously with other natural sequences. "Isolated" nucleic acid molecules refer to nucleic acid molecules that are separated from nucleic acid molecules that are present in other natural sources of nucleic acid molecules. In addition, "isolated" nucleic acid molecules, such as cDNA molecules, can be substantially free of other cell materials or culture media when produced by recombinant technology, or substantially free of chemical precursors or other chemical substances when chemically synthesized. The term includes nucleic acid sequences removed from the environment of its natural occurrence, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs synthesized by heterologous systems. Substantially pure molecules can include isolated forms of molecules. Specifically, "isolated" nucleic acid molecules encoding polypeptides described herein refer to nucleic acid molecules that are identified and separated from nucleic acid molecules of at least one contamination that is generally associated in the environment produced.

[0074] As used herein, the term "homology" refers to the percent identity between two polynucleotides or two polypeptide portions. Two DNA or two polypeptide sequences are "substantially homologous" to each other when they exhibit at least about 50%, at least about 75%, at least about 80% to 85%, at least about 90%, at least about 95% to 98%, at least about 99%, or any percentage of sequence identity over a specified length of the molecule. As used herein, substantially homologous also refers to sequences that show complete identity to a particular DNA or polypeptide sequence.

[0075] As used herein, the term "identity" refers to the precise correspondence of the nucleotides of two polynucleotides to the nucleotides, or the precise correspondence of the amino acids of two peptide sequences to the amino acids. The method for determining the percentage identity is well known in the art. For example, the percentage identity can be determined by directly comparing the sequence information between two molecules, by aligning the sequences, calculating the exact number of matches between the two aligned sequences, divided by the length of the shorter sequence, and then multiplying the result by 100. Existing computer programs can be used to help analyze, such as ALIGN, Dayhoff, MO in Atlas of Protein Sequence and Structure MODayhoff ed. [protein sequence and structural atlas MODayhoff ed.], Volume 5 Appendix 3: 353-358, National Biomedical Research Foundation, Washington, DC [National Biomedical Research Foundation, Washington, DC], it uses the local homology algorithm of Smith and Waterman (see Advances in Appl.Math. [applied mathematics research progress] 2: 482-489, 1981) for peptide analysis. Programs for determining nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package (Version 8) (available from GCG (Genetics Computer Group, Madison, Wis.), such as BESTFIT, FASTA, and GAP programs that also rely on the Smith and Waterman algorithm. These programs are easy to use and use the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package mentioned above. For example, the homology algorithm of Smith and Waterman can be used to determine the percent identity of a particular nucleotide sequence to a reference sequence using a default score table and gap penalties for 6 nucleotide positions. In the context of the present invention, another method for determining percent identity is to use the MPSRCH program package, which is copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics (Mountain View, Calif.). From this software package, the Smith-Waterman algorithm can be used, wherein the scoring table uses default parameters (e.g., gap opening penalty of 12, gap extension penalty of 1, gap size of 6). From the generated data, the "match" value reflects the "sequence identity".Other suitable programs for calculating percent identity or similarity between sequences are generally known in the art, for example, another sequence alignment program is BLAST, which is used with default parameters. For example, BLASTN and BLASTP can use the following default parameters: genetic code = standard; filter = none; strand = double strand; cutoff = 60; expectation = 10; matrix = BLOSUM62; description = 50 sequences; sort by = high score; database = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. The details of these programs are well known in the art. Alternatively, homology can be determined by hybridizing polynucleotides under conditions that form stable double strands between homologous regions, followed by digestion with a single-stranded specific nuclease, and sizing the digested fragments. Substantially homologous DNA sequences can be determined in a Southern hybridization experiment, for example, under stringent conditions specified for the particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.

[0076] The term "vector" as used herein refers to a substance used to carry or include a nucleic acid sequence, for example, in order to introduce a nucleic acid sequence into a host cell. Applicable vectors include, for example, expression vectors, plasmids, phage vectors, viral vectors, exons and artificial chromosomes, which may include operable selection sequences or markers for stable integration into the chromosome of a host cell. In addition, the vector may include one or more selectable marker genes and suitable expression control sequences. The selectable marker genes that may be included, for example, provide resistance to antibiotics or toxins, supplement nutritional deficiencies, or provide key nutrients not available in the culture medium. The expression control sequence may include constitutive and inducible promoters, transcription enhancers, transcription terminators, etc., which are well known in the art. When two or more nucleic acid molecules are to be expressed together, the two nucleic acid molecules may, for example, be inserted into an expression vector or a separate expression vector. Methods well known in the art may be used to confirm that the nucleic acid molecule is introduced into a host cell. These methods include, for example, nucleic acid analysis, such as Northern blot or polymerase chain reaction (PCR) amplification of mRNA, immunoblotting of gene product expression, or other suitable analytical methods to detect the expression of the introduced nucleic acid sequence or its corresponding gene product. The term "vector" includes cloning and expression vectors, as well as viral vectors. In certain embodiments, the vector provided herein is a recombinant AAV vector.

[0077] The term "recombinant AAV vector (rAAV vector)" as used herein refers to a polynucleotide vector comprising a nucleic acid sequence derived from AAV and one or more heterologous sequences (i.e., a nucleic acid sequence derived from non-AAV). In some embodiments, one or more heterologous sequences are flanked by at least one, and in some embodiments, two AAV terminal inverted repeat (ITR) sequences. In some embodiments, such rAAV vectors can be replicated and packaged into infectious viral capsid particles, for example, when present in a host cell that has been infected with a suitable helper virus (or is expressing a suitable helper function) and is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). The rAAV vector can be integrated into a larger polynucleotide (e.g., in a chromosome or in another vector, such as a plasmid for cloning or transfection), and can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. The rAAV vector can be any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes, complexes with lipids, encapsulated in liposomes, and encapsulated in viral capsid particles, particularly AAV particles. rAAV vectors can be packaged into AAV capsids to produce "recombinant adeno-associated virus capsid particles (rAAV particles)".

[0078] The term "heterologous" used herein, in connection with nucleic acid sequences such as coding sequences and control sequences, refers to sequences that are not usually linked together, and / or sequences that are not usually associated with a particular cell. Therefore, a "heterologous" region of a nucleic acid construct or vector refers to a nucleic acid fragment within or attached to another nucleic acid molecule that is not found associated with other molecules in nature. For example, the heterologous region of a nucleic acid construct can include a coding sequence flanked by sequences that are not found associated with the coding sequence in nature. Another example of a heterologous coding sequence is a construct in which the coding sequence itself does not exist in nature (e.g., a synthetic sequence with codons that are different from natural genes).

[0079] As used herein, the term "flanking" refers to a sequence that is flanked by other elements, indicating that there are one or more flanking elements upstream and / or downstream (i.e., 5' and / or 3') relative to the sequence. The term "flanking" does not mean that these sequences are necessarily adjacent. For example, there may be intervening sequences between the nucleic acid encoding the transgene and the flanking elements. A sequence (such as a transgene) "flanked" by two other elements (such as TR) indicates that one element is located at 5' of the sequence and the other element is located at 3' of the sequence; however, there may be intervening sequences between the two.

[0080] The term "inverted terminal repeat" or "ITR" sequence as used herein refers to a relatively short sequence that exists in the opposite direction of the ends of the viral genome. The "AAV inverted terminal repeat (ITR)" sequence is well known in the art and is generally a sequence of about 145 nucleotides that exists at both ends of the natural single-stranded AAV genome. The 125 nucleotides at the farthest ends of the ITR can exist in one of two alternative directions, which leads to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The 125 nucleotides at the farthest ends also contain some shorter self-complementary regions (named A, A', B, B', C, C' and D regions) so that intrachain base pairing can occur in this portion of the ITR.

[0081] A "coding sequence" or a sequence "encoding" a selected polypeptide is a nucleic acid molecule that is transcribed (if DNA) and translated (if mRNA) into a polypeptide under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A transcription termination sequence may be located 3' to the coding sequence.

[0082] The term "control sequence" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. For example, control sequences suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. It is known that eukaryotic cells use promoters, polyadenylation signals, and enhancers.

[0083] As used herein, the term "operably linked" and similar phrases (e.g., gene fusion), when used in relation to nucleic acids or amino acids, refers to an operational connection in which nucleic acid sequences or amino acid sequences are placed in a functional relationship with each other. For example, operably linked promoters, enhancer elements, open reading frames, 5' and 3' UTRs, and terminator sequences result in the accurate production of nucleic acid molecules (e.g., RNA). In some embodiments, the operably linked nucleic acid elements result in the transcription of the open reading frame, thereby ultimately producing a polypeptide (i.e., expression of the open reading frame). As another example, an operably linked polypeptide is one in which the functional domains are at an appropriate distance from each other to convey the intended function of each domain.

[0084] The term "promoter" as used herein refers in a general sense to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene that can bind to RNA polymerase and initiate transcription of a downstream (3' direction) coding sequence. Transcription promoters may include "inducible promoters" (wherein the expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), "repressible promoters" (wherein the expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and "constitutive promoters".

[0085] The term "transgene" as used herein refers in a broad sense to any heterologous nucleotide sequence incorporated into a viral vector, for example, for expression in a target segment of cells, which may be associated with an expression control sequence, such as a promoter. It will be appreciated by those skilled in the art that the expression control sequence will be selected based on the ability to promote expression of the transgene in the target segment of cells. Examples of transgenes are nucleic acids encoding therapeutic polypeptides or detectable markers.

[0086] As used herein, the term "AAV capsid" or "AAV capsid protein" or "AAV cap" refers to a protein encoded by an AAV capsid gene (cap) (e.g., VP1, VP2, and VP3) or a variant thereof. For example, the term includes, but is not limited to, a capsid protein derived from any AAV serotype, such as AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV-2 / 1, AAV 2 / 6, AAV 2 / 7, AAV 2 / 8, AAV 2 / 9, AAV LK03, AAVrh10, AAVrh74, AAV44-9, or a variant thereof. The term also includes capsid proteins expressed by or derived from a recombinant AAV (eg, a chimeric AAV).

[0087] The terms "AAV capsid particle" or "AAV particle" as used herein include at least one AAV capsid protein (e.g., VP1 protein, VP2 protein, VP3 protein or variants thereof), and optionally encapsulate a nucleic acid from or derived from the AAV genome.

[0088] The term "serotype" with respect to a vector or viral capsid is defined by different immunological characteristics based on the capsid protein sequence and capsid structure.

[0089] As used herein, the term "chimeric" refers to viral capsids or particles that include sequences from different parvoviruses, preferably different AAV serotypes, as described in U.S. Patent Application No. 6,491,907 to Rabinowitz et al., which is incorporated herein by reference in its entirety.

[0090] The term "recombinant" refers to a genetic entity other than that normally found in nature. When applied to a polynucleotide or gene, this means that the polynucleotide is the product of various combinations of cloning, restriction and / or ligation steps and other procedures that result in the production of a construct other than a polynucleotide found in nature.

[0091] As used herein, the term "recombinant virus" refers to a virus that has been genetically modified, for example, by the addition or insertion of a heterologous nucleic acid construct into the particle. For example, as used herein, the term "recombinant AAV particle" or "rAAV" refers to an AAV that has been genetically modified, for example, by the deletion or other mutation of an endogenous AAV gene and / or the addition or insertion of a heterologous nucleic acid construct into the polynucleotide of the AAV particle.

[0092] As used herein, "off-target activity" refers to any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, off-target activity refers to a decrease in the amount or expression of a target nucleic acid or a protein product encoded by such a target nucleic acid.

[0093] As used herein, "endogenous miRNA" refers to a known or unknown microRNA expressed by any mammalian cell that is capable of hybridizing with a target nucleic acid segment through hydrogen bonds or protein / RNA complexes (e.g., after a processing step). Non-limiting examples of endogenous miRNAs include single-stranded and double-stranded DNA or RNA, or nucleic acid compounds such as antisense oligonucleotides, siRNA, shRNA, ssRNA, miRNA, lncRNA, and occupancy-based compounds.

[0094] As used herein, "off-target inhibition" refers to a decrease in the level of a target nucleic acid in the presence of an endogenous miRNA that is complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the endogenous miRNA.

[0095] As used herein, "antisense oligonucleotide" refers to a single-stranded oligonucleotide with a nucleobase sequence that can hybridize with a corresponding segment of a target nucleic acid. According to some embodiments, the antisense oligonucleotide of the present disclosure includes at least 80%, at least about 85%, at least about 90%, at least about 95% sequence complementarity with a target region within a target nucleic acid. For example, an endogenous miRNA, in which 18 of the 20 nucleobases of the antisense oligonucleotide are complementary, will specifically hybridize with the target region, representing 90% complementarity. The percentage complementarity of an endogenous miRNA to a target nucleic acid region can be routinely determined using a basic local alignment search tool (BLAST program) (see Altschul et al., J. Mol. Biol. [Molecular Biology], 215, 403-410 (1990); Zhang and Madden, Genome Res. [Genome Research], 7, 649-656 (1997)). In some embodiments, antisense oligonucleotides include endogenous miRNAs and other miRNAs that hybridize to SMN1 mRNA expressed by rAAV vectors, and representative sequences of these endogenous miRNAs are described herein.

[0096] As used herein, "wild-type SMN1 transcripts" refer to transcripts produced from AAV vectors containing wild-type SMN1 mRNA with or without a tissue-specific miRNA target segment array. Thus, wild-type SMN1 transcripts with or without a tissue-specific miRNA target segment array are distinguished from canonically transcribed mammalian cell "SMN1 sense transcripts", which are produced from the coding strand (also referred to as the sense strand) of the host cell smn1 gene.

[0097] As used herein, "specifically hybridizable" means that the antisense compound has a sufficient degree of complementarity between the antisense oligonucleotide and the target nucleic acid to induce the desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions where specific binding is desired, i.e., under physiological conditions for in vivo testing and treatment.

[0098] As used herein, "stringent hybridization conditions" or "stringent conditions" refers to conditions under which an oligomeric compound will hybridize to its target sequence, but will hybridize to a minimal number of other sequences.

[0099] As used herein, "target segment" refers to the nucleotide sequence of the target nucleic acid to which the antisense compound (e.g., miRNA) is directed. "5' target segment site" refers to the nucleotide at the 5' end of the target segment. "3' target segment site" refers to the nucleotide at the 3' end of the target segment. The target segment of miRNA refers to the nucleic acid sequence whose mRNA transcript can be specifically hybridized by miRNA.

[0100] As used herein, the term "transfection" or "transformation" or "transduction" refers to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell refers to a cell that has been transfected, transformed, or transduced with exogenous nucleic acid. For example, the term "transfection" refers to the uptake of foreign DNA by a cell, and a cell is "transfected" when foreign DNA is introduced into the cell membrane. Many transfection techniques are well known in the art. For example, see Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. These techniques can be used to introduce one or more exogenous molecules into a suitable host cell. "Transduction" of a cell by a virus refers to the transfer of nucleic acid (such as DNA or RNA) from a viral particle into a cell.

[0101] The term "host cell" as used herein refers to a specific cell that can be transfected with a nucleic acid molecule, as well as the progeny or potential progeny of such a cell. The host cell can be a bacterial cell, a yeast cell, an insect cell or a mammalian cell.

[0102] The term "purification" refers to the separation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance of interest is the majority percentage of the sample in which it is present. Typically, in a sample, the substantially purified component comprises 50%, 80% to 85%, 90% to 99%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well known in the art and include, for example, ion exchange chromatography, affinity chromatography, and density-based sedimentation.

[0103] As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia, European Pharmacopeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.

[0104] In one embodiment, each ingredient is "pharmaceutically acceptable" in the sense that it is compatible with the other ingredients of the pharmaceutical formulation and suitable for use in contact with the tissues or organs of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications commensurate with a reasonable benefit / risk ratio. See, for example, Lippincott Williams & Wilkins: Philadelphia, PA, 2005; Handbook of Pharmaceutical Excipients, 6th ed.; Rowe et al., eds.; The Pharmaceutical Press and the American Pharmaceutical Association: 2009; Handbook of Pharmaceutical Additives, 3rd ed.; Ash and Ash, eds.; Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, 2nd ed.; Gibson, ed.; CRC Press LLC. Boca Raton, FL, 2009. In some embodiments, the pharmaceutically acceptable excipient is non-toxic to the cell or mammal to which it is exposed at the dosages and concentrations employed. In some embodiments, the pharmaceutically acceptable excipient is a pH buffered aqueous solution.

[0105] As used herein, the terms "treat, treatment and treating" refer to reducing or ameliorating the progression, severity and / or duration of a disease or condition by administering one or more therapies. Treatment can be determined by assessing whether one or more symptoms associated with the underlying disease are reduced, alleviated and / or alleviated, such that improvement is observed in the patient, although the patient may still be suffering from the underlying disease. The term "treat" includes both control and amelioration of a disease. The terms "manage, manage and manage" refer to the beneficial effects that a subject obtains from treatment, but does not necessarily result in a cure of the disease. "Treatment or treating" includes: (1) preventing a disease, i.e., preventing the development of a disease or causing the disease to occur at a lesser intensity in a subject who may be exposed to the disease or who is susceptible to the disease but who does not yet manifest or show symptoms of the disease, (2) inhibiting a disease, i.e., arresting development, hindering or slowing progression, or reversing the disease state, (3) alleviating the symptoms of a disease, i.e., reducing the number of symptoms manifested by a subject, and (4) reducing, preventing or delaying the development of a disease or its symptoms. The terms "prevent," "preventing," and "prevention" refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or related symptoms.

[0106] As used herein, "administer, administration or administering" refers to the act of injecting or otherwise physically delivering a substance (e.g., a conjugate or pharmaceutical composition provided herein) to a subject or patient (e.g., a human), such as by oral, mucosal, topical, intradermal, parenteral, intravenous, intravenous, intravitreal, intraarticular, subretinal, intramuscular, intrathecal delivery and / or any other physical delivery method described herein or known in the art. In a specific embodiment, administration is by intravenous infusion. The conjugate or composition provided herein can be delivered systemically or to a specific tissue.

[0107] As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount of a therapeutic agent (e.g., a conjugate or pharmaceutical composition provided herein) sufficient to treat, diagnose, prevent, delay the onset of, reduce and / or improve the severity and / or duration of a given condition, disorder or disease and / or symptoms associated therewith. These terms also include the amount required to reduce, slow or improve the development or progression of a given disease, reduce, slow or improve the recurrence, development or onset of a given disease, and / or improve or enhance the preventive or therapeutic effect of another therapy or serve as a bridge to another therapy. In some embodiments, "effective amount" as used herein also refers to the amount of a conjugate described herein to achieve a specified result. As used herein, the terms "subject" and "patient" are used interchangeably.

[0108] As used herein, a subject is a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, goats, rabbits, rats, mice, etc.) or a primate (e.g., monkeys and humans), such as a human. In certain embodiments, the subject is a mammal, such as a human, diagnosed with a disease or condition as provided herein. In another embodiment, the subject is a mammal, such as a human, at risk of developing a disease or condition as provided herein. In a specific embodiment, the subject is a human.

[0109] As used herein, the term "therapies and therapy" may refer to any regimen, method, composition, formulation, and / or agent that can be used to prevent, treat, control, or improve a disease or condition or a symptom thereof (e.g., a disease or condition provided herein or one or more symptoms or conditions associated therewith). In certain embodiments, the term "therapy" refers to drug therapy, adjuvant therapy, radiotherapy, surgery, biological therapy, supportive therapy, and / or other therapies that help treat, control, prevent, or improve a disease or condition or one or more symptoms thereof. In certain embodiments, the term "therapy" refers to a therapy other than a conjugate described herein or a pharmaceutical composition thereof.

[0110] As used herein, the term "SMN-related disease or condition" refers to a disease or condition involving SMN (including abnormal expression levels of SMN protein), for example, as a symptom or direct or indirect cause. Diseases or conditions associated with SMN include, but are not limited to, diseases or conditions associated with reduced expression of the smn1 gene or with a mutated smn1 gene.

[0111] The terms "about" and "approximately" mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1% or less of a given value or range.

[0112] As used in the disclosure and claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0113] It is understood that any embodiment described herein using the term "comprising" also provides similar embodiments described using the phrases "consisting of" and / or "consisting essentially of." It is also understood that any embodiment described herein using the phrase "consisting essentially of" also provides similar embodiments described using the phrase "consisting of."

[0114] The term “between” used in phrases such as “between A and B” or “between AB” means a range including A and B.

[0115] The term "and / or" as used in phrases such as "A and / or B" is intended to include A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0116] 5.2. Nucleic acid constructs

[0117] In one aspect, provided herein is a novel nucleic acid comprising a first nucleic acid region encoding a protein of interest and a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs (also referred to as target segment sequences of miRNAs).

[0118] In some embodiments, the first nucleic acid region encodes a therapeutic molecule (e.g., SMN protein). In some embodiments, the second nucleic acid region comprising one or more target segments is located 3' to the first nucleic acid region encoding the protein of interest. In some embodiments, the second nucleic acid region comprising one or more target segments is immediately adjacent to or connected without a gap to the 3' of the first nucleic acid region encoding the protein of interest. In other embodiments, the second nucleic acid region comprising one or more target segments is spaced one or more nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides) 3' from the first nucleic acid region encoding the protein of interest.

[0119] 5.2.1. Nucleic acid encoding the target protein or its variant

[0120] In some embodiments, the nucleic acid constructs provided herein comprise a nucleic acid sequence encoding an SMN protein or a variant thereof.

[0121] In some embodiments, the nucleic acid construct provided herein comprises a nucleic acid sequence encoding an SMN protein having an amino acid sequence as shown in SEQ ID NO: 33. In some embodiments, the nucleic acid sequence encoding the SMN protein is selected from the group consisting of SEQ ID NO: 34 and SEQ ID NO: 35.

[0122] In some embodiments, the nucleic acids provided herein comprise a percentage of identity to the nucleic acid sequences shown as SEQ ID NO: 34 and SEQ ID NO: 35. In some embodiments, the nucleic acids encoding the proteins of interest provided herein comprise a nucleic acid sequence having at least about 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 34. In some embodiments, the nucleic acids encoding the proteins of interest provided herein comprise a nucleic acid sequence having at least about 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 35.

[0123] The determination of percent identity between two sequences (e.g., amino acid sequences or nucleic acid sequences) can be accomplished by a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul (see Proc. Natl. Acad. Sci. USA 87:2264 2268 (1990)), as modified in Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873 5877 (1993). This algorithm is embedded in the NBLAST and XBLAST programs of Altschul et al. (see J. Mol. Biol. 215:403 (1990)). BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameter settings, for example, score=100, wordlength=12, to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. BLAST protein searches can be performed using the XBLAST program parameter settings, e.g., set to score 50, word length = 3, to obtain amino acid sequences homologous to the protein molecules described herein. To obtain gapped alignments for comparison, Gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. [Nucleic Acids Research] 25:3389 3402 (1997). Alternatively, PSI BLAST can be used to perform an iterative search to detect long-range relationships between molecules (ibid). When using BLAST, Gapped BLAST, and PSI Blast programs, the default parameters of each program (e.g., XBLAST and NBLAST) can be used (e.g., see the National Center for Biotechnology Information (NCBI) on the World Wide Web, ncbi.nlm.nih.gov). Another non-limiting example of a mathematical algorithm for comparing sequences is the algorithm of Myers and Miller (CABIOS [Computer Applications in Biological Sciences] 4:11-17 (1998)). This algorithm is embedded in the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0124] The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0125] According to some embodiments, the sequences described herein may further include one or more modifications to the sugar group, the internucleoside linkage, or the nucleobase.

[0126] According to certain embodiments, the nucleic acid is a human nucleic acid (ie, a nucleic acid derived from the human smn1 gene). In other embodiments, the nucleic acid is a non-human nucleic acid (ie, a nucleic acid derived from a non-human smn1 gene).

[0127] According to some embodiments, the nucleic acids provided herein include one or more insertions, deletions, inversions and / or substitutions. According to some embodiments, the nucleic acid constructs provided herein include a codon-optimized nucleic acid region. According to one embodiment, the nucleic acid encoding smn1 is codon-optimized. According to one embodiment, the nucleic acid encoding smn1 is codon-optimized for expression in eukaryotic organisms (e.g., humans). According to some embodiments, the coding sequence encoding smn1 is codon-optimized for expression in specific cells, such as eukaryotic cells. Eukaryotic cells can be those specific organisms, such as mammals, including but not limited to humans, or non-human eukaryotic cells or animals or mammals discussed herein, such as cells of mice, rats, rabbits, dogs, poultry, or non-human mammals or primates, or cells derived from these specific organisms. In general, codon optimization refers to the process of changing a nucleic acid sequence to enhance expression in a target host cell by replacing at least one codon (such as about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of a native sequence with a codon that is more frequently or most frequently used in the genes of a host cell, while maintaining the native amino acid sequence. Various species show special biases to certain codons of specific amino acids. Codon bias (differences in codon usage between organisms) is generally related to the translation efficiency of messenger RNA (mRNA), and conversely, among other things, the translation efficiency of messenger RNA is considered to also depend on the characteristics of the codons translated and the availability of specific transfer RNA (tRNA) molecules. The advantage of the selected tRNA in a cell generally reflects the most frequently used codons in peptide synthesis. Therefore, according to codon optimization, a gene can be customized to optimal gene expression in a specific organism. Codon usage tables are readily available, for example, at www.kazusa.orjp / codon / "Codon Usage Database", and these tables can be modified in a variety of ways. See Nakamura, Y. et al., Nucl. Acids Res. 28:292 (2000). There are also computer algorithms such as Gene Forge (Aptagen; Jacobs, Philadelphia) that can be used to codon-optimize a particular sequence for expression in a particular host cell.

[0128] Nucleic acid molecules of the present disclosure (e.g., including smn1 nucleic acids) can be isolated using standard molecular biology techniques. Nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, EF, and Maniatis, T. Molecular Cloning. A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) using all or part of the nucleic acid sequence of interest as a hybridization probe.

[0129] The nucleic acid molecules used in the disclosed method can also be separated by polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based on the target nucleic acid molecule sequence. According to standard PCR amplification techniques, the nucleic acid molecules used in the disclosed method can be amplified using cDNA, mRNA or alternatively genomic DNA as template and suitable oligonucleotide primers.

[0130] In addition, oligonucleotides corresponding to the target nucleotide sequence can also be chemically synthesized using standard techniques. Many methods for chemically synthesizing polydeoxynucleotides are known, including solid phase synthesis that has been automated in commercially available DNA synthesizers (e.g., see Itakura et al. U.S. Pat. No. 4,598,049; Caruthers et al. U.S. Pat. No. 4,458,066; and Itakura U.S. Pat. Nos. 4,401,796 and 4,373,071, which are incorporated herein by reference). Methods for automating the design of synthetic oligonucleotides are available. For example, see Hoover, DM and Lubowski, J. Nucleic Acids Research, 30 (10): e43 (2002).

[0131] In other embodiments, the nucleic acid constructs provided herein comprise a nucleic acid sequence encoding an SMN protein variant. In some embodiments, the SMN protein variant comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 33.

[0132] It is contemplated that variants of the proteins described herein may be prepared. For example, polypeptide variants may be prepared by introducing appropriate nucleotide changes in the encoding DNA, and / or by synthesizing the desired polypeptide. It will be appreciated by those skilled in the art that amino acid changes may alter the post-translational processes of the polypeptide.

[0133] The change may be a substitution, deletion or insertion of one or more codons encoding the polypeptide resulting in a change in the amino acid sequence compared to the original polypeptide.

[0134] Amino acid substitution can be the result of replacing an amino acid with another amino acid having similar structure and / or chemical properties, such as replacing leucine with serine, for example, conservative amino acid substitution. Standard techniques known to those skilled in the art can be used to introduce mutations into the nucleotides encoding the molecules provided herein, for example, including site-directed mutagenesis and PCR-mediated mutagenesis that cause amino acid substitutions. Alternatively, insertion or deletion can be within the range of about 1 to 5 amino acids. In certain embodiments, relative to the original molecule, substitution, deletion or insertion includes less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions or less than 2 amino acid substitutions. In a specific embodiment, substitution is a conservative amino acid substitution carried out on one or more predicted non-essential amino acid residues. The variation allowed can be determined by systematically carrying out amino acid insertion, deletion or substitution in the sequence, and the resulting variant is tested for activity shown by the parental peptide.

[0135] Insertions of the amino acid sequence include amino acid and / or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing multiple residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include polypeptides with an N-terminal methionyl residue.

[0136] Proteins produced by conservative amino acid substitutions are also included in the present disclosure. In conservative amino acid substitutions, amino acid residues are replaced by amino acid residues with side chains of similar charge. As mentioned above, families of amino acid residues with side chains of similar charge have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamic acid, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be randomly introduced along all or part of the coding sequence, such as by saturation mutagenesis, and the resulting mutants are screened for biological activity to identify mutants that retain activity. After mutagenesis, the encoded protein can be expressed and the activity of the protein can be determined. Conservative (e.g., within a group of amino acids with similar properties and / or side chains) substitutions can be made to maintain or not significantly change the properties. Exemplary substitutions are shown in the table below.

[0137] Table 1. Amino acid substitutions

[0138]

[0139]

[0140] Amino acids can be classified according to the similarity of the properties of their side chains (see, e.g., Lehninger, Biochemistry [Biochemistry] 73-75 (2nd ed., 1975): (1) nonpolar: alanine (A), valine (V), leucine (L), isoleucine (I), proline (P), phenylalanine (F), tryptophan (W), methionine (M); (2) uncharged polar: glycine (G), serine (S), threonine (T), cysteine ​​(C), tyrosine (Y), asparagine (N), glutamine (Q); (3) acidic: aspartic acid (D), glutamic acid (E); and (4) basic: lysine (K), arginine (R), histidine (H). Alternatively, naturally occurring residues can be divided into the following groups based on common side chain properties: (1) hydrophobic: norleucine, methionine, alanine, valine, leucine, isoleucine; (2) neutral hydrophilic: cysteine, serine, threonine, asparagine, aminoacylglycerol; (3) acidic: aspartic acid, glutamic acid; (4) basic: histidine, lysine, arginine; (5) residues affecting chain direction: glycine, proline; and (6) aromatic: glycine, tyrosine, phenylalanine.

[0141] For example, any cysteine ​​residue that is not involved in maintaining the proper conformation of a polypeptide provided herein can also be substituted, for example, with another amino acid (such as alanine or serine) to improve the oxidative stability of the molecule and prevent aberrant cross-linking.

[0142] Non-conservative substitutions will entail exchanging an amino acid from one of these classes for another.

[0143] Insertions of the amino acid sequence include amino acid and / or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include polypeptides with an N-terminal methionyl residue.

[0144] These variations can be made using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine screening, and PCR mutagenesis. Site-directed mutagenesis (e.g., see Carter, Biochem J. 237:1-7 (1986); and Zoller et al., Nucl. Acids Res. 10:6487-500 (1982)), cassette mutagenesis (e.g., see Wells et al., Gene 34:315-23 (1985)), or other known techniques can be performed on cloned DNA to generate polypeptide variant DNA.

[0145] On the other hand, the present invention provides an optimized nucleic acid encoding SMN protein, comprising a nucleic acid sequence as shown in SEQ ID NO: 35 or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity with SEQ ID NO: 35. In some embodiments, the optimized nucleic acid provided herein further comprises a promoter region, the promoter region comprising SEQ ID NO: 36 or SEQ ID NO: 37. In some specific embodiments, the present invention provides a nucleic acid comprising a nucleic acid as shown in SEQ ID NO: 36 and SEQ ID NO: 35. In other specific embodiments, the present invention provides a nucleic acid comprising a nucleic acid as shown in SEQ ID NO: 37 and SEQ ID NO: 35.

[0146] 5.2.2. Targets of endogenous miRNAs

[0147] In certain embodiments, the nucleic acid constructs provided herein include, in addition to nucleic acids encoding a protein of interest (e.g., SMN protein), nucleic acids containing one or more target segments of one or more endogenous miRNAs (or target segment sequences of miRNAs). As shown in Section 6 below, certain target segments containing one or more endogenous miRNAs show favorable properties for reducing off-target toxicity of gene therapy (e.g., AAV-based gene therapy).

[0148] In some embodiments, the nucleic acid comprises target segments of two or more endogenous miRNAs, and the two or more endogenous miRNAs are tissue-specific miRNAs. As used herein, tissue-specific miRNAs are miRNAs whose quantity is higher in one or more specific tissues than in other tissues, such as liver-specific miRNAs and heart-specific miRNAs. In some embodiments, two or more endogenous miRNAs are specific to the same tissue. In other embodiments, two or more endogenous miRNAs are specific to different tissues. In some specific embodiments, the nucleic acid comprises one or more target segments of one or more liver-specific miRNAs and one or more target segments of one or more heart-specific miRNAs.

[0149] In some embodiments, the nucleic acid comprises 1 to 50 target segments. In some embodiments, the nucleic acid comprises 1 to 40 target segments. In some embodiments, the nucleic acid comprises 1 to 30 target segments. In some embodiments, the nucleic acid comprises 1 to 20 target segments. In some embodiments, the nucleic acid comprises 1 to 15 target segments. In some embodiments, the nucleic acid comprises 5 to 15 target segments. In some embodiments, the nucleic acid comprises 7 to 11 target segments.

[0150] The target segment of miRNA refers to a nucleic acid fragment that can specifically hybridize or complement with miRNA (e.g., tissue-specific endogenous miRNA). The most common hybridization mechanism involves hydrogen bonds (such as Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonds) between complementary nucleobases of nucleic acid molecules. Stringent conditions depend on the sequence and are determined by the properties and composition of the nucleic acid molecules to be hybridized. Methods for determining whether a sequence can specifically hybridize with another sequence are well known in the art.

[0151] The endogenous miRNA and the target nucleic acid are complementary to each other when a sufficient number of nucleobases of the endogenous miRNA are able to hydrogen bond with corresponding nucleobases of the target nucleic acid, thereby producing the desired effect (e.g., antisense inhibition of the target nucleic acid (such as smn1 having a target segment provided herein)).

[0152] Non-complementary nucleobases between the miRNA and the smn1 with the target segment can be tolerated as long as the miRNA can still hybridize specifically to the target segment nucleic acid. In addition, the miRNA can hybridize on one or more segments of the smn1 with the target segment, such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).

[0153] According to some embodiments, the miRNA provided herein or a specific portion thereof has or has at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementarity with the target segment of the miRNA provided by the nucleic acid construct of the present disclosure or a portion thereof. The percentage complementarity of the miRNA to the target segment nucleic acid can be determined by conventional methods. For example, in the miRNA, 18 of the 20 nuclear bases of the miRNA are complementary to the target segment region, so such a miRNA will specifically hybridize, representing 90% complementarity. In this example, the remaining non-complementary nuclear bases can be clustered with complementary nuclear bases or interspersed with complementary nuclear bases, and do not have to be adjacent to each other or adjacent to complementary nuclear bases. A miRNA of 18 nucleobases in length has 4 (four) non-complementary nucleobases flanked by two regions that are fully complementary to the target nucleic acid segment, and such a miRNA has an overall complementarity of 77.8% with the target nucleic acid segment, and therefore falls within the scope of the present disclosure. The percentage complementarity of a miRNA with a target nucleic acid region can be routinely determined by the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program known in the art (Altschul et al., J. Mol. Biol. [Molecular Biology], 1990, 215, 403 410; Zhang and Madden, Genome Res. [Genome Research], 1997, 7, 649 656). Percent homology, sequence identity or complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using default settings, which employ the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

[0154] In some embodiments, the miRNA or a specific portion thereof provided herein is completely complementary (i.e., 100% complementary) to a target segment nucleic acid or a specific portion thereof. For example, in some embodiments, the miRNA can be completely complementary to a target segment provided herein. As used herein, "completely complementary" means that each nucleobase of the miRNA can accurately pair with the corresponding nucleobase of the target segment nucleic acid. For example, for a 20-nucleobase-long miRNA and a 400-nucleobase-long target segment sequence, as long as there are corresponding 20 nucleobase portions in the target segment nucleic acid that are completely complementary to the miRNA, they are completely complementary. With respect to a specific portion of the first and / or second nucleic acid, complete complementarity can also be used. For example, a 20-nucleobase portion of a 30-nucleobase-long miRNA can be "completely complementary" to a 400-nucleobase-long target segment sequence. If the target segment sequence has a corresponding 20-nucleobase portion, each of which is complementary to a 20-nucleobase portion of the miRNA, the 20-nucleobase portion of the 30-nucleobase-long oligonucleotide is completely complementary to the target segment sequence. At the same time, the entire 30 nucleobase miRNA may or may not be completely complementary to the target sequence, depending on whether the remaining 10 nucleobases of the miRNA are also complementary to the target sequence.

[0155] The position of non-complementary core base can be at 5 ' end or 3 ' end of miRNA, or any position between 5 ' end and 3 ' end of miRNA.Or, non-complementary core base or core base can be at the internal position of miRNA.When two or more non-complementary core bases exist, they can be adjacent (i.e. connected) or non-adjacent.In one embodiment, non-complementary core base is positioned in the wing segment of gapmer antisense oligonucleotide.

[0156] According to some embodiments, a miRNA of or up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprises no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase to the target nucleic acid. According to some embodiments, a miRNA of or up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprises no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase to the target nucleic acid.

[0157] The miRNA provided herein also includes those miRNAs that are complementary to a portion of a target segment nucleic acid. As used herein, "portion" refers to a limited number of adjacent (i.e., connected) nucleobases in a region or fragment of a target segment nucleic acid. "Portion" may also refer to a limited number of adjacent nucleobases of a miRNA. According to some embodiments, miRNA is partially complementary to at least 8 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 9 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 10 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 11 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 12 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 13 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 14 nucleobases of a target segment. According to some embodiments, miRNAs are partially complementary to at least 15 nucleobases of a target segment. Also contemplated are miRNAs that are complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portions of a target segment, or a range defined by any two of these values.

[0158] Non-limiting exemplary endogenous miRNAs and non-limiting exemplary target segments of these exemplary miRNAs are shown in Table 2 below.

[0159] Table 2. List of miRNAs and their target sequences

[0160]

[0161] In some embodiments, the endogenous miRNA sequence comprises SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is at least 80% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 80% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 81% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 82% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 83% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 84% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 85% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 86% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 87% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 88% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 89% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 90% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 91% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 92% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 93% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 94% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 95% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 96% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 97% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 98% identical to SEQ ID NO: 1. In some embodiments, the endogenous miRNA sequence is about 99% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid comprises at least one or more target segments of any of the above miRNAs.

[0162] In some embodiments, the endogenous miRNA sequence comprises SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is at least 80% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 80% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 81% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 82% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 83% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 84% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 85% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 86% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 87% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 88% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 89% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 90% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 91% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 92% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 93% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 94% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 95% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 96% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 97% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 98% identical to SEQ ID NO:2. In some embodiments, the endogenous miRNA sequence is about 99% identical to SEQ ID NO:2. In some embodiments, the nucleic acid comprises at least one or more target segments of any of the above miRNAs.

[0163] In some embodiments, the endogenous miRNA sequence comprises SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is at least 80% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 80% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 81% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 82% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 83% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 84% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 85% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 86% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 87% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 88% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 89% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 90% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 91% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 92% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 93% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 94% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 95% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 96% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 97% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 98% identical to SEQ ID NO:3. In some embodiments, the endogenous miRNA sequence is about 99% identical to SEQ ID NO:3. In some embodiments, the nucleic acid comprises at least one or more target segments of any of the above miRNAs.

[0164] In some embodiments, the endogenous miRNA sequence comprises SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is at least 80% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 80% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 81% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 82% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 83% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 84% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 85% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 86% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 87% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 88% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 89% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 90% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 91% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 92% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 93% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 94% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 95% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 96% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 97% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 98% identical to SEQ ID NO:4. In some embodiments, the endogenous miRNA sequence is about 99% identical to SEQ ID NO:4. In some embodiments, the nucleic acid comprises at least one or more target segments of any of the above miRNAs.

[0165] In some embodiments, the endogenous miRNA sequence comprises SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is at least 80% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 80% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 81% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 82% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 83% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 84% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 85% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 86% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 87% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 88% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 89% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 90% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 91% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 92% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 93% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 94% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 95% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 96% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 97% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 98% identical to SEQ ID NO:5. In some embodiments, the endogenous miRNA sequence is about 99% identical to SEQ ID NO:5. In some embodiments, the nucleic acid comprises at least one or more target segments of any of the above miRNAs.

[0166] In some embodiments, the endogenous miRNA sequence comprises SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is at least 80% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 80% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 81% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 82% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 83% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 84% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 85% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 86% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 87% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 88% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 89% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 90% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 91% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 92% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 93% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 94% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 95% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 96% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 97% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 98% identical to SEQ ID NO:6. In some embodiments, the endogenous miRNA sequence is about 99% identical to SEQ ID NO:6. In some embodiments, the nucleic acid comprises at least one or more target segments of any of the above miRNAs.

[0167] In some embodiments, the nucleic acid comprises one or more repeats of a target segment comprising a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 7. In some specific embodiments, the nucleic acid comprises one or more repeats of a target segment having SEQ ID NO: 7. In some embodiments, the nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeats of any of the above target segments, such as a target segment having a nucleic acid sequence as shown in SEQ ID NO: 7.

[0168] In some embodiments, the nucleic acid comprises one or more repeats of a target segment comprising a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 8. In some specific embodiments, the nucleic acid comprises one or more repeats of a target segment having SEQ ID NO: 8. In some embodiments, the nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeats of any of the above target segments, such as a target segment having a nucleic acid sequence as shown in SEQ ID NO: 8.

[0169] In some embodiments, the nucleic acid comprises one or more repeats of a target segment comprising a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 9. In some specific embodiments, the nucleic acid comprises one or more repeats of a target segment having SEQ ID NO: 9. In some embodiments, the nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeats of any of the above target segments, such as a target segment having a nucleic acid sequence as shown in SEQ ID NO: 9.

[0170] In some embodiments, the nucleic acid comprises one or more repeats of a target segment comprising a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 10. In some specific embodiments, the nucleic acid comprises one or more repeats of a target segment having SEQ ID NO: 10. In some embodiments, the nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeats of any of the above target segments, such as a target segment having a nucleic acid sequence as shown in SEQ ID NO: 10.

[0171] In some embodiments, the nucleic acid comprises one or more repeats of a target segment comprising a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 11. In some specific embodiments, the nucleic acid comprises one or more repeats of a target segment having SEQ ID NO: 11. In some embodiments, the nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeats of any of the above target segments, such as a target segment having a nucleic acid sequence as shown in SEQ ID NO: 11.

[0172] In some embodiments, the nucleic acid comprises one or more repeats of a target segment comprising a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 12. In some specific embodiments, the nucleic acid comprises one or more repeats of a target segment having SEQ ID NO: 12. In some embodiments, the nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeats of any of the above target segments, such as a target segment having a nucleic acid sequence as shown in SEQ ID NO: 12.

[0173] In some embodiments, the nucleic acid comprises at least one target segment of hsa-mir-133a (or hsa-mir-133a-1). In some embodiments, the nucleic acid comprises at least two repeats of the target segment of hsa-mir-133a (or hsa-mir-133a-1). In some embodiments, the nucleic acid comprises at least three repeats of the target segment of hsa-mir-133a (or hsa-mir-133a-1).

[0174] In some embodiments, the nucleic acid comprises at least one target segment of hsa-mir-133a (or hsa-mir-133a-1) and at least one target segment of a liver-specific miRNA. In some embodiments, the nucleic acid comprises at least 2 repeats of the target segment of hsa-mir-133a (or hsa-mir-133a-1) and at least one target segment of a liver-specific miRNA. In some embodiments, the nucleic acid comprises at least 3 repeats of the target segment of hsa-mir-133a (or hsa-mir-133a-1) and at least one target segment of a liver-specific miRNA. In some embodiments, the liver-specific miRNA is hsa-mir-122. In some more specific embodiments, the target segment of hsa-mir-133a comprises SEQ ID NO: 11 and the target segment of hsa-mir-122 comprises SEQ ID NO: 10.

[0175] Table 3. Exemplary linkers

[0176] Connector Name Adapter sequence EXG Link01 5'-cttgac-3' (SEQ ID NO: 13) EXG Link02 5'-ccatag-3' (SEQ ID NO: 14) EXG Link03 5'-tttcta-3' (SEQ ID NO: 15) EXG Link04 5'-caagct-3' (SEQ ID NO: 16) EXG Link05 5'-gatcta-3' (SEQ ID NO: 17)

[0177] In some embodiments, multiple target segments within the target segment sequence in the present nucleic acid construct can be overlapping. Alternatively, these target segments can be non-overlapping. In some embodiments, the target segment within the target segment region is separated by multiple nucleotides, the number of these nucleotides is, is about, does not exceed, does not exceed about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 nucleotides, or is a range defined by any two of the aforementioned values. In some embodiments, the target segment within the target segment sequence is separated by no more than or no more than about 5 nucleotides. According to some embodiments, the target segment is continuous.

[0178] In some embodiments, one or more joints are present between two target segments. In some embodiments, all target segments are connected by joints. In other embodiments, only a portion of the target segments are connected by joints. In some embodiments, the joints in the nucleic acid are the same. In other embodiments, different joints are present in the nucleic acid.

[0179] Exemplary linkers are listed in Table 3. In some embodiments, the nucleic acid comprises one or more linkers having SEQ ID NO: 13. In some embodiments, the nucleic acid comprises one or more linkers having SEQ ID NO: 14. In some embodiments, the nucleic acid comprises one or more linkers having SEQ ID NO: 15. In some embodiments, the nucleic acid comprises one or more linkers having SEQ ID NO: 16. In some embodiments, the nucleic acid comprises one or more linkers having SEQ ID NO: 17. In some embodiments, the nucleic acid comprises one or more linkers, each linker independently selected from SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0180] Exemplary nucleic acids comprising multiple target segments of multiple endogenous miRNAs (or target segment sequences of miRNAs) are shown in Table 6 in Section 6 below.

[0181] In some embodiments, the nucleic acid (or target segment sequence of miRNA) comprising multiple target segments comprises at least one target segment of hsa-mir-208a, at least one target segment of hsa-mir-208b, at least one target segment of hsa-mir-122, and at least one target segment of hsa-mir-133a. In some embodiments, the nucleic acid (or target segment sequence of miRNA) comprising multiple target segments comprises two target segments of hsa-mir-208a, two target segments of hsa-mir-208b, three target segments of hsa-mir-122, and three target segments of hsa-mir-133a. In a specific embodiment, the nucleic acid (or target segment sequence of miRNA) comprising multiple target segments comprises 2 repetitions of a target segment having a nucleic acid sequence as shown in SEQ ID NO: 8, 2 repetitions of a target segment having a nucleic acid sequence as shown in SEQ ID NO: 9, 3 repetitions of a target segment having a nucleic acid sequence as shown in SEQ ID NO: 10, and 3 repetitions of a target segment having a nucleic acid sequence as shown in SEQ ID NO: 11. In some embodiments, the nucleic acid comprising multiple target segments (or target segment sequence of miRNA) comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:19.

[0182] In some embodiments, the nucleic acid comprising multiple target segments (or target segment sequence of miRNA) comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:18.

[0183] In some embodiments, the nucleic acid comprising multiple target segments (or target segment sequence of miRNA) comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:20.

[0184] In some embodiments, the nucleic acid comprising multiple target segments (or target segment sequence of miRNA) comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:21.

[0185] In some embodiments, the order of the component target segments is the same as the order of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21. In other embodiments, the order of the component target segments (from 5' to 3') is different from the order of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21.

[0186] 5.2.3. Synthetic promoter

[0187] As shown in Section 6 below, certain synthetic promoters provided herein provide surprisingly superior effects, particularly for delivery of SMN in AAV-based gene therapy.

[0188] Therefore, in yet another aspect, provided herein is a nucleic acid comprising a nucleic acid region comprising a nucleic acid sequence encoding an SMN protein or a variant thereof and a synthetic promoter comprising an enhancer and a core promoter.

[0189] In some embodiments, the synthetic promoter comprises a CMV enhancer and an hSyn promoter. In some embodiments, the synthetic promoter comprises a proC3 enhancer and an hSyn promoter. In some embodiments, the synthetic promoter comprises a proA5 enhancer and an hSyn promoter. In other embodiments, the synthetic promoter comprises a proB15 enhancer and an hSyn promoter.

[0190] In some embodiments, the synthetic promoter comprises a CMV enhancer and an hSyn promoter, wherein the hSyn promoter comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38; and the CMV enhancer comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:39.

[0191] In some embodiments, the synthetic promoter comprises a proC3 enhancer and an hSyn promoter, wherein the hSyn promoter comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38; and the proC3 enhancer comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:40.

[0192] In some embodiments, the synthetic promoter comprises a proA5 enhancer and an hSyn promoter, wherein the hSyn promoter comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:38; and the proA5 enhancer comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:41.

[0193] In some embodiments, the synthetic promoter comprises a proB15 enhancer and an hSyn promoter, wherein the hSyn promoter comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38; and the proB15 enhancer comprises a nucleic acid sequence selected from the group consisting of: a nucleic acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:42.

[0194] In some embodiments, the SMN protein or a variant thereof comprises an amino acid sequence as set forth in SEQ ID NO:33, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:33.

[0195] In some embodiments, the nucleic acid sequence encoding the SMN protein or a variant thereof comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:34 and SEQ ID NO:35.

[0196] Section 6, below, describes exemplary rAVV vectors comprising the synthetic promoters of the present disclosure.

[0197] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:45 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:45.

[0198] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:46 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:46.

[0199] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:47 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:47.

[0200] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:48 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:48.

[0201] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:49 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:49.

[0202] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:50 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:50.

[0203] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:51 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:51.

[0204] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:52 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:52.

[0205] In some embodiments, provided herein is a rAVV vector comprising a nucleic acid sequence as shown in SEQ ID NO:53 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:53.

[0206] 5.3. Recombinant Viral Vectors and Vector Particles for Gene Therapy

[0207] Also provided herein is a gene therapy based on a virus for delivering a nucleic acid provided herein. Therefore, on the other hand, provided herein is a viral vector (e.g., rAAV vector) comprising a nucleic acid provided herein (comprising a nucleic acid region encoding a target protein and a nucleic acid region containing a target segment of miRNA). On the other hand, provided herein is a viral particle (e.g., rAAV or rAAV particle) comprising a nucleic acid provided herein.

[0208] 5.3.1. Virus-based gene delivery systems

[0209] Some virus-based systems have been developed for transferring genes into mammalian cells. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, retroviral vectors, vaccinia virus vectors, herpes simplex virus vectors and derivatives thereof. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and other virology and molecular biology manuals.

[0210] In certain embodiments, the viral vectors or viral particles provided herein are derived from adenovirus. Exemplary vectors are based on or derived from HAd5, ChAd3, HAd26, HAd6, AdCH3NSmut, HAd35, ChAd63, HAd4, rcAd26. Recombinant adenoviral vectors can be constructed according to methods known in the art. For example, see O'Connor et al., Virology, 217(1):11-22 (1996); Hardy et al., Journal of Virology, 73(9):7835-7841 (1999); Hardy et al., Journal of Virology, 71(3):1842-1849 (1997). In some embodiments, third generation adenoviral vectors (also referred to as "high capacity adenoviral vectors" (HCAd), helper virus-dependent or "gutless" adenoviral vectors) can be used herein to deliver longer sequences. In some embodiments, the polynucleotide of interest, e.g., a transgene, is cloned into an adenoviral vector containing only the ITRs and packaging signals. A helper adenoviral vector can be co-transfected into HEK cells to produce adenoviral particles. See Lee et al., Genes and Diseases, 4(2):43-63 (2007).

[0211] In certain embodiments, the viral vector or viral particle provided herein is derived from a lentivirus. Exemplary vectors are based on or derived from HIV-1, HIV-2, SIVSM, SIVAGM, EIAV, FIV, VNV, CAEV or BIV. Slow virus vectors can be produced according to known methods in the art, for example, as described in the following documents: Cribbs et al., BMC Biotechnology [BMC Biotechnology], 13: 98 (2003); Merten et al., Mol Ther Methods Clin Dev. [Molecular Therapeutic Methods and Clinical Development], 13 (3): 16017 (2016); Durand and Cimarelli, Viruses [Virus], 3: 132-159 (2011). In some embodiments, a third generation self-inactivating lentivirus vector is used herein.

[0212] In certain embodiments, the viral vectors or viral particles provided herein are derived from herpes simplex virus (HSV). In some embodiments, the herpes simplex virus is herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), or any derivative thereof. Exemplary vectors are based on or derived from HSV-1, HSV-2, CMV, VZV, EBV, and KSHV. HSV-based vectors can be constructed according to methods known in the art, for example, as described in U.S. Pat. Nos. 7,078,029, 6,261,552, 5,998,174, 5,879,934, 5,849,572, 5,849,571, 5,837,532, 5,804,413, and 5,658,724, and International Patent Applications WO 91 / 02788, WO 96 / 04394, WO 98 / 15637, and WO 99 / 06583, which are incorporated herein by reference in their entireties.

[0213] In some embodiments, the HSV-based vectors provided herein are amplicon vectors. In other embodiments, the HSV-based vectors provided herein are replication-deficient vectors. In yet other embodiments, the HSV-based vectors provided herein are replicable vectors.

[0214] Amplicon is a plasmid-derived vector designed to contain both the HSV DNA replication origin (ori) and the HSV cleavage packaging recognition sequence (pac). When the amplicon is transfected into a mammalian cell with HSV auxiliary function, the amplicon is replicated to form a head-to-tail concatemer, which is then packaged into viral particles. There are currently two main methods for producing amplicon particles, one is based on an auxiliary HSV with a defective infection, and the other is based on the transfection of HSV-1 genes (such as a set of overlapping clays or pac-deleted and ICP27-deleted BAC-HSV-1 of a pac deletion). In certain embodiments, the amplicon used herein can accommodate large foreign DNA fragments (e.g., up to 152kb), including multiple copies of transgenics (e.g., up to 15 copies), and is non-toxic.

[0215] In some embodiments, the HSV-based vector used herein lacks at least one essential HSV gene, and the HSV-based vector may also include the deletion of one or more non-essential genes. In some embodiments, the HSV-based vector is replication-defective. Most replication-defective HSV-based vectors include deletions that remove one or more mid-early, early or late HSV genes to prevent replication. In other embodiments, the HSV-based vector lacks the early genes selected from the group consisting of the following items: ICP0, ICP4, ICP22, ICP27, ICP47 and combinations thereof. In a specific embodiment, the HSV-based vector lacks all of the following genes: ICP0, ICP4, ICP22, ICP27 and ICP47. Exemplary replicable vectors include NV-1020 (HSV-1), RAV9395 (HSV-2), AD-472 (HSV-2), NS-gEnull (HSV-1) and ImmunoVEX (HSV2). Exemplary replication-defective vectors include d15-29(HSV-2), d15-29-41L(HSV-1), DISC-dH(HSV-1 and HSV-2), CJ9gD(HSV-1), TOH-OVA(HSV-1), d106(HSV-1), d81(HSV-1), HSV-SIV d106(HSV-1), and d106(HSV-1).

[0216] Replication-deficient HSV-based vectors are typically produced in complementing cell lines that provide appropriate levels of gene functions that are not present in replication-deficient HSV-based vectors but are required for viral propagation to produce high-titer viral vector reserves. Exemplary cell lines supplement at least one, and in some embodiments, all replication-essential gene functions that are not present in replication-deficient HSV-based vectors. For example, HSV-based vectors that lack ICP0, ICP4, ICP22, ICP27, and ICP47 can be complemented by the human osteosarcoma cell line U2OS. The cell line can also supplement non-essential genes that, once lost, reduce growth or replication efficiency (e.g., UL55). The complementing cell line can complement the defects of at least one replication-essential gene function encoded by the early region, i.e., the early region, the late region, the viral packaging region, the viral-associated region, or a combination thereof, including all HSV functions (e.g., enabling the propagation of HSV amplicons containing minimal HSV sequences (e.g., only terminal inverted repeats and packaging signals or only ITRs and HSV promoters)). In some embodiments, the cell line is further characterized in that it contains genes that complement the HSV-based vector in a non-overlapping manner, which minimizes and virtually eliminates the possibility of recombination of the HSV-based vector genome with cellular DNA. Therefore, if replication-competent HSV is inevitably present in the vector stock solution, it is reduced to a minimum amount. Therefore, this is suitable for certain therapeutic purposes, especially for gene therapy. The construction of the complementary cell line involves standard molecular biology and cell culture techniques known in the art.

[0217] In some cases, the viral vectors or viral particles provided herein are derived from adeno-associated virus (AAV). A more detailed description of AAV is provided in Sections 5.3.2 to 5.3.4 below.

[0218] The target nucleic acid can be cloned into a vector using any molecular cloning method known in the art, for example, including the use of restriction endonuclease sites and one or more selective markers. In certain embodiments, the nucleic acid is operably connected to a promoter. Various promoters for gene expression in mammalian cells have been explored, and any promoter known in the art can be used in the present disclosure. Promoters can be roughly divided into constitutive promoters or regulated promoters, such as inducible promoters.

[0219] In certain embodiments, the nucleic acid provided herein is operably connected to a constitutive promoter. A constitutive promoter allows a heterologous gene (also referred to as a transgene) to be constitutively expressed in a host cell. Exemplary constitutive promoters contemplated herein include, but are not limited to, cytomegalovirus (CMV) promoters, human elongation factor-1α (hEF1α), ubiquitin C promoter (UbiC), phosphoglycerol kinase promoter (PGK), simian virus 40 early promoter (SV40), and the chicken beta-actin promoter combined with the CMV early enhancer (CAGG). In a large number of studies, the efficiency of such constitutive promoters to driving transgenic expression has been widely compared.

[0220] In some embodiments, the nucleic acid provided herein is operably connected to an inducible promoter. Inducible promoters belong to the category of regulatable promoters. Inducible promoters can be induced by one or more conditions, such as physical conditions, the microenvironment of engineered immune effector cells, or the physiological state of engineered immune effector cells, inducing substances (i.e., inducers), or combinations thereof.

[0221] In some embodiments, the inducing conditions do not induce expression of endogenous genes in the engineered mammalian cells and / or the subject receiving the pharmaceutical composition. In some embodiments, the inducing conditions are selected from the group consisting of: an inducing agent, irradiation (e.g., ionizing radiation, light), temperature (e.g., heat), redox state, tumor environment, and the activity state of the engineered mammalian cells.

[0222] Those skilled in the art will recognize that target cells may require specific promoters, including but not limited to promoters with species specificity, inducibility, tissue specificity or cell cycle specificity (Parr et al., Nat. Med. [Nature Medicine] 3: 1145-9 (1997); the contents of which are incorporated herein by reference in their entirety). In one embodiment, the promoter is a promoter that is believed to be able to effectively drive the expression of the polynucleotides described herein. Promoters that promote expression in most tissues include, for example, but are not limited to, human elongation factor 1α-subunit (EF1α), early cytomegalovirus (CMV), RSV LTR, MoMLVLTR, phosphoglycerate kinase 1 (PGK) promoter, simian virus 40 (SV40) promoter and CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), telomerase (hTERT) promoter, chicken β-actin (CBA) and its derivatives CAG and mini-CBA, β-glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to limit expression to certain cell types, such as, but not limited to, nervous system promoters that can be used to limit expression to neurons, astrocytes, or oligodendrocytes. Non-limiting examples of neuronal tissue-specific expression elements include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β.), synaptophysin (Syn), methyl CpG binding protein 2 (MeCP2), CaMKII, mGluR2, NFL, NFH, nβ2, PPE, Enk and EAAT2 promoters. The above promoters can be combined with other synthetic short regulatory elements to generate novel synthetic promoters with central homology DNA sequences.

[0223] In some embodiments, the promoter is capable of expressing heterologous nucleic acids in neuronal cells. In some embodiments, the promoter is capable of expressing heterologous nucleic acids in motor neuron cells. In some embodiments, the promoter is capable of expressing heterologous nucleic acids in astrocytes. According to some embodiments, the promoter is the human synapsin 1 (hSyn) promoter, or hSyn in combination with a synthetic neuronal cell-specific regulatory element. According to some embodiments, the promoter is the glial fibrillary acid protein (GFAP) or EAAT2 promoter, or GFAP or EAAT2 in combination with a synthetic astrocyte-specific regulatory element.

[0224] In one embodiment, the nucleic acid construct comprises a promoter, such as but not limited to CMV or U6, or CMV or U6 in combination with a synthetic regulatory element. As a non-limiting example, the promoter in the rAAV vector of the present disclosure is a CBA or a small CBA promoter. As another non-limiting example, the promoter in the rAAV vector of the present disclosure is a modified small CBA promoter. In one embodiment, the rAAV vector has an engineered promoter. In one embodiment, the rAAV vector further comprises a synthetic enhancer element.

[0225] In one embodiment, the vector genome comprises at least one element that enhances transgene target specificity and expression (e.g., see Powell et al., Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are incorporated herein by reference in their entirety), such as an intron, or a synthetic intron having a modified sequence derived from a mammalian genome. Non-limiting examples of introns include: MVM (67-97 bps), F.IX truncated intron 1 (300 bps), β-globulin SD / immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor / immunoglobulin splice acceptor (500 bps), SV40 late splice donor / splice acceptor (19S / 16S) (180 bps), and hybrid adenovirus splice donor / IgG splice acceptor (230 bps). In one embodiment, the length of the intron can be 100 to 500 nucleotides. The length of the intron can be 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500. The promoter may be between 80 and 100, 80 and 120, 80 and 140, 80 and 160, 80 and 180, 80 and 200, 80 and 250, 80 and 300, 80 and 350, 80 and 400, 80 and 450, 80 and 500, 200 and 300, 200 and 400, 200 and 500, 300 and 400, 300 and 500, or 400 and 500 in length.

[0226] In certain embodiments, the vector also contains a selectable marker gene or reporter gene to select cells expressing the protein from a host cell population transfected by the vector. Both sides of the selectable marker gene and the reporter gene can have appropriate regulatory sequences to enable them to be expressed in host cells. For example, the vector can contain transcription and translation terminators, initiation sequences, and promoters useful for regulating the expression of the nucleic acid sequence.

[0227] 5.3.2. Recombinant AVV vector

[0228] In certain more specific embodiments, the nucleic acids provided herein are delivered by an AAV-based system and are thus contained within a recombinant AAV vector.

[0229] Any AAV serotype or variant thereof can be used in the present disclosure. AAV serotypes can include, but are not limited to, AAV1 (Genbank Accession No. NC_002077.1; HC000057.1), AAV2 (Genbank Accession No. NC_001401.2, JC527779.1), AAV2i8 (Asokan, A, 2010, Discov. Med. [Discovery Medicine] 9:399), AAV3 (Genbank Accession No. NC_001729.1), AAV3-B (Genbank Accession No. AF028705.1), AAV4 (Genbank Accession No. NC_001829.1), AAV5 (Genbank Accession No. NC_006152.1; JC527780.1), AAV6 (Genbank Accession No. AF028704.1; JC527781. 1), AAV7 (Gene Bank Accession No. NC_006260.1; JC527782.1), AAV8 (Gene Bank Accession No. NC_006261.1; JC527783.1), AAV9 (Gene Bank Accession No. AX753250.1; JC527784.1), AAV10 (Gene Bank Accession No. AY631965.1), AAVrh10 (Gene Bank Accession No. AY243015.1), AAV11 (Gene Bank Accession No. AY631966.1), AAV12 (Gene Bank Accession No. DQ813647.1), AAV13 (Gene Bank Accession No. EU285562.1), AAVLK03, AAVrh74, AAV DJ (Wu Z, et al., J Virol. 80: 11393-7 (2006)), AAV Anc81, Anc82, Anc83, Anc84, Anc110, Anc113, Anc126 or Anc127 (Zin, E. et al., Cell. Rep. 12: 1056 (2016)), AAV_go.1 (Arbetum, AE et al., J. Virol. 79: 15238 (2005)), AAVhu.37, AAVrh8, AAVrh8R and AAV rh.8 (Wang et al., Mol. Ther. 18: 119-125 (2010)), or variants thereof.

[0230] AAV variants include, but are not limited to, AAV1 variants (e.g., AAV comprising an AAV1 variant capsid protein), AAV2 variants (e.g., AAV comprising an AAV2 variant capsid protein), AAV3 variants (e.g., AAV comprising an AAV3 variant capsid protein), AAV3-B variants (e.g., AAV comprising an AAV3-B variant capsid protein), AAV4 variants (e.g., AAV comprising an AAV4 variant capsid protein), AAV5 variants (e.g., AAV comprising an AAV5 variant capsid protein), AAV6 variants (e.g., AAV comprising an AAV6 variant capsid protein), AAV7 variants (e.g., AAV comprising an AAV7 variant capsid protein), and AAV8 variants. (e.g., AAV comprising an AAV8 variant capsid protein), AAVrh8, AAVrh8R (e.g., AAV comprising an AAVrh8R variant capsid protein), AAV9 variant (e.g., AAV comprising an AAV9 variant capsid protein), AAV10 variant (e.g., AAV comprising an AAV10 variant capsid protein), AAVrh10 variant (e.g., AAV comprising an AAVrh10 variant capsid protein), AAV11 variant (e.g., AAV comprising an AAV11 variant capsid protein), AAV12 variant (e.g., AAV comprising an AAV12 variant capsid protein), AAV13 variant (e.g., AAV comprising an AAV13 variant capsid protein), AAV LK03 variant (e.g., AAV comprising an AAV LK03 variant capsid protein) or AAVrh74 variant (e.g., AAV comprising an AAVrh74 variant capsid protein).

[0231] The recombinant AAV (rAAV) vector used in the present disclosure can be constructed according to known techniques. In certain embodiments, the rAAV vector is constructed to include components that are operably connected in the transcription direction, including a transcription initiation region, a polynucleotide provided herein, and a control element in a transcription termination region. The control element can be selected based on the target cell. In certain embodiments, the resulting rAAV vector construct including the operably connected components has functional AAV ITR sequences (5' and 3') on both sides.

[0232] In certain embodiments, the polypeptides provided herein (e.g., encoding SMN proteins) are operably linked to at least one regulatory sequence. In certain embodiments, regulatory sequences may include, for example, promoter sequences, enhancer sequences (e.g., upstream enhancer sequences (USE)), RNA processing signals, such as splicing signals, polyadenylation signal sequences, sequences that stabilize cytoplasmic mRNA, post-transcriptional regulatory elements (PREs), and / or microRNA (miRNA) target sequences. In certain embodiments, regulatory sequences may include sequences that improve translation efficiency (e.g., Kozak sequences), sequences that improve protein stability, and / or sequences that enhance protein processing and / or secretion. In certain embodiments, polynucleotides may encode regulatory miRNAs.

[0233] In certain embodiments, the regulatory sequence comprises a constitutive promoter and / or a regulatory control element. In certain embodiments, the regulatory sequence comprises a regulated promoter and / or a regulatory control element. In certain embodiments, the regulatory sequence comprises a broad promoter and / or a regulatory control element. In certain embodiments, the regulatory sequence comprises a cell or tissue-specific promoter and / or a regulatory control element. In certain embodiments, the regulatory control element is the 5' (i.e., present in the '5 untranslated region; 5'UTR) of the protein coding sequence. In other embodiments, the regulatory control element is the 3' (i.e., present in the '3 untranslated region; 3'UTR) of the protein coding sequence. In certain embodiments, the polynucleotide comprises more than one regulatory control element, for example, two, three, four or five control elements may be included. In the case where the polynucleotide comprises more than one control element, each control element may be independently located at the 5', 3', flank or interior of the coding sequence of the protein.

[0234] In certain embodiments, the control element is an enhancer. In certain embodiments, the control element comprises a polynucleotide that directs transcription or expression of the protein in vivo. The control element may comprise a control sequence that is normally associated with the selected polynucleotide of interest, or a heterologous control sequence.

[0235] Exemplary control sequences include those derived from sequences encoding mammalian or viral genes, such as the neuron-specific enolase promoter, the GFAP promoter, the SV40 early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, the cytomegalovirus (CMV) promoter, such as the CMV immediate early promoter region (CMVIE), the Rous sarcoma virus (RSV) promoter, synthetic promoters, and hybrid promoters.

[0236] In certain embodiments, the promoter is not cell or tissue specific, for example, the promoter is considered a broad promoter. Examples of promoter sequences that can promote expression in a variety of cell or tissue types include, for example, human elongation factor 1a-subunit (EF1a), cytomegalovirus (CMV) early enhancer and / or promoter, chicken β-actin (CBA) and its derivatives, such as CAG, such as CBA promoter with S40 intron, β-glucuronidase (GUSB) or ubiquitin C (UBC).

[0237] In certain embodiments, the promoter sequence can promote expression in a specific cell type or tissue. For example, in certain embodiments, the promoter can be a muscle-specific promoter, for example, it can be a mammalian muscle creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a mammalian troponin I (TNNI2) promoter, or a mammalian skeletal α-actin (ASKA) promoter. In other embodiments, the promoter sequence can promote expression in neural cells or cell types, for example, it can be a neuron-specific enolase (NSE), a synaptic protein (Syn), a methyl CpG binding protein 2 (MeCP2), a Ca2+ / calmodulin-dependent protein kinase II (CaMKII), a metabotropic glutamate receptor 2 (mGluR2), a neurofilament light (NFL) or heavy (NFH) beta globulin minigene hb2, a proenkephalin (PPE), an enkephalin (Enk), or an excitatory amino acid transporter 2 (EAAT2) promoter. In other embodiments, the promoter sequence can promote expression in the liver, for example, it can be α1 antitrypsin (hAAT) or thyroxine binding globulin (TBG) promoter. In yet other embodiments, the promoter sequence can promote expression in cardiac tissue, for example, it can be a cardiomyocyte-specific promoter, such as MHC, cTnT or CMV-MUC2k promoter.

[0238] In certain embodiments, the polynucleotide may include at least one polyadenylation (polyA) signal sequence known in the art. Where a polyadenylation sequence is present, it is typically located between the 3' end of the transgenic coding sequence and the 5' end of the 3' ITR. In certain embodiments, the polynucleotide further comprises a polyA upstream enhancer sequence 5' of the polyA signal sequence. In certain cases, the regulatory sequence is a sequence that improves translation efficiency, such as a Kozak sequence.

[0239] In certain embodiments, the polynucleotide comprises an intron. In certain embodiments, the intron is present in the coding sequence of the protein provided herein. In certain embodiments, the intron is 5' or 3' of the protein coding sequence. In certain embodiments, the intron is at one side of the 5' or 3' end of the protein coding sequence. In certain embodiments, the polynucleotide comprises two introns. In certain embodiments, an intron is 5' of the protein coding sequence, and an intron is 3' of the protein coding sequence. In certain embodiments, an intron is at one side of the 5' end of the protein coding sequence, and a second intron is at one side of the 3' end of the protein coding sequence. In certain embodiments, the intron is an SV40 intron, for example, a 5'UTR SV40 intron.

[0240] The sequence of AAV ITR known in the art can be used in the rAAV vector of the present disclosure. In some embodiments, the AAV ITR used in the vector of the present disclosure has a wild-type nucleotide sequence. In other embodiments, the AAV ITR sequence used in the vector of the present disclosure is not a wild-type sequence, but contains insertions, deletions or substitutions such as nucleotides. The AAV ITR provided herein can be derived from any AAV serotype, including but not limited to AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, AAV44-9, or variants thereof.

[0241] In some embodiments, the 5' and 3' ITRs on both sides of the nucleotide sequence in the rAAV vector provided herein are identical and derived from the same AAV serotype. In other embodiments, the 5' and 3' ITRs on both sides of the nucleotide sequence in the rAAV vector provided herein are different and / or derived from different AAV serotypes.

[0242] In some embodiments, rAAV vectors comprising a protein polynucleotide flanked by AAV ITRs can be constructed by directly inserting the polynucleotide of interest into the AAV genome, e.g., into an excised AAV open reading frame, and certain portions of the AAV genome may optionally be deleted as described in WO 1993 / 003769; Kotin (1994) Human Gene Therapy 5:793-801; Shelling and Smith (1994) Gene Therapy 1:165-169; and Zhou et al. (1994) J. Exp. Med. 179:1867-1875.

[0243] In other embodiments, the AAV ITRs are excised from the AAV genome or an AAV vector containing the ITRs and then fused 5' and 3' to the polynucleotide sequence of the protein present in another vector using standard ligation techniques.

[0244] In certain embodiments, the rAAV vector provided herein comprises a recombinant self-complementary genome. The rAAV comprising a self-complementary genome can generally form a double-stranded DNA molecule quickly by its partial complementary sequence (e.g., complementary coding strand and non-coding strand of transgenic). More specifically, in some embodiments, the rAAV vector provided herein comprises a rAAV genome, and the genome comprises a first heterologous polynucleotide sequence (e.g., therapeutic transgenic coding strand) and a second heterologous polynucleotide sequence (e.g., non-coding strand or antisense strand of therapeutic transgenic), and the first heterologous polynucleotide sequence can form an intrachain base pair with the second polynucleotide sequence. In certain embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are connected by a sequence that is conducive to intrachain base pairing, such as a DNA hairpin structure. In certain embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are connected by the ITR of mutation, so the rep protein will not crack the viral genome at the ITR of mutation. rAAV vectors containing a self-complementary genome can be made using methods known in the art, for example, as described in U.S. Pat. Nos. 7,125,717; 7,785,888; 7,790,154; 7,846,729; 8,093,054 and 8,361,457.

[0245] In some embodiments, the size of the polynucleotide molecules in the rAAV vector provided herein is less than about 5 kilobases (kb). In some embodiments, the size of the polynucleotide molecules in the rAAV vector provided herein is less than about 4.5kb. In some embodiments, the size of the polynucleotide molecules in the rAAV vector provided herein is less than about 4.0kb. In some embodiments, the size of the polynucleotide molecules in the rAAV vector provided herein is less than about 3.5kb. In some embodiments, the size of the polynucleotide molecules in the rAAV vector provided herein is less than about 3.0kb. In some embodiments, the size of the polynucleotide molecules in the rAAV vector provided herein is less than about 2.5kb.

[0246] In one aspect, the present invention provides a recombinant AAV (rAAV) vector comprising (i) a first nucleic acid region comprising a transgene; (ii) a second nucleic acid region comprising one or more target segments of one or more heterologous miRNAs, wherein at least one target segment is a target segment of an endogenous miRNA in the heart, and at least one target segment is a target segment of an endogenous miRNA in the liver; wherein the second nucleic acid region is located 3' to the first nucleic acid region; and wherein the rAAV vector comprises an inverted terminal repeat (ITR) derived from AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, or AAV44-9. In some embodiments, the first nucleic acid encodes SMN or a variant thereof.

[0247] In some specific embodiments, the second nucleic acid region in the rAAV vector of the present disclosure comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 18. In some embodiments, the rAAV vector comprises an ITR derived from AAV1. In some embodiments, the rAAV vector comprises an ITR derived from AAV2. In some embodiments, the rAAV vector comprises an ITR derived from AAV2i8. In some embodiments, the rAAV vector comprises an ITR derived from AAV3. In some embodiments, the rAAV vector comprises an ITR derived from AAV3-B. In some embodiments, the rAAV vector comprises an ITR derived from AAV4. In some embodiments, the rAAV vector comprises an ITR derived from AAV5. In some embodiments, the rAAV vector comprises an ITR derived from AAV6. In some embodiments, the rAAV vector comprises an ITR derived from AAV7. In some embodiments, the rAAV vector comprises an ITR derived from AAV8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8R. In some embodiments, the rAAV vector comprises an ITR derived from AAV9. In some embodiments, the rAAV vector comprises an ITR derived from AAV10. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh10. In some embodiments, the rAAV vector comprises an ITR derived from AAV11. In some embodiments, the rAAV vector comprises an ITR derived from AAV12. In some embodiments, the rAAV vector comprises an ITR derived from AAV13. In some embodiments, the rAAV vector comprises an ITR derived from AAV-DJ. In some embodiments, the rAAV vector comprises an ITR derived from AAV LK03. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh74.

[0248] In some specific embodiments, the second nucleic acid region in the rAAV vector of the present invention comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 19. In some embodiments, the rAAV vector comprises an ITR derived from AAV1. In some embodiments, the rAAV vector comprises an ITR derived from AAV2. In some embodiments, the rAAV vector comprises an ITR derived from AAV2i8. In some embodiments, the rAAV vector comprises an ITR derived from AAV3. In some embodiments, the rAAV vector comprises an ITR derived from AAV3-B. In some embodiments, the rAAV vector comprises an ITR derived from AAV4. In some embodiments, the rAAV vector comprises an ITR derived from AAV5. In some embodiments, the rAAV vector comprises an ITR derived from AAV6. In some embodiments, the rAAV vector comprises an ITR derived from AAV7. In some embodiments, the rAAV vector comprises an ITR derived from AAV8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8R. In some embodiments, the rAAV vector comprises an ITR derived from AAV9. In some embodiments, the rAAV vector comprises an ITR derived from AAV10. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh10. In some embodiments, the rAAV vector comprises an ITR derived from AAV11. In some embodiments, the rAAV vector comprises an ITR derived from AAV12. In some embodiments, the rAAV vector comprises an ITR derived from AAV13. In some embodiments, the rAAV vector comprises an ITR derived from AAV-DJ. In some embodiments, the rAAV vector comprises an ITR derived from AAV LK03. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh74.

[0249] In some specific embodiments, the second nucleic acid region in the rAAV vector of the present invention comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 20. In some embodiments, the rAAV vector comprises an ITR derived from AAV1. In some embodiments, the rAAV vector comprises an ITR derived from AAV2. In some embodiments, the rAAV vector comprises an ITR derived from AAV2i8. In some embodiments, the rAAV vector comprises an ITR derived from AAV3. In some embodiments, the rAAV vector comprises an ITR derived from AAV3-B. In some embodiments, the rAAV vector comprises an ITR derived from AAV4. In some embodiments, the rAAV vector comprises an ITR derived from AAV5. In some embodiments, the rAAV vector comprises an ITR derived from AAV6. In some embodiments, the rAAV vector comprises an ITR derived from AAV7. In some embodiments, the rAAV vector comprises an ITR derived from AAV8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8R. In some embodiments, the rAAV vector comprises an ITR derived from AAV9. In some embodiments, the rAAV vector comprises an ITR derived from AAV10. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh10. In some embodiments, the rAAV vector comprises an ITR derived from AAV11. In some embodiments, the rAAV vector comprises an ITR derived from AAV12. In some embodiments, the rAAV vector comprises an ITR derived from AAV13. In some embodiments, the rAAV vector comprises an ITR derived from AAV-DJ. In some embodiments, the rAAV vector comprises an ITR derived from AAV LK03. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh74.

[0250] In some specific embodiments, the second nucleic acid region in the rAAV vector of the present disclosure comprises a nucleic acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 21. In some embodiments, the rAAV vector comprises an ITR derived from AAV1. In some embodiments, the rAAV vector comprises an ITR derived from AAV2. In some embodiments, the rAAV vector comprises an ITR derived from AAV2i8. In some embodiments, the rAAV vector comprises an ITR derived from AAV3. In some embodiments, the rAAV vector comprises an ITR derived from AAV3-B. In some embodiments, the rAAV vector comprises an ITR derived from AAV4. In some embodiments, the rAAV vector comprises an ITR derived from AAV5. In some embodiments, the rAAV vector comprises an ITR derived from AAV6. In some embodiments, the rAAV vector comprises an ITR derived from AAV7. In some embodiments, the rAAV vector comprises an ITR derived from AAV8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh8R. In some embodiments, the rAAV vector comprises an ITR derived from AAV9. In some embodiments, the rAAV vector comprises an ITR derived from AAV10. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh10. In some embodiments, the rAAV vector comprises an ITR derived from AAV11. In some embodiments, the rAAV vector comprises an ITR derived from AAV12. In some embodiments, the rAAV vector comprises an ITR derived from AAV13. In some embodiments, the rAAV vector comprises an ITR derived from AAV-DJ. In some embodiments, the rAAV vector comprises an ITR derived from AAV LK03. In some embodiments, the rAAV vector comprises an ITR derived from AAVrh74.

[0251] In some more specific embodiments, the present invention provides a vector comprising a nucleic acid sequence as shown in SEQ ID NO:22 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:22.

[0252] In some more specific embodiments, the present invention provides a vector comprising a nucleic acid sequence as shown in SEQ ID NO:23 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:23.

[0253] In some more specific embodiments, the present invention provides a vector comprising a nucleic acid sequence as shown in SEQ ID NO:24 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:24.

[0254] In some more specific embodiments, the present invention provides a vector comprising a nucleic acid sequence as shown in SEQ ID NO:25 or a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:25.

[0255] 5.3.3. Recombinant AVV particles

[0256] In another aspect, provided herein are recombinant AAV (rAAV) or rAAV particles comprising a nucleic acid provided herein and at least one AAV capsid protein. The nucleic acid comprises any of the nucleic acids described in Sections 5.2 and 5.3.2 above and a rAAV vector.

[0257] The capsid protein may be derived from the same serotype as the ITR, or a derivative thereof. The capsid may also be of a different serotype than the ITR. For example, in certain embodiments, the AAV particle comprises an AAV2 ITR and an AAV6 capsid (AAV 2 / 6), an AAV2 ITR and an AAV7 capsid (AAV 2 / 7), an AAV2 ITR and an AAV8 capsid (AAV 2 / 8), or an AAV2 ITR and an AAV9 capsid (AAV 2 / 9).

[0258] Naturally occurring AAV capsids include AAV VP1, VP2 and VP3 capsid proteins, which are encoded by splice variants of the AAV cap gene, respectively. In general, AAV particles include three proteins, VP1, VP2 and VP3, wherein VP2 and VP3 are truncated versions of VP1 and therefore have sequences contained in VP1. In general, the amino acid sequence of VP1 defines the serotype of the capsid. Thus, for example, if the VP1 capsid protein encodes the AAV2 VP1 protein, the AAV will be of the AAV2 serotype, and if the VP1 capsid protein encodes the AAV8 VP1 protein, the AAV will be of the AAV8 serotype.

[0259] In some embodiments, the AAV capsid proteins (e.g., VP1, VP2, and / or VP3) in the rAAV particles of the present disclosure are not naturally occurring capsid proteins. In some embodiments, the AAV capsid proteins (e.g., VP1, VP2, and / or VP3) are derived from naturally occurring capsid proteins.

[0260] In some embodiments, the AVV capsid protein is a VP1 capsid protein. In other embodiments, the AVV capsid protein is a VP2 capsid protein. In other embodiments, the AVV capsid protein is a VP3 capsid protein. In some embodiments, the rAVV particles comprise a VP1 capsid protein, a VP2 capsid protein and / or a VP3 capsid protein. In other embodiments, the rAVV particles comprise a VP1 capsid protein, a VP2 capsid protein and a VP3 capsid protein. In some embodiments, the rAAV particles comprise a VP1 capsid protein, a VP2 capsid protein and / or a VP3 capsid protein, wherein the capsid proteins of the rAAV particles belong to the same serotype. In other embodiments, the rAAV particles comprise a VP1 capsid protein, a VP2 capsid protein and a VP3 capsid protein, wherein the capsid proteins of the AAV particles belong to the same serotype.

[0261] In certain aspects, the capsid protein is a variant capsid protein. Compared to the corresponding reference capsid protein, such as a naturally occurring parent capsid protein, i.e., the capsid protein from which it is derived, the variant capsid protein may include one or more mutations, such as amino acid substitutions, amino acid deletions, and heterologous peptide insertions. In some embodiments, the amino acid sequence of the AAV capsid protein is identical to the amino acid sequence of a wild-type, or reference, or parent AAV capsid protein except for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid residues, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid residues are replaced. In some embodiments, the capsid protein or AAV particle described herein may be a chimeric capsid protein or AAV particle, which comprises the protein sequences of two or more AAV serotype capsid proteins or particles, respectively.

[0262] In some embodiments, the capsid protein in the rAAV particles provided herein is derived from AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, AAV44-9 capsid protein. In specific embodiments, the capsid protein in the rAAV particles provided herein has an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% identical to the amino acid sequence of the AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, AAV44-9 capsid protein.

[0263] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins, which comprise VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV1.

[0264] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins, which comprise VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV2.

[0265] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV2i8.

[0266] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV3.

[0267] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV3-B.

[0268] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV4.

[0269] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV5.

[0270] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV6.

[0271] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV7.

[0272] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV8.

[0273] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAVrh8.

[0274] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAVrh8R.

[0275] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV9.

[0276] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV10.

[0277] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAVrh10.

[0278] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins, which comprise VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV11.

[0279] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins, which comprise VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV12.

[0280] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins, which comprise VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV13.

[0281] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV-DJ.

[0282] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV LK03.

[0283] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAVrh74.

[0284] In certain embodiments, the AAV particles provided herein comprise VP1, VP2 and / or VP3 capsid proteins comprising VP1, VP2 and / or VP3 capsid protein sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 100% sequence identity to any of the VP1, VP2 or VP3 amino acid sequences of AAV44-9.

[0285] In some specific embodiments, the rAAV particles provided herein comprise a nucleic acid encoding a protein of interest provided herein and VP1 of AAV, and VP1 of AAV comprises an amino acid sequence as shown in SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 or SEQ ID NO: 32. In a specific embodiment, VP1 comprises an amino acid sequence as shown in SEQ ID NO: 29.

[0286] Table 4. Exemplary VP1, VP2 and VP3 proteins

[0287]

[0288]

[0289]

[0290]

[0291]

[0292] The rAAV particles described herein can be produced by any suitable method known in the art. For example, host cells (such as mammalian cells) can be engineered to stably express the components necessary for the production of AAV particles. This can be achieved by integrating plasmids (or multiple plasmids) and selective markers containing AAV rep and cap genes, such as antibiotic (e.g., neomycin or ampicillin) resistance genes into the genome of the cell. The cell can be such as an insect or mammalian cell, and then the cell can be co-infected with a helper virus (e.g., an adenovirus or baculovirus providing an auxiliary function) and a rAAV vector containing 5' and 3' AAV ITR. Selective markers are used to enable rAAV to be mass-produced. As another non-limiting example, adenovirus or baculovirus can be used instead of plasmids to introduce rep and cap genes into packaging cells. As another non-limiting example, viral vectors containing 5' and 3' AAV ITR and rep and cap genes can be stably integrated into the DNA of the production cell, and auxiliary functions can be provided by wild-type adenovirus to produce rAAV.

[0293] AAV's helper virus refers to a virus that allows AAV to be replicated and packaged by host cells. Helper viruses provide auxiliary functions that enable AAV to replicate. Many such helper viruses have been identified, including adenoviruses, herpes viruses, and pox viruses, such as vaccinia viruses. Adenoviruses include many different subgroups, but adenovirus type 5 (Ad5) of subgroup C is the most commonly used. Many adenoviruses of human, non-human mammalian and avian origin are known and can be obtained from depository institutions such as ATCC. Viruses of the herpes family can also be obtained from depository institutions such as ATCC, including, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV) and pseudorabies virus (PRV). Examples of adenovirus helper functions for AAV replication include E1A function, E1B function, E2A function, VA function and E4orf6 function.

[0294] A preparation of AAV is said to be substantially free of helper virus if the ratio of infectious AAV particles to infectious helper virus particles is at least about 102:1; at least about 104:1; at least about 106:1; or at least about 108:1. The preparation may also be free of equivalent amounts of helper virus protein (i.e., if the helper virus particle impurities described above are present in fragmented form, proteins will be present due to this level of helper virus). Viral and / or cellular protein contamination can typically be observed as Coomassie staining bands on SDS gels (e.g., the presence of bands other than those corresponding to AAV capsid proteins VP1, VP2, and VP3).

[0295] In certain embodiments, host cells containing the above-mentioned rAAV vectors are endowed with the ability to provide AAV helper functions to replicate and encapsulate polynucleotides with AAV ITRs on both sides encoding the target protein provided herein, thereby producing rAAV particles. AAV helper functions are generally AAV-derived coding sequences that can be expressed to provide AAV gene products, which in turn play a role in productive AAV replication. In this article, AAV helper functions are used to supplement the necessary AAV functions missing in rAAV vectors. In some embodiments, AAV helper functions include one or two major AAV ORFs, namely rep and cap coding regions, or functional homologs thereof.

[0296] AAV helper functions can be introduced into host cells by transfecting host cells with AAV helper constructs before or simultaneously with transfection of rAAV vectors. For example, AAV helper constructs can be used to provide at least transient expression of AAV rep and / or cap genes to supplement the AAV functional deficiencies necessary for productive infection of AAV. Typically, AAV helper constructs lack AAVITR and can neither replicate nor package themselves. AAV helper constructs can be in the form of, for example, plasmids, bacteriophages, transposons, cosmids, viruses or virions.

[0297] In certain embodiments, the host cell is also capable of providing or being provided with non-AAV derived functions or "helper functions" to produce rAAV particles. Helper functions refer to non-AAV derived viral and / or cellular functions that AAV replication depends on, such as non-AAV proteins and RNAs required for AAV replication, including those involved in activating AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, Cap expression product synthesis, and AAV capsid assembly. In some embodiments, virus-based helper functions can be derived from known helper viruses.

[0298] In some embodiments, recombinant AAV particles are produced by infecting host cells with a helper virus and / or a helper function vector, so that the generated rAAV particles are infectious, replication-defective viruses and include an AAV protein coat that encapsulates a heterologous target nucleotide sequence flanked by AAV ITRs.

[0299] rAAV particles can be purified from host cells using purification methods known in the art (e.g., chromatography, cesium chloride gradients, and other methods described, for example, in U.S. Pat. Nos. 6,989,264 and 8,137,948 and WO 2010 / 148143). In some embodiments, residual helper viruses can be inactivated using known methods (e.g., by heating).

[0300] 5.3.4. Cells

[0301] Various host cells can be used to produce rAAV particles as described herein. Suitable host cells for producing AAV particles from polynucleotides and AAV vectors provided herein include microorganisms, yeast cells, insect cells, and mammalian cells. Typically, such cells can be or have been used as receptors for heterologous nucleic acid molecules and can be grown in, for example, suspension cultures and bioreactors.

[0302] In some embodiments, the cell is a mammalian host cell, such as HEK293, HEK293-T, A549, WEHI, 10T1 / 2, BHK, MDCK, COS1, COS7, BSC 1, BSC 40, BMT 10, VERO, W138, HeLa, 293, Jurkat, 2V6.11, Saos, C2C12, L, HT1080, HepG2, primary fibroblasts, hepatocytes, and myoblasts.

[0303] In other embodiments, the cell is an insect cell, such as Sf9, SF21, SF900+ or ​​a Drosophila cell line, a mosquito cell line, such as a cell line derived from Aedes albopictus, a silkworm cell line, such as a Bombyx mori cell line, a Trichoplusia ni cell line, such as a High Five cell, or a Lepidoptera cell line, such as an Ascalapha odorata cell line. In some embodiments, the insect cell is a cell derived from an insect species susceptible to baculovirus infection, including High Five, Sf9, Se301, SeIZD2109, SeUCR1, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, BM-N, Ha2302, Hz2E5, and Ao38. For example, Kotin RM has described large-scale production of recombinant AAV in cells, including Sf9 insect cells (Hum Mol Genet. [Human Molecular Genetics] 20 (R1): R2-R6 (2011) doi: 10.1093 / hmg / ddr141). Methods for molecular engineering and polypeptide expression in insect cells are described, for example, in the following references: Summers and Smith. A Manual of Methods for Baculovirus Vectors and Insect Culture Procedure s [Manual of Methods for Baculovirus Vectors and Insect Culture Procedures], Texas Agricultural Experimental Station Bull. No. 7555, College Station, Tex. [Texas Agricultural Experimental Station Bulletin, No. 7555, College Station, Texas] (1986); King, LA and RD Possee, The baculovirus expression system ,Chapman and Hall,United Kingdom [Chapman Hall Publishers, UK] (1992); O'Reilly, DR, LK Miller, VA Luckow, Baculovirus Expression Vectors:A Laboratory Manual, New York [Baculovirus Expression Vectors: A Laboratory Manual, New York] (1992); WH Freeman and Richardson, CD, Baculovirus Expression Protocols,Methods in Molecular Biology [Molecular Biology Protocols and Methods for Baculovirus Expression], Issue 39 (1995).

[0304] 5.4. Pharmaceutical Compositions

[0305] In one aspect, the present disclosure further provides a pharmaceutical composition comprising the vector or viral particle of the present disclosure. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of the vector or viral particle provided herein and a pharmaceutically acceptable excipient.

[0306] In some embodiments, provided herein is a pharmaceutical composition comprising a therapeutically effective amount of a rAAV vector provided herein and a pharmaceutically acceptable excipient.

[0307] In other embodiments, provided herein is a pharmaceutical composition comprising a therapeutically effective amount of a vector or viral particle provided herein and a pharmaceutically acceptable excipient.

[0308] In a specific embodiment, the term "excipient" may also refer to a diluent, an adjuvant (such as Freunds' adjuvant (complete or incomplete)), a carrier or a medium. Pharmaceutical excipients may be sterile liquids, such as water and oils, including those derived from petroleum, animals, plants or synthetic liquids, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. Saline solutions and aqueous solutions of glucose and glycerol may also be used as liquid excipients. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talcum powder, sodium chloride, skim milk powder, glycerol, propylene glycol, water, ethanol, etc. If necessary, the composition may also include a small amount of a wetting agent or emulsifier, or a pH buffer. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, etc. Examples of suitable pharmaceutical excipients are described in Remington's Pharmaceutical Sciences (1990) Mack Publishing Co., Easton, PA. These compositions will contain a prophylactically or therapeutically effective amount of an active ingredient as provided herein, such as in purified form, plus an appropriate amount of an excipient to provide a form suitable for administration to a patient. The dosage form should be suitable for the mode of administration.

[0309] In some embodiments, the choice of excipient is determined in part by the particular cells, viral particles, and / or method of administration. Thus, there are a wide variety of suitable dosage forms.

[0310] Generally, acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers, antioxidants including ascorbic acid, methionine, vitamin E, sodium metabisulfite; preservatives, isotonic agents, stabilizers, metal complexes (e.g., zinc-protein complexes); chelating agents such as EDTA and / or nonionic surfactants.

[0311] Buffers can be used to control the pH to a range that optimizes the therapeutic effect, especially in cases where stability depends on the pH. Buffers suitable for use in the present disclosure include organic and inorganic acids and their salts. For example, citrates, phosphates, succinates, tartrates, fumarates, gluconates, oxalates, lactates, acetates. In addition, buffers can include histidine and trimethylamine salts, such as Tris.

[0312] Preservatives may be added to slow the growth of microorganisms. Preservatives suitable for use in the present disclosure include octadecyl dimethyl benzyl ammonium chloride; hexamethonium chloride; halogenated (e.g., chloride, bromide, iodide) benzalkonium, benzethonium chloride; thimerosal, phenol, butyl alcohol or benzyl alcohol; alkyl parabens, such as methyl paraben or propyl paraben; catechol; resorcinol; cyclohexanol, 3-pentanol and m-cresol.

[0313] Isotonic agents, sometimes referred to as "stabilizers," can be used to adjust or maintain the isotonicity of a liquid in a composition. When used for charged biomacromolecules such as proteins and antibodies, isotonic agents are often referred to as "stabilizers" because they can interact with the charged groups of amino acid side chains, thereby reducing the potential for intermolecular and intramolecular interactions. Exemplary isotonic agents include polyols, triols, or more polyols, such as glycerol, erythritol, arabitol, xylitol, sorbitol, and mannitol.

[0314] Additional exemplary excipients include: (1) bulking agents, (2) solubility enhancers, (3) stabilizers, and (4) agents that prevent denaturation or adhesion to the container wall. These excipients include: polysaccharide alcohols (as described above); amino acids, such as alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, threonine, etc.; organic sugars or sugar alcohols, such as sucrose, lactose, lactitol, trehalose, stachyose, mannose, sorbitol, xylose, ribose, ribitol, myoinisitose, myoinisitol, galactose, galactitol, glycerol, cyclitol ( For example, inositol), polyethylene glycol; sulfur-containing reducing agents such as urea, glutathione, lipoic acid, sodium thioacetate, thioglycerol, α-monothioglycerol and sodium thiosulfate; low molecular weight proteins such as human serum albumin, bovine serum albumin, gelatin or other immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; monosaccharides (e.g., xylose, mannose, fructose, glucose; disaccharides (e.g., lactose, maltose, sucrose); trisaccharides such as raffinose; and polysaccharides such as dextrin or dextran.

[0315] Nonionic surfactants or detergents (also called "wetting agents") may be present to help dissolve the therapeutic agent and protect the therapeutic protein from aggregation caused by agitation, which also allows the formulation to be exposed to shear surface stress without causing denaturation of the active therapeutic protein. Suitable nonionic surfactants include, for example, polysorbates (20, 40, 60, 65, 80, etc.), polyoxyethylene ethers (184, 188, etc.), Polyols, Polyoxyethylene sorbitan monoether ( The detergents include glyceryl monostearate, sucrose fatty acid ester, methylcellulose and carboxymethylcellulose. The anionic detergents include sodium lauryl sulfate, sodium dioctyl sulfosuccinate and sodium dioctyl sulfonate. The cationic detergents include benzalkonium chloride or benzethonium chloride.

[0316] In order to be used for in vivo administration, the pharmaceutical composition is preferably sterile. The pharmaceutical composition can be sterilized by filtering through a sterile filter membrane. The pharmaceutical composition herein can usually be placed in a container with a sterile access port, for example, an intravenous fluid bag or a vial with a stopper that can be pierced by a hypodermic injection needle.

[0317] The route of administration is in accordance with known and recognized methods, for example by single or multiple boluses or prolonged infusion in an appropriate manner, such as injection or infusion by subcutaneous, intravenous, intraperitoneal, intramuscular, intraarterial, intralesional or intraarticular routes, intravitreal, subretinal injection, topical administration, inhalation or by sustained release or slow release means.

[0318] In another embodiment, the pharmaceutical composition can be provided as a controlled release or sustained release system. In one embodiment, a pump can be used to achieve controlled release or sustained release (e.g., see Sefton, Crit. Ref. Biomed. Eng. [Biomedical Engineering] 14: 201-40 (1987); Buchwald et al., Surgery [Surgery] 88: 507-16 (1980); and Saudek et al., N. Engl. J. Med. [New England Journal of Medicine] 321: 569-74 (1989)). In another embodiment, a polymeric material can be used to achieve controlled release or sustained release of a preventive or therapeutic agent or a composition provided herein (e.g., see Medical Applications of Controlled Release [Medical Applications of Controlled Release] (Langer and Wise, ed., 1974); Controlled Drug Bioavailability, Drug Product Design and Performance [Bioavailability, Drug Product Design, and Performance of Controlled Release Drugs] (Smolen and Ball, eds., 1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61-126 (1983); Levy et al., Science 228:190-92 (1985); During et al., Ann. Neurol. 25:351-56 (1989); Howard et al., J. Neurosurg. 71:105-12 (1989); U.S. Patents Nos. 5,679,377; 5,916,597; 5,912,015; 5,989,463 and 5,128,326; PCT Publication No. WO 99 / 15154 and WO99 / 20253). Examples of polymers used in sustained-release formulations include, but are not limited to, polyhydroxyethyl methacrylate, polymethyl methacrylate, polyacrylic acid, ethylene-vinyl acetate copolymer, polymethacrylic acid, polyglycolide (PLG), polyanhydride, poly(N-vinyl pyrrolidone), polyvinyl alcohol, polyacrylamide, polyethylene glycol, polylactic acid (PLA), lactide-co-glycolide (PLGA), and polyorthoesters. In one embodiment, the polymer used in the sustained-release formulation is inert, free of leachable impurities, stable on storage, sterile, and biodegradable.

[0319] In yet another embodiment, a controlled or sustained release system can be positioned near a specific target tissue, such as the nasal cavity or lungs, thereby requiring only a small fraction of the systemic dose (see, e.g., Goodson, Medical Applications of Controlled Release [Medical Applications of Controlled Release] Vol. 2, 115-38 (1984). For example, Langer et al. discuss controlled release systems (Science 249: 1527-33 (1990)). Any technique known to those skilled in the art can be used to produce sustained release formulations containing one or more of the agents described herein (e.g., see U.S. Pat. No. 4,526,938, PCT Publication Nos. WO 91 / 05548 and WO 96 / 20698, Ning et al., Radiotherapy & Oncology 39: 179-89 (1996); Song et al., PDA J. of Pharmacol. USA ... Pharma. Sci. & Tech. [PDA Journal of Pharmaceutical Science and Technology] 50: 372-97 (1995); Cleek et al., Pro. Int'l. Symp. Control. Rel. Bioact. Mater. [Proceedings of the International Symposium on "Controlled Release of Bioactive Materials"] 24: 853-54 (1997); and Lam et al., Proc. Int'l. Symp. Control Rel. Bioact. Mater. [Proceedings of the International Symposium on "Controlled Release of Bioactive Materials"] 24: 759-60 (1997)).

[0320] The pharmaceutical compositions described herein may also contain one or more active compounds or agents that are necessary for the specific indication being treated. Alternatively, or additionally, the composition may contain a cytotoxic agent, a chemotherapeutic agent, a cytokine, an immunosuppressant, or a growth inhibitory agent. These molecules may be suitably present in combination in an amount effective for the intended purpose.

[0321] Active ingredients can also be encapsulated in microcapsules prepared, for example, by coascervation techniques or interfacial polymerization, such as hydroxymethylcellulose or gelatin-microcapsules and polymethylmethacrylate microcapsules in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or macroemulsions, respectively. These techniques are disclosed in Remington's Pharmaceutical Science, 18th edition.

[0322] Various compositions and delivery systems are known and can be used with the therapeutic agents provided herein, including but not limited to liposomes, microparticles, encapsulation in microcapsules, recombinant cells capable of expressing the therapeutic molecules provided herein, nucleic acid constructs as part of viral vectors or other vectors, and the like.

[0323] In certain embodiments, the pharmaceutical compositions provided herein include binding molecules and / or viral particles for treating or preventing a disease or condition in an effective amount (such as a therapeutically effective or prophylactically effective amount). In certain embodiments, the therapeutic or preventive efficacy is monitored by regularly evaluating the subject being treated. For repeated administration for several days or longer, depending on the condition, repeated treatment is performed until the desired disease symptom suppression occurs. However, other dosage regimens may also be useful and may be determined.

[0324] 5.5. Methods and Purpose

[0325] In another aspect, provided herein are methods of using the vectors or viral particles (rAAV) provided herein and uses of the vectors or viral particles provided herein.

[0326] These methods and uses include treatment methods and uses, for example, involving administering a molecule, rAAV, or a composition containing rAAV to a subject suffering from a disease or condition. In some embodiments, the molecule, viral particle, and / or composition is administered in an effective amount to achieve the effect of treating the disease or condition. Uses include the use of viral particles in such methods and treatments, and the use in preparing a medicament to implement such treatment methods. In some embodiments, these methods are performed by administering a viral particle or a composition containing a viral particle to a subject suffering from or suspected of suffering from a disease or condition. In some embodiments, these methods thereby treat the disease or condition of the subject.

[0327] In some embodiments, the treatment methods provided herein result in complete or partial improvement or reduction of a disease or condition, or symptoms, side effects, or results or phenotypes associated therewith. The desired effects of treatment include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the progression of the disease, improving or alleviating the disease state, and alleviating or improving prognosis. These terms include, but do not mean to completely cure the disease or completely eliminate any symptoms or be effective or effective for all symptoms.

[0328] As used herein, in some embodiments, the treatments provided herein delay the development of a disease or condition, e.g., postpone, hinder, slow, slow down, stabilize, inhibit and / or delay the development of a disease (e.g., SMA). Such delays can have different lengths of time, depending on the disease history and / or the individual being treated. It will be apparent to those skilled in the art that a sufficient or significant delay can actually include prevention, i.e., the individual does not develop a disease or condition.

[0329] In other embodiments, the methods or uses provided herein can prevent a disease or disorder.

[0330] In some embodiments, the disease or condition is associated with SMN. In some embodiments, the disease or condition is associated with insufficient expression of SMN protein. In some embodiments, the disease or condition is associated with defective SMN protein (such as a mutated SMN protein). In some embodiments, the vectors or viral particles described herein are used to treat subjects with SMA who have smn1 deletions and / or mutations. In some embodiments, the subject has one or more smn1 mutations or microdeletions. In some embodiments, the subject has one or more smn1 antisense mutations. In some embodiments, the subject has one or more smn1 frameshift mutations.

[0331] In some specific embodiments, the disease or condition is SMA. In certain embodiments, the present disclosure provides a gene therapy method for SMN (such as SMN1) related diseases or conditions (e.g., neuromuscular degenerative diseases, such as SMA-I, SMA-II, SMA-III, and SMA-IV). In some embodiments, the disease or condition is a neuromuscular degenerative disease, such as type I SMA, type II SMA, type III SMA, and type IV SMA. In some specific embodiments, the disease or condition is type I SMA. In some embodiments, the disease or condition is type II SMA. In other embodiments, the disease or condition is type III SMA. In yet other embodiments, the disease or condition is type IV SMA.

[0332] Microdeletions and antisense mutations of the smn1 gene are the most common genetic causes of SMA-I. Adequate levels of SMN1 protein expression are detected in the blood of the vast majority of people with healthy nervous systems. The lack of expression of SMN proteins (e.g., SMN1) has also been identified as a cause of other neurodegenerative diseases, including, for example, Parkinson's disease, progressive supranuclear palsy, ataxia, corticobasal syndrome, Huntington disease-like syndrome, Creutzfeldt–Jakob disease, and Alzheimer's disease. In some embodiments, SMN-related diseases or disorders are diseases associated with SMN protein expression defects (e.g., diseases associated with SMN1 expression defects).

[0333] Spinal muscular atrophy (SMA) is an early-onset neuromuscular degenerative disease that is a progressive and fatal disease characterized by, for example, the selective death of motor neurons in the motor cortex, brainstem, and spinal cord. Patients diagnosed with SMA-I present with a progressive muscle phenotype characterized by, for example, spasticity, hyperreflexia or hyporeflexia, fasciculations, muscle atrophy, and paralysis. These movement disorders are due to muscle denervation caused by the loss of motor neurons. The main pathological features of SMA-I include degeneration of the corticospinal tracts and massive loss of lower motor neurons (LMNs) or anterior horn cells, degeneration and loss of Betz cells and other pyramidal cells in the primary motor cortex, and reactive gliosis in the motor cortex and spinal cord. SMA-I usually die within 0.9 to 2 years of diagnosis due to respiratory defects and / or inflammation.

[0334] In some embodiments, symptoms of SMA including, but not limited to, motor neuron degeneration, muscle weakness, muscle atrophy, muscle stiffness, difficulty breathing, slurred speech, development of fasciculations, frontotemporal dementia, and / or premature death are improved in the treated subject. In other aspects, the compositions of the present disclosure are applied to one or both of the brain and the spinal cord. According to some embodiments, one or both of muscle coordination and muscle function are improved. According to some embodiments, the survival of the subject is prolonged.

[0335] In some embodiments, overall enhancement of expression of AAV-derived wild-type smn1 or codon-optimized smn1 can reduce the effects of SMA in a subject.

[0336] In some embodiments, administering a composition of the disclosure to a subject enhances transcription of smn1 (eg, wild-type smn1 or codon-optimized smn1) mRNA in transduced cells of the subject. In some embodiments, transcription of wild-type smn1 and / or codon-optimized smn1 may be enhanced by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, or 500%, or at least 20% to 30%, 20% to 40%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 30% to 40%, 30% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 100%, 30% to 40%, 30% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95% %, 30% to 100%, 40% to 50%, 40% to 60%, 40% to 70%, 40% to 80%, 40% to 90%, 40% to 95%, 40% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 60% to 70%, 60% to 70%, 60% to 90%, 60% to 95%, 60% to 10 ... 0% to 80%, 60% to 90%, 60% to 95%, 60% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100% or 95% to 100%, 100% to 500%.

[0337] In some embodiments, the vectors or viral particles described herein may be administered to a subject in the early stages of SMA. Early symptoms include, but are not limited to, muscle weakness or stiffness, tightness and spasms, muscle cramps and twitches (fasciculations), reduced muscle size (atrophy), fatigue, poor balance, slurred speech, weak grip, and / or stumbling while walking. Symptoms may be limited to a single body area, or mild symptoms may affect more than one area. As a non-limiting example, administration of the vectors or particles described herein may reduce the severity of early SMA symptoms and / or reduce the occurrence of early SMA symptoms.

[0338] In other embodiments, the vectors or viral particles described herein may be administered to subjects in the middle or late stages of SMA-I, or early stages of SMA-II-IV. The middle or late stages of SMA-I, or early stages of SMA-II-IV include, but are not limited to, a greater range of muscle symptoms compared to the early stages, paralysis of some muscles while other muscles are weak or unaffected, persistent muscle twitching (fasciculations), contractures of unused muscles, stiffness, pain and sometimes deformity of joints, weakness of swallowing muscles that may lead to choking, more difficulty eating and controlling saliva, weakness of respiratory muscles that may lead to respiratory insufficiency (which may be evident when lying down), and / or the subject may have episodes of uncontrolled, inappropriate laughter or crying (pseudobulbar effects). As a non-limiting example, administration of the vectors or viral particles described herein may reduce the severity of symptoms of the middle or late stages of SMA-I or early stages of SMA-II-IV, and / or reduce the occurrence of symptoms of the middle or late stages of SMA-I or early stages of SMA-II-IV.

[0339] The compositions described herein can be administered to an individual by any route, for example, intravascularly (e.g., intravenously (IV) or intraarterially), directly into an artery, systemically (e.g., by intravenous injection), or topically (e.g., by intraarterial or intraocular injection). Non-limiting exemplary methods of administration include intravenous (e.g., by an infusion pump), intraperitoneally, intraocularly, intraarterially, intrapulmonary, oral, inhalation, intravenous, intramuscularly, intratracheally, subcutaneously, intrathecally, transdermally, transpleurally, intraarterially, topically, inhalation (e.g., spray), mucosal (e.g., through the nasal mucosa), subcutaneously, transdermally, gastrointestinal, intraarticularly, intrathoracic, intraventricularly, intracranially, intraurethrally, intrahepatically, intratumorally, intravitreally, and subretinally. In some embodiments, the compositions for treating SMA of the present disclosure are administered intravenously, intramuscularly, subcutaneously, intraperitoneally, intrathecally, and / or intraventricularly to a subject in need thereof, such that the nucleic acid of the present disclosure passes through one or both of the blood-brain barrier and the blood-spinal cord barrier. In some embodiments, the method comprises administering (e.g., intravenously and / or intrathecally) a therapeutically effective amount of a composition of the present disclosure directly to the central nervous system (CNS) of a subject (e.g., using an infusion pump and / or a delivery stent). The vector or viral particle can be used to enhance the expression of the smn1 gene, and / or reduce one or more symptoms of SMA in a subject, thereby treating SMA.

[0340] In some embodiments, compositions comprising an AAV vector or AAV particle comprising a nucleic acid sequence described herein can be administered in a manner that facilitates entry of the composition into the central nervous system and penetration into motor neurons.

[0341] In some embodiments, the AAV vectors or AAV particles of the present disclosure may be administered by intramuscular injection.

[0342] In some embodiments, an AAV vector or AAV particle comprising a nucleic acid of the present disclosure is administered to a subject by peripheral injection and / or intranasal delivery.

[0343] In some embodiments, an AAV vector or AAV particle comprising a nucleic acid of the disclosure is administered to a subject by intracranial delivery (e.g., intrathecal or intracerebroventricular administration, see, e.g., U.S. Pat. No. 8,119,611; the contents of which are incorporated herein by reference in their entirety).

[0344] In some embodiments, compositions comprising the AAV vectors or particles of the present disclosure are administered intravenously or intracranially to the central nervous system (CNS) of a subject. In other embodiments, compositions comprising the AAV vectors or particles of the present disclosure are administered to the CNS, such as neurons, motor neurons, microglia, and astrocytes. In other embodiments, compositions comprising the AAV vectors or particles of the present disclosure are administered to astrocytes.

[0345] In some embodiments, compositions comprising the AAV vectors or particles of the present disclosure can be delivered to specific types of target cells, including neurons, motor neurons; glial cells (including oligodendrocytes, astrocytes, and microglia); and / or other cells surrounding neurons, such as T cells.

[0346] In some embodiments, the AAV vectors or AAV particles of the present disclosure may be administered in a therapeutically effective amount, e.g., an amount sufficient to alleviate and / or prevent at least one symptom associated with a disease, or to improve the condition of a subject.

[0347] In some embodiments, the AAV vectors or AAV particles of the present disclosure can be administered to the central nervous system in a therapeutically effective amount to improve the function and / or survival of SMA patients. As a non-limiting example, the composition can be administered intravenously and / or intrathecally.

[0348] In some embodiments, the AAV vectors or AAV particles of the present disclosure can be administered to a subject (e.g., administered to the subject's central nervous system) in a therapeutically effective amount to slow the subject's functional decline (e.g., as determined using known assessment methods such as the SMA Functional Rating Scale (SMAFRS)) and / or prolong the subject's ventilator-independent survival (e.g., reduce mortality or the need for respiratory support). As a non-limiting example, the composition can be administered intravenously and / or intrathecally.

[0349] In some embodiments, the AAV vectors or AAV particles of the present disclosure may be administered to the cisterna magna in a therapeutically effective amount to transduce spinal motor neurons and / or astrocytes. As a non-limiting example, the composition may be administered intrathecally.

[0350] In some embodiments, the AAV vectors or AAV particles of the present disclosure may be administered by intrathecal infusion in a therapeutically effective amount to transduce spinal motor neurons and / or astrocytes. As a non-limiting example, the composition may be administered intrathecally.

[0351] In some embodiments, the AAV vectors or AAV particles of the present disclosure may be administered by bolus infusion.

[0352] In some embodiments, the AAV vectors or AAV particles of the present disclosure can be administered in a manner that provides sustained delivery over a period of minutes, hours, or days. The infusion rate can vary depending on the subject, distribution, dosage form, or another administration parameter.

[0353] In some embodiments, the catheter may be located at more than one site in the spine to achieve multi-site administration. In some embodiments, the AAV vectors or AAV particles of the present disclosure may be delivered as a continuous and / or bolus infusion. Each delivery site may be a different dosing regimen, or the same dosing regimen may be used for each delivery site. As a non-limiting example, the delivery site may be in the neck and waist. As a non-limiting example, the delivery site may be in the neck. As a non-limiting example, the delivery site may be in the waist.

[0354] In some embodiments, prior to delivery of an AAV vector or AAV particle described herein, the subject may be subjected to an analysis of spinal anatomy and pathology. As a non-limiting example, a subject with scoliosis may have a different dosing regimen and / or catheter position than a subject without scoliosis.

[0355] In some embodiments, during the delivery of the AAV vectors or particles of the present disclosure, the subject's spine direction can be perpendicular to the ground. In other embodiments, during the delivery of the AAV vectors or AAV particles of the present disclosure, the subject's spine direction can be parallel to the ground.

[0356] In some embodiments, during the delivery of the AAV vectors or AAV particles of the present disclosure, the subject's spine can be at an angle to the ground. The angle of the subject's spine to the ground can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, or 180 degrees.

[0357] In some embodiments, the delivery method and duration are selected to provide transduction over a wide range in the spinal cord. As a non-limiting example, intrathecal administration is used to provide transduction over a wide range along the head-to-tail length of the spinal cord. As another non-limiting example, multi-site infusion provides more uniform transduction along the head-to-tail length of the spinal cord. As another non-limiting example, continuous infusion provides more uniform transduction along the head-to-tail length of the spinal cord.

[0358] The pharmaceutical compositions disclosed herein can be administered to a subject in any effective amount to reduce, prevent and / or treat SMN-related diseases (such as SMA). The exact amount required may vary from subject to subject, depending on the species, age and overall condition of the subject, the severity of the disease, the specific composition, its mode of administration, its mode of activity, etc.

[0359] In some embodiments, the AAV vectors or AAV particles of the present disclosure may be administered in any suitable form, either as a liquid solution or suspension, or in a solid form suitable for a liquid solution or a suspension in a liquid solution, and may be formulated with any suitable and pharmaceutically acceptable excipient. In some embodiments, the AAV vectors or particles are formulated. As non-limiting examples, the alkalinity and / or osmotic pressure of the formulation may be optimized to ensure optimal distribution of the drug in the central nervous system or a region or component of the central nervous system.

[0360] In certain embodiments, the pharmaceutical composition provided herein is a suspension, such as a refrigerated suspension. In certain embodiments, the method further includes stirring the suspension before the administration step to ensure uniform distribution of the suspension. In certain embodiments, the method further includes heating the pharmaceutical composition to room temperature before the administration step. The composition can also be administered in a sustained release dosage form. Sustained release devices (such as pellets, nanoparticles, microparticles, nanospheres, microspheres, etc.) can be administered by injection or surgical implantation in various locations.

[0361] The compositions of the present disclosure are generally formulated in unit dosage form for ease of administration and uniformity of dosage. However, it is understood that the total daily dosage of the compositions of the present disclosure may be determined by the attending physician within the scope of reasonable medical judgment. The specific therapeutic effect for any particular patient will depend on various factors, including the disease being treated and the severity of the disease; the activity of the specific compound employed; the specific composition employed; the patient's age, weight, general health, sex and diet; the time of administration; the route of administration; the duration of treatment; drugs used in combination or concurrently with the specific compound employed; and other factors well known in the medical field.

[0362] In certain embodiments, the age and sex of the subject can be used to determine the dosage of the compositions of the present disclosure. As a non-limiting example, older subjects can receive a larger dose of the compositions (e.g., 5%-10%, 10%-20%, 15%-30%, 20%-50%, 25%-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90%) compared to younger subjects. As another non-limiting example, a younger subject can receive a larger dose of the composition (e.g., 5%-10%, 10%-20%, 15%-30%, 20%-50%, 25%-50%, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 90% more dose) than an older subject. As yet another non-limiting example, a female subject can receive a larger dose of the composition (e.g., 5%-10%, 10%-20%, 15%-30%, 20%-50%, 25%-50%, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 90% more dose) than a male subject. As yet another non-limiting example, male subjects can receive a larger dose of the composition compared to female subjects (e.g., 5%-10%, 10%-20%, 15%-30%, 20%-50%, 25%-50%, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more dose).

[0363] In some embodiments, the dosage of the AAV vector or AAV particle used to deliver the nucleic acids of the present disclosure can be adjusted according to the disease condition, the subject, and the treatment strategy.

[0364] In some embodiments, the concentration of vector or viral particle administered may vary depending on the method of production and may be selected or optimized based on the concentration determined to be therapeutically effective for a particular route of administration.

[0365] According to some embodiments, the concentration of vector genomes per milliliter (vg / ml) is selected from the group consisting of: about 10 8 vg / ml, about 10 9 vg / ml, about 10 10 vg / ml, about 10 11 vg / ml, about 10 12 vg / ml, about 10 13 vg / ml, about 10 14vg / ml and about 10 15 In some embodiments, the concentration is 10 10 vg / ml to 10 14 vg / ml range, for example 10 10 vg / ml to 10 15 vg / ml, 10 10 vg / ml to 10 14 vg / ml, 0 10 vg / ml to 10 13 vg / ml, 10 10 vg / ml to 10 12 vg / ml, 10 10 vg / ml to 10 11 vg / ml, 10 11 vg / ml to 10 14 vg / ml, 10 11 vg / ml to 10 13 vg / ml, 10 11 vg / ml to 10 12 vg / ml, 10 12 vg / ml to 10 14 vg / ml, 10 12 vg / ml to 10 13 vg / ml, 10 13 vg / ml to 10 14 vg / ml or 10 14 vg / ml to 10 15vg / ml. In some embodiments, the vector or viral particle provided herein is delivered by intravenous injection, intracranial injection, or intracerebellar medullary cisterna magna injection, or intrathecal injection, or intramuscular injection, or intravitreal injection. In some embodiments, the vector or viral particle injection volume provided herein is between about 0.1ml and about 20ml, for example, between about 0.1ml and about 20ml, between about 0.5ml and about 20ml, between about 1ml and about 20ml, between about 5ml and about 20ml, between about 0.1ml and about 5.0ml, between about 0.1ml and about 2.0ml, between about 0.1ml and about 1.0ml, between about 0.1ml and about 0.8ml, between about 0.1ml and about 0.6ml, between about 0.1mm and about 0.4ml, between about 0.1ml and about 0.2m l, between about 0.2ml and about 1.0ml, between about 0.2ml and about 0.8ml, between about 0.2ml and about 0.6ml, between about 0.2ml and about 0.4ml, between about 0.4ml and about 1.0ml, between about 0.4ml and about 0.8ml, between about 0.4ml and about 0.6ml, between about 0.6ml and about 1.0ml, between about 0.6ml and about 0.8ml, between about 0.8ml and about 1.0ml, or about 0.1ml, about 0.2ml, about 0.4ml, about 0.6ml, about 0.8ml and about 1.0ml.

[0366] In some embodiments, rAAV comprising a nucleic acid described herein can be administered to a subject at a dose of: 1 x 10 8 Up to 1x10 17 vector genomes (vg), such as 1x10 9 Up to 1x10 17 vector genomes (vg) or 1x10 14 Up to 1x10 15 vector genomes (vg), and include, for example, 1x10 10 , 2x10 10 , 3x10 10 , 4x10 10 , 5x10 10 , 6x10 10 , 7x10 10 , 8x10 10 , 9x10 10 , 1x10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11, 9x10 11 , 1x10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , 9x10 12 , 1x10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 , 9x10 13 , 1x10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , 9x10 14 , 1x10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , 9x10 15 , 1x10 16 , 2x10 16 , 3x10 16 , 4x10 16 , 5x10 16 , 6x10 16 , 7x10 16 , 8x10 16 , 9x10 16 , 1x10 17 , 2x10 17 , 3x10 17 , 4x10 17 , 5x10 17 , 6x10 17 , 7x10 17 , 8x10 17 or 9x10 17 Vector genome (vg).

[0367] In some embodiments, rAAV comprising a nucleic acid described herein can be administered at 1×10 8 Up to 1x10 17 The dose of vector genome / kilogram (vg / kg) is administered to the subject, such as 1x10 13 Up to 1x10 16 vg / kg, for example, including 1x10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 , 9x10 13 , 1x10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 or 9x10 14 vg / kg.

[0368] In some embodiments, one or more additional therapeutic agents may be administered to the subject.

[0369] The effectiveness of the compositions described herein can be monitored by some criteria. For example, after the subject is treated using the methods disclosed herein, the subject can be evaluated by one or more clinical parameters (including the parameters described herein), for example, improvement and / or stabilization of one or more signs or symptoms of the disease state and / or delay in progression. Examples of such tests are known in the art, including objective and subjective (e.g., subject report) measurements.

[0370] In some embodiments, the AAV vectors or AAV particles of the present disclosure can be delivered to a subject via a single route of administration. In other embodiments, the AAV vectors or AAV particles of the present disclosure can be delivered to a subject via a multi-site route of administration (e.g., at 2, 3, 4, 5 or more sites).

[0371] The pharmaceutical composition comprising the AAV vector or AAV particle of the present disclosure can be administered as a single dose per day, or the daily dose can be administered as divided doses twice, three times, or four times per day. The compositions provided herein can also be administered multiple times over a period of time (e.g., 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, or 3 years).

[0372] In some embodiments, compositions comprising the AAV vectors or particles of the disclosure are administered as a sole therapeutic agent or in combination therapeutic agent for the treatment of SMA.

[0373] In some embodiments, compositions comprising the AAV vectors or particles of the present disclosure may be used in combination with one or more other therapeutic agents. "Used in combination" does not mean that these agents must be administered simultaneously and / or formulated for delivery together, although these delivery methods are within the scope of the present disclosure. The composition may be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical treatments. In general, each agent will be administered according to the dosage and / or schedule determined for that agent.

[0374] In some embodiments, therapeutic agents that can be used in combination with the AAV vectors or particles of the present disclosure can be small molecule compounds, including, for example, immunosuppressants, antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamate agents, structural protein inhibitors, and compounds involved in metal ion regulation.

[0375] In some embodiments, compounds for treating SMA that can be used in combination with the vectors or viral particles described herein include, but are not limited to, anti-glutamate agents such as Riluzole, Topiramate, Talampanel, Lamotrigine, Dextromethorphan, Gabapentin, and AMPA antagonists; anti-apoptotic agents such as Minocycline, Sodium Phenylbutyrate, and Arimoclomol; anti-inflammatory agents such as gangliosides, Celecoxib, cyclosporine, azathioprine, cyclophosphamide, plasmafiltration, Glatiramer acetate, and sirolimus. acetate and thalidomide; ceftriaxone; β-lactam antibiotics; pramipexole (a dopamine agonist); nimesulide; diazoxide; pyrazolone derivatives; free radical scavengers that inhibit oxidative stress-induced cell death, such as bromocriptine; phenylcarbamate compounds; neuroprotective compounds; and glycopeptides.

[0376] In some embodiments, the therapeutic agent that can be used in combination therapy with the vectors or viral particles described herein can be a hormone or variant that can protect against neuronal loss, such as adrenocorticotropic hormone (ACTH) or a fragment thereof (such as U.S. Patent Publication No. 20130259875); estrogen (such as U.S. Patent Publication Nos. 6,334,998 and 6,592,845); the contents of which are incorporated herein by reference in their entirety.

[0377] In some embodiments, neurotrophic factors can be used together with the AAV vectors or AAV particles disclosed herein in combination therapy to treat SMA. In general, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation and / or maturation of neurons, or stimulate neuronal activity to increase. In some embodiments, the method of the present disclosure further includes delivering one or more trophic factors to a subject in need of treatment. Trophic factors may include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, Colivelin, Xaliproden, thyrotropin-releasing hormone, and ADNF, and variants thereof.

[0378] Experimental methods

[0379] Analysis of mRNA levels

[0380] Enhancement of gene (eg, smn1 nucleic acid) levels or expression can be assayed using a variety of methods known in the art.

[0381] For example, some methods of detecting or quantifying mRNA levels are known in the art. Exemplary methods include, but are not limited to, northern blots, ribonuclease protection experiments, PCR-based methods, etc. The mRNA sequence of a gene can be used to prepare a probe that is at least partially complementary to the mRNA sequence. The probe can then be used to detect mRNA in a sample using any suitable experimental method, such as PCR-based methods, northern blots, dipstick assays, etc.

[0382] Depending on the type of mRNA information desired, the experimental method can be different. Exemplary methods include, but are not limited to, Northern blots and PCR-based methods (e.g., qRT-PCR). Methods such as qRT-PCR can also accurately quantify the amount of mRNA in a sample.

[0383] Any suitable experimental platform can be used to determine the presence of mRNA in a sample. For example, the experiment can be in the form of a dipstick, membrane, chip, dish, test paper, filter, microsphere, slide, porous plate or optical fiber. The experimental system can have a solid support, on which the nucleic acid corresponding to the mRNA is attached. The solid support can include, for example, plastic, silicon, metal, resin, glass, membrane, particle, precipitate, gel, polymer, thin sheet, sphere, polysaccharide, capillary, film, plate or slide. The experimental components can be prepared and packaged into a kit for detecting mRNA.

[0384] If necessary, nucleic acid can be labeled to make a labeled mRNA population. In general, samples can be labeled using methods known in the art (e.g., using DNA ligase, terminal transferase, or by labeling RNA backbones, etc.). For example, see Ausubel et al. (Short Protocols in Molecular Biology, Wiley & Sons, 3rd edition, 1995); Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY, 3rd edition, 2001). In some embodiments, samples are labeled using fluorescent markers. Exemplary fluorescent dyes include, but are not limited to, xanthene dyes, fluorescein dyes (e.g., fluorescein isothiocyanate (FITC), 6-carboxyfluorescein (FAM), 6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE)), rhodamine dyes (e.g., rhodamine 110 (R110), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAM RA), 6-carboxy-X-rhodamine (ROX), 5-carboxyrhodamine 6G (R6G5 or G5), 6-carboxyrhodamine 6G (R6G6 or G6)), cyanine dyes (e.g., Cy3, Cy5, and Cy7), Alexa dyes (e.g., Alexa-fluor-555), coumarins, diethylaminocoumarins, umbelliferone, benzimide dyes (e.g., Hoechst 33258), phenanthridine dyes (e.g., Texas Red), ethidium dyes, acridine dyes, carbazole dyes, phenoxazine dyes, porphyrin dyes, polymethine dyes, BODIPY dyes, quinoline dyes, pyrene, chlorotriazine fluorescein, eosin dyes, tetramethylrhodamine, Lissamine, naphthylfluorescein, etc.

[0385] A typical mRNA experimental method may include the following steps: 1) obtaining a surface-bound subject probe; 2) hybridizing a population of mRNAs to the surface-bound probe under conditions sufficient to provide specific binding; (3) washing after hybridization to remove nucleic acids that are not specifically bound to the surface-bound probe; and (4) detecting the hybridized mRNA. The reagents used in each of these steps and the conditions under which they are used may vary depending on the specific application.

[0386] Hybridization can be carried out under appropriate hybridization conditions, and its stringency can be different as needed. Typical conditions are sufficient to produce probe / target segment complexes between complementary binding molecules on the solid surface (i.e., between the surface-bound main probe and the complementary mRNA in the sample). In some cases, stringent hybridization conditions can be used.

[0387] Hybridization is usually performed under stringent hybridization conditions. Standard hybridization techniques (e.g., under conditions sufficient to allow specific binding of the target mRNA in the sample to the probe) are described in the following literature: Kallioniemi et al., Science [Science], 258: 818-821 (1992) and International Patent Application Publication No. WO 93 / 18186. Some general technical guidance is available, for example, Tijssen, Hybridization with Nucleic Acid Probes [Nucleic Acid Probe Hybridization], Parts I and II (Elsevier Publishers, Amsterdam, 1993). For a description of techniques suitable for in situ hybridization, see Gall et al., Meth. Enzymol. [Enzymology Methods] 1981, 21: 470-480; Angerer et al., Genetic Engineering: Principles and Methods [Genetic Engineering: Principles and Methods], Volume 7, Pages 43-65 (Plenum, New York, Setlow and Hollaender, eds., 1985). The selection of appropriate conditions, including temperature, salt concentration, polynucleotide concentration, hybridization time, stringency of washing conditions, etc., will depend on the experimental design, including the source of the sample, the characteristics of the capture agent, the desired degree of complementarity, etc., and can be determined as a routine experimental matter for ordinary technicians in the field.

[0388] One of ordinary skill will readily recognize that alternative but equivalent hybridization and wash conditions can be utilized to provide similar stringency conditions.

[0389] After the mRNA hybridization process, the surface-bound polynucleotide is usually washed to remove unbound nucleic acids. Washing can be performed using any convenient washing scheme, wherein, as mentioned above, washing conditions are usually stringent. The hybridization of the target segment mRNA with the probe is then detected using standard techniques.

[0390] Other methods, such as PCR-based methods, can also be used to detect gene expression. Examples of PCR methods can be found in U.S. Patent No. 6,927,024, which is incorporated herein by reference in its entirety. Examples of RT-PCR methods can be found in U.S. Patent No. 7,122,799, which is incorporated herein by reference in its entirety. Fluorescence in situ PCR methods are described in U.S. Patent No. 7,186,507, which is incorporated herein by reference in its entirety.

[0391] In some embodiments, quantitative reverse transcription PCR (qRT-PCR) can be used for detection and quantification of RNA targets (Bustin et al., Clin. Sci. [Clinical Science] 2005, 109: 365-379). The quantitative results obtained by qRT-PCR are generally more valuable than qualitative data. Therefore, in some embodiments, experimental methods based on qRT-PCR can be used to measure mRNA levels in cell-based experimental methods. The qRT-PCR method is also useful for monitoring the treatment of patients. Examples of methods based on qRT-PCR can be found in U.S. Patent No. 7,101,663, which is incorporated herein by reference in its entirety.

[0392] Compared with conventional reverse transcriptase PCR and agarose gel analysis, qRT PCR can produce quantitative results. Another advantage of qRT-PCR is that it is relatively easy and convenient to use. Instruments for qRT-PCR, such as the Applied Biosystems 7500, are commercially available, as are reagents such as Sequence detection chemistry. For example, following the manufacturer's instructions, Gene expression detection reagents These kits are pre-formulated gene expression analysis reagents for rapid and reliable detection and quantitative mRNA transcripts of humans, mice and rats. In order to determine the number of cycles at which the fluorescent signal associated with the accumulation of a specific amplicon crosses a threshold value (called CT), the data can be analyzed using, for example, a 7500 real-time PCR system sequence detection software comparison comparison CT relative quantitative calculation method. Using this method, the output results are expressed as a multiple change in expression level. In certain embodiments, the threshold level can be selected to be automatically determined by the software. In certain embodiments, the threshold level is set to be higher than the baseline, but low enough so that it is within the exponential growth region of the amplification curve.

[0393] In other embodiments, the target RNA can be detected or quantified by next-generation sequencing (NGS).

[0394] 5.6.2 Analysis of protein levels

[0395] Enhanced protein expression of smn1 nucleic acid can be assessed by measuring SMN protein levels. Protein levels can be assessed or quantified by various methods known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assay, protein activity assay (e.g., caspase activity assay), immunohistochemistry, immunocytochemistry or fluorescence activated cell sorting (FACS), LC-MS (liquid chromatography-mass spectrometry) and other methods. Antibodies against the target segment can be obtained from various sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, Mich.), or prepared by conventional monoclonal or polyclonal antibody production methods known in the art. Antibodies useful for detecting mouse, rat, monkey and human smn1 are commercially available. For mass spectrometry analysis, protein levels can be measured using labeled or unlabeled methods.

[0396] In vivo analysis

[0397] In vivo experiments can be used to evaluate enhanced expression of SMN1, for example, improved motor function and respiration with reduced off-target toxicity in the liver and / or heart.

[0398] In some embodiments, motor function is measured by upright, open field performance of the animal. In certain embodiments, respiratory function is measured by whole body plethysmography, invasive resistance and compliance measurements of the animal.

[0399] In certain embodiments, overall survival (OS) and disease-free survival (DFS) are measured by observing the body weight and health status of living animals twice a day.

[0400] The test can be conducted in normal animals or experimental disease models. For administration to animals, the oligonucleotides can be formulated in a pharmaceutically acceptable diluent, such as phosphate buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous and subcutaneous. Calculation of oligonucleotide dosage and frequency of administration is within the capabilities of those skilled in the art and depends on factors such as the route of administration and the weight of the animal. After a period of treatment with the oligonucleotides, RNA can be isolated from the target tissue (including liver, heart, spleen, CNS tissue or CSF), and changes in smn1 nucleic acid expression can be measured, for example, using NGS.

[0401] 5.7. Kits and Products

[0402] Further provided herein are kits, unit doses, and articles of manufacture comprising any of the compositions described herein. In some embodiments, kits are provided comprising any of the pharmaceutical compositions described herein, preferably with instructions for use.

[0403] The kit of the present application adopts suitable packaging. Suitable packaging includes but is not limited to vials, bottles, cans, flexible packaging (such as sealed Mylar or plastic bags), etc. The kit can selectively provide additional components, such as buffers and information instructions. Therefore, the present application also provides products, including vials (such as sealed vials), bottles, cans, flexible packaging, etc.

[0404] The article may include a container and a label or drug instructions on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, etc. The container may be formed of various materials, such as glass or plastic. In general, the container holds a composition effective for treating a disease or condition described herein (such as SMA), and may have a sterile access port (for example, the container may be an intravenous fluid bag or a vial with a stopper that can be pierced by a hypodermic needle). The label or drug instructions indicate that the composition is used to treat a specific condition of an individual. The label or drug instructions will further include instructions for administering the composition to an individual. The label may indicate reconstitution and / or instructions for use. The container holding the pharmaceutical composition may be a multi-purpose vial that allows repeated administration of a reconstituted formulation (e.g., 2-6 administrations). The drug instructions refer to instructions typically included in the commercial packaging of a therapeutic product, which contains information about the indications, usage, dosage, administration, contraindications, and / or warnings of such therapeutic products. In addition, the article may further include a second container containing a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and user perspective, including other buffers, diluents, filters, needles, and syringes.

[0405] The kit or article of manufacture may include multiple unit doses of the pharmaceutical composition and instructions for use, packaged in quantities sufficient for storage and use in pharmacies (eg, hospital pharmacies and compounding pharmacies).

[0406] For the sake of brevity, certain abbreviations are used herein. One example is the use of single-letter abbreviations to represent amino acid residues. The amino acids and their corresponding three-letter and single-letter abbreviations are as follows:

[0407]

[0408] The present disclosure generally uses affirmative language to describe numerous embodiments herein. The present disclosure also specifically includes embodiments of specific subject matter that are excluded in whole or in part, such as substances or materials, method steps and conditions, schemes, procedures, detection or analysis. Therefore, although the present disclosure generally does not state what is not included in the present disclosure, aspects that are not explicitly included in the disclosure are still disclosed herein.

[0409] Some embodiments of the present disclosure have been described. However, it will be appreciated that various modifications may be made without departing from the spirit and scope of the present disclosure. Therefore, the following examples are intended to illustrate but not limit the scope of the disclosure described in the claims.

[0410] 6. Examples

[0411] The following is a description of various methods and materials used in the study, which are provided to provide a person of ordinary skill in the art with a complete disclosure and description of how to make and use the present disclosure, and are not intended to limit the scope of what the inventors consider to be their disclosure, nor to indicate that the following experiments have been performed, and all experiments can be performed. It should be understood that the exemplary descriptions written in the present tense are not necessarily performed, but rather that these descriptions can be performed to generate data, etc., relevant to the teachings of the present disclosure. Efforts have been made to ensure the accuracy of the numbers used (such as amounts, percentages, etc.), but some experimental errors and deviations should be taken into account.

[0412] 6.1. Example 1 - Construction of nucleic acid encoding SMN

[0413] This example illustrates the construction of an exemplary nucleic acid provided herein comprising a first nucleic acid region encoding SMN and a second nucleic acid region comprising a plurality of target segments of a plurality of endogenous microRNAs (miRNAs) (see Figure 1A ).

[0414] Based on the wild-type SMN1 (hSMN1) protein sequence (SEQ ID NO: 33), the coding sequence of human SMN1 was optimized using algorithms and platforms (including GPS technology (Atrum, USA), OptimWiz (Genwiz, USA), OptimumGene (GenScript, USA) and PyCUB (J.Kalfon, 2018)). The wild-type hSMN1 coding sequence (SEQ ID NO: 34) and the codon-optimized hSMN1 coding sequence (e.g., SEQ ID NO: 35) were then cloned into an expression vector containing the optimized promoter sequence (SEQ ID NO: 36 or SEQ ID NO: 37) provided herein. By transcriptome analysis ( Figure 2B), codon optimization increased hSMN1 mRNA expression in vitro, which was consistent with protein expression analysis using Western blot described in more detail below ( Figure 2A In addition, as discussed in more detail below, an increase in median survival of injected animals was observed in in vivo efficacy studies.

[0415] The mRNA transcript of each target segment used in the present nucleic acid construct can be specifically hybridized by tissue-specific endogenous miRNA (e.g., liver-specific miRNA such as hsa-mir-122, and heart-specific endogenous miRNA such as hsa-mir-1-5p, hsa-mir-208a, hsa-mir-208b, hsa-mir-133a, and hsa-mir-448-5p). Exemplary target segments of each of the above miRNAs are shown in Table 2 above. Figure 1B In addition, the sequence of an exemplary second nucleic acid region comprising multiple target segments of multiple endogenous miRNAs is shown in Table 6 below, indicating the constituent target segments of each nucleic acid sequence. Figure 1A , Figure 1B In Table 6, miR-1 represents the target segment of hsa-mir-1-5p, miR-208a represents the target segment of hsa-mir-208a-5p, miR-208b represents the target segment of hsa-mir-208b-5p, miR-122 represents the target segment of hsa-mir-122, miR-133 represents the target segment of hsa-mir-133a-1, and miR-488 represents the target segment of hsa-mir-488-5p. The 5' (left) of these exemplary constructs is suitable for SMN coding sequence and its buffering sequence, and the 3' (right) of these exemplary constructs is suitable for polyA sequence and its buffering sequence. There are joints between some target segments. As shown in the figure, these constructs can have multiple repeat sequences. These sequences are provided as exemplary constructs, and the order of these target segments can be changed and is included in the present disclosure.

[0416] Table 5. Sequences of SMN and promoter

[0417]

[0418]

[0419]

[0420]

[0421] Table 6. Exemplary miRNA sponge regions containing multiple target segments

[0422]

[0423]

[0424] 6.2. Example 2 - Construction of AAV vectors containing nucleic acids

[0425] In this example, the nucleic acid sequence described in Section 6.1 is introduced into an exemplary rAAV vector derived from AAV9 to produce rAAV vectors including, for example, EXG202, EXG204, EXG205, EXG206, EXG207, EXG209, and EXG211, such as Figure 1A The nucleic acid sequences of exemplary rAAV vectors (i.e., EXG204, EXG207, EXG209, and EXG211) are shown in the following table. The target segments in these rAAV vectors are shown in Tables 6 and 7. Table 8 also provides components of exemplary rAAV vectors provided herein.

[0426] Table 7. Exemplary rAVV vectors

[0427]

[0428]

[0429]

[0430]

[0431]

[0432]

[0433]

[0434]

[0435]

[0436]

[0437] Table 8. Components of exemplary rAVV vectors

[0438]

[0439]

[0440] 6.3. Example 3 - Protein expression experiment

[0441] HEK 293 cells were cultured in 12-well plates using DMEM supplemented with 10% fetal bovine serum and incubated at 37°C with 5% CO. 2 Incubate in the incubator for 24 hours before infection. HEK 293 cells were seeded in 12-well plates at 4 × 10 5 cells were cultured in 1 mL DMEM, 10% FBS, and incubated at 37°C, 5% CO 2 Then, HEK 293 cells were incubated with rAAV-SMN (10 5 GC / cell) and human adenovirus 5 (Ad5) helper virus (10 iu / cell) were co-infected and incubated at 37°C with 5% CO 2 Incubate in the incubator for 72 hours. Use normal 293FT cells as blank control. After 72 hours, harvest the cells, wash with PBS, centrifuge into pellets, and lyse in cell lysis buffer. According to the total protein concentration calculated by BCA assay, samples containing equal amounts of protein (1.25ug per sample) were separated by 4%-12% Bis-Tris gel electrophoresis as recommended by the manufacturer (Invitrogen), and then transferred to nitrocellulose membranes at 25V for 7 minutes using a Power Blotter workstation and probed with SMN antibody and tubulin antibody.

[0442] The rAAV vectors tested in this example are shown in Table 8 above. For example, EXG101-01-03 comprises a promoter sequence (SEQ ID NO: 35) driving an hSMN1 sequence (SEQ ID NO: 36); EXG101-05M comprises a promoter sequence (SEQ ID NO: 35) driving an hSMN1 sequence (SEQ ID NO: 37); EXG101-02M comprises a promoter sequence (SEQ ID NO: 34) driving an hSMN1 sequence (SEQ ID NO: 37); and

[0443] EXG101-01M2 contains a hSMN1 sequence (SEQ ID NO: 36) driven by a promoter sequence (SEQ ID NO: 34).

[0444] The expression intensity was measured by the ratio of SMN / tubulin, and the results were as follows Figure 2A shown.

[0445] 6.4. Example 4 - In vivo efficacy test

[0446] The constructs provided herein were tested and analyzed in an in vivo efficacy assay by treating P0-2 year old mice with spinal muscular atrophy (SMA) that have biallelic mutations in the survival motor neuron 1 (smn1) gene. In vivo efficacy assays refer to rescue experiments in smn1- / - deficient mouse models and measuring median survival and other relevant in vivo parameters such as upright, body weight measurements. The type 1 SMA mouse model is defined by progressive muscle weakness associated with lower motor neuron loss before the ability to independently upright or stand is achieved.

[0447] like Figure 3-6 As shown, mice treated with the constructs of the present disclosure (eg, EXG204) exhibited excellent survival, open field activity comparable to untreated control wild-type mice, and very uniform body weight distribution.

[0448] The results also showed that the target segments of hsa-mir-133a (e.g., in EXG204 and EXG206) were more effective than those of other miRNAs such as hsa-mir-1 and hsa-mir-488a (e.g., in EXG202 and EXG205) (see Figure 6 ). In addition, compared with a single target segment of hsa-mir-133a, multiple repeats of the target segment of hsa-mir-133a, such as 3 repeats, showed better effects, such as comparing EXG204 and EXG206.

[0449] In summary, the rAAV9 viral vector for delivering the smn1 gene disclosed in the present invention was demonstrated to be able to express human SMN1 protein driven by an optimized promoter sequence, and through post-transcriptional regulation of the 3' target sequence of endogenous microRNA, simultaneously achieve (>60% better) tolerable liver toxicity and cardiotoxicity in vivo, and maximize tissue-specific downregulation of SMN1 in the liver and heart.

[0450] 6.5. Example 5 - Constructs containing synthetic promoters

[0451] Various nucleic acid constructs containing synthetic promoters were produced and tested in this study. Specifically, Fig. 7A and Figure 7BAs shown, in some constructs, various enhancers are combined with the core promoter (hSyn). For example, EXG304 contains proC3 enhancer and hSyn promoter; EXG305 contains proB15 enhancer and hSyn promoter; EXG306 contains proA5 enhancer and hSyn promoter; and EXG307 contains CMV enhancer and hSyn promoter; and EXG340 is designed by replacing the SMN1 protein coding sequence with a codon-optimized sequence of human SMN1, while other elements are the same as EXG307. Various enhancers and promoters are shown in Table 9. Figure 7B The sequences of the rAAV vectors shown (i.e., EXG301, EXG302, EXG303, EXG304, EXG305, EXG306, and EXG307), and the sequences of EXG340 and EXG341 are shown in Table 10 below.

[0452] Table 9. Core promoter and enhancer sequences

[0453]

[0454]

[0455]

[0456]

[0457] Table 10. Exemplary rAAV vectors with various promoters

[0458]

[0459]

[0460]

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

[0469]

[0470]

[0471]

[0472] The in vivo efficacy assay described in Example 4 was used to examine the various constructs described above with different promoters, with a single intravenous injection at a dose level of 1.98×10 14 or 3.96 × 10 14 vg / kg. Fig. 8A and Figure 8B As shown in Figure 3, EXG303, EXG307, and EXG340 showed dose-related improvements in survival. Although all candidate EXGs consistently showed therapeutic effects compared to the GFP control, EXG100-07 and EXG-307 performed significantly better than EXG301, EXG204, and EXG101-01. Surprisingly, when constructs containing different synthetic promoters were expressed at 3.96 × 10 14 When injected intravenously at a dose level of 100 vg / kg per single dose, constructs EXG307 and EXG340 containing synthetic promoters showed significant survival improvements compared to other promoters, including other promoters such as EXG-304, EXG-305, and EXG-306. These results demonstrate the superior efficacy of certain specific combinations of specific enhancers with specific core promoters, such as the CMV enhancer with the hSyn promoter, particularly for use with SMN1 in AAV vector-mediated gene therapy.

[0473] The teachings of all patents, published applications, and references cited herein are incorporated by reference in their entirety.

[0474] While exemplary embodiments have been particularly shown and described, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the embodiments as encompassed by the following claims.

[0475] In summary, it will be appreciated that, although specific embodiments have been described herein for purposes of illustration, various modifications may be made without departing from the spirit and scope provided herein. All of the above references are incorporated herein by reference in their entirety. SEQUENCE LISTING <110> Hangzhou Jiayin Biotechnology Co., Ltd. <120> Nucleic acid constructs and their use in treating spinal muscular atrophy <130> 14652-017-228 <140> <141> <150> PCT / CN2020 / 138056 <151> 2020-12-21 <150> PCT / CN2020 / 107173 <151> 2020-08-05 <160> 53 <170> PatentIn version 3.5 <210> 1 <211> 71 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1-5p <400> 1 ugggaaacau acuucuuuau augcccauau ggaccugcua agcuauggaa uguaaagaag 60 uauguaucuc a 71 <210> 2 <211> 71 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-208a-5p <400> 2 ugacgggcga gcuuuuggcc cggguuauac cugaugcuca cguauaagac gagcaaaaag 60 cuuguugguc a 71 <210> 3 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-208b-5p <400> 3 ccucucaggg aagcuuuuug cucgaauuau guuucugauc cgaauauaag acgaacaaaa 60 gguuugucug agggcag 77 <210> 4 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-122 <400> 4 ccuuagcaga gcuguggagu gugacaaugg uguuuguguc uaaacuauca aacgccauua 60 ucacacuaaa uagcuacugc uaggc 85 <210> 5 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-133a-1 <400> 5 acaaugcuuu gcuagagcug guaaaaugga accaaaucgc cucuucaaug gauuuggucc 60 ccuucaacca gcuguagcua ugcauuga 88 <210> 6 <211> 83 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-488-5p <400> 6 gagaaucauc ucucccagau aauggcacuc ucaaacaagu uuccaaauug uuugaaaggc 60 uauuucuugg ucagaugacu cuc 83 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Target segment of hsa-miR-1-5p <400> 7 atgggcatat aaagaagtat gt 22 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Target segment of hsa-mir-208a-5p <400> 8 gtataacccg ggccaaaagc tc 22 <210> 9 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Target segment of hsa-mir-208b-5p <400> 9 acataattcg agcaaaaagc t 21 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Target segment of hsa-mir-122 <400> 10 caaacaccat tgtcacactc ca 22 <210> 11 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Target segment of hsa-mir-133a-1 <400> 11 cagctggttg aaggggacca aa 22 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Target segment of hsa-mir-488-5p <400> 12 ttgagagtgc cattatctgg g 21 <210> 13 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> EXG-Link01 <400> 13 cttgac 6 <210> 14 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> EXG-Link02 <400> 14 ccatag 6 <210> 15 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> EXG-Link03 <400> 15 tttcta 6 <210> 16 <211> 6 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <223> EXG-Link04 <400> 16 caagct <210> 17 <211> 6 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <223> EXG-Link05 <400> 17 gatcta <210> 18 <211> 486 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <223> miRNA promoter-1x hsa-mir-1; 2x hsa-mir-208a; 3x hsa-mir-208b; 3x hsa-mir-122 (as in EXG202) <400> 18 ttgaatgagg cttcagtact ttacagaatc gttgcctgca catcttgga acacttgctg ggattacttc ttcaggttaa cccaacagaa ggctcgagaa ggtatattgc tgttgacagt 180. gagcgctaca tacttcttta tatgcccatg tgaagccaca gatgatgggc father gtatgtattg cctactgcct cggaattcaa ggggctactt taggcaat tatcttgttt actaaaactg aataccttgc tatctctttg atacattttt acaaagctga attaaaatgg 300 tataaattaa atcacttttt tctagtataa cccgggccaa aagctcagta taacccgggc 360 caaaagctcg acataattcg agcaaaaagc taacataatt cgagcaaaaa gctcttgaca 420 aacaccattg tcacactcca acaaacacca ttgtcacact ccaacaaaca ccattgtcac 480 actcca 486 <210> 19 <211> 237 <212> DNA <213> Artificial Sequence <220> <223> miRNA sponge region - 2x hsa - mir - 208a; 2x hsa - mir - 208b; 3x hsa - mir - 122; 3x hsa - mir - 133a (as in EXG204) <400> 19 gtataacccg ggccaaaagc tcagtataac ccgggccaaa agctcgacat aattcgagca 60 aaaagctaac ataattcgag caaaaagctc ttgacaaaca ccattgtcac actccaacaa 120 acaccattgt cacactccaa caaacaccat tgtcacactc caccatagac agctggttga 180 aggggaccaa aacagctggt tgaaggggac caaaacagct ggttgaaggg gaccaaa 237 <210> 20 <211> 258 <212> DNA <213> Artificial Sequence <220> <223> miRNA Sponge Region - 2x hsa-mir-208a; 2x hsa-mir-208b; 3x hsa-mir-122; 2x hsa-mir-488; 2x hsa-mir-1 (as in EXG205) <400> 20 gtataacccg ggccaaaagc tcagtataac ccgggccaaa agctcgacat aattcgagca 60 aaaagctaac ataattcgag caaaaagctc ttgacaaaca ccattgtcac actccaacaa 120 acaccattgt cacactccaa caaacaccat tgtcacactc caccatagat tgagagtgcc 180 attatctggg attgagagtg ccattatctg ggaatgggca tataaagaag tatgtaatgg 240 gcatataaag aagtatgt 258 <210> 21 <211> 486 <212> DNA <213> Artificial Sequence <220> <223> miRNA Sponge Region - 1x hsa-mir-133a; 2x hsa-mir-208a; 2x hsa-mir-208b; 3x hsa-mir-122 (as in EXG206) <400> 21 ttgaatgagg cttcagtact ttacagaatc gttgcctgca catcttggaa acacttgctg 60 ggattacttc ttcaggttaa ccaacagaa ggctcgagaa ggtatattgc tgttgacagt 120 gagcgcttt ggtccccttc aaccagctgg tgaagccaca gatgcagctg gttgaagggg 180 accaaaattg cctactgcct cggaattcaa ggggctactt taggagcaat tatcttgttt 240 actaaaactg aataccttgc tatctctttg atacattttt acaaagctga attaaaatgg 300 tataaattaa atcacttttt tctagtataa cccgggccaa aagctcagta taacccgggc 360 caaaagctcg acataattcg agcaaaaagc taacataatt cgagcaaaaa gctcttgaca 420 aacaccattg tcacactcca acaaacacca ttgtcacact ccaacaaaca ccattgtcac 480 actcca 486 <210> 22 <211> 2596 <212> DNA <213> Artificial Sequence <220> <223> EXG204-LmiR122-HmiR133 <400> 22 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc cgggcgtcg ggcgacctt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatg cacgcgtgga 120 tctgagttca attcacgcgt ggtacccgtt acataactta cggtaaatgg cccgcctggc 180 tgaccgccca acgacccccg cccattgacg tcaatagtaa cgccaatagg gactttccat 240 tgacgtcaat gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat 300 catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattgt 360 gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc 420 gctattacca tggtcgaggt gagccccacg ttctgcttca ctctccccat ctcccccccc 480 tccccacccc caattttgta tttatttatt ttttaattat tttgtgcagc gatgggggcg 540 gggggggggg ggggggcgcg gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 600 aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tcctttatg 660 gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc gggagtcgct 720 gcgacgctgc cttcgccccg tgccccgctc cgccgccgcc tcgcgccgcc cgccccggct 780 ctgactgacc gcgttactcc cacaggtgag cgggcgggac ggcccttctc ctccgggctg 840 taattagctg agcaagaggt aagggtta gggatggttg gttggtgggg tattaatgtt 900 taattacctg gagcacctgc ctgaaatcac tttttcag gattcccgg gatatcgtcg 960 acccacgcgt ccgggcccca cgctgcgcac ccgcggtttt gctatggcga tgagcagcgg 1020 cggcagtggt ggcggcgtcc cggagcagga ggattccgtg ctgttccggc gcggcacagg 1080 ccagagcgat gattctgaca ttgggatga tacagcactg aaaagcat atgataaagc 1140 tgtggcttca tttaagcatg ctctaaagaa tggtgacatt tgtgaactt cgggtaaacc 1200 aaaaaccaca cctaaaagaaaacctgctaa gagaataa agccaaaga agaatactgc 1260 agctcctta cacagtgga aagttgggga caatgttct gccattggt cagaagacgg 1320 ttgcatttac ccagctacca ttgctcaat tgatttaag agagaaacct gtgttgtggt 1380 ttacactgga tatggaata gagaggagca aaatctgtcc gatctacttt cccaatctg 1440 tgaagtagct aaatatatag aacagaatgc tcaagagaat gaaatgaaa gccaagtttc 1500 aacagatgaa agtgagaact cccaggctcc tggaaataa tcagataca tcaagcccaa 1560 atctgctcca tggaactctt ttctccctcc accacccccc atgccagggc caagactggg 1620 accaggaaag ccaggtctaa aattcaatgg cccaccaccg ccaccgccac caccaccacc 1680 ccacttacta tcatgctggc tgcctccatt tccttctgga ccaccaataa ttcccccacc 1740 acctcccata tgtccagatt ctcttgatga tgctgatgct ttgggaagta tgttaatttc 1800 atggtacatg agtggctatc atactggcta ttatatgggt tttagacaaa atcaaaaaga 1860 aggaaggtgc tcacattcct taaattaagg agaaatgctg gcatagagca gcactaaatg 1920 acaccactaa agaaacgatc agacagatct agtataaccc gggccaaaag ctcagtataa 1980 cccgggccaa aagctcgaca taattcgagc aaaaagctaa cataattcga gcaaaaagct 2040 cttgacaaac accattgtca cactccaaca aacaccattg tcacactcca acaaacacca 2100 ttgtcacact ccaccataga cagctggttg aaggggacca aaacagctgg ttgaagggga 2160 ccaaaacagc tggttgaagg ggaccaaaca agcttatcga taccgtcgac tagagctcgc 2220 tgatcagcct cgactgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg 2280 ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt 2340 gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc 2400 aagggggagg attgggaagt ctagagcagg catgctgggg agagatcgat ctgaggaacc 2460 cctagtgatg gagttggcca ctccctctct gcgcgctcgc tcgctcactg aggccgggcg 2520 accaaaggtc gcccgacgcc cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg 2580 cagagaggga gtggcc 2596 <210> 23 <211> 2595 <212> DNA <213> Artificial Sequence <220> <223> EXG207-LmiR122-HmiR133 <400> 23 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatg cacgcgtgga 120 tctgagttca attcacgcgt ggtacctctg gtcgttacat aacttacggt aaatggcccg 180 cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata 240 gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc 300 cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac 360 ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg 420 cagtacatct actcgaggcc acgttctgct tcactctccc catctccccc ccctccccac 480 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 540 ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 600 gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 660 ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagcg ggatcagcca 720 ccgcggtggc ggcctagagt cgacgaggaa ctgaaaaacc agaaagttaa ctggtaagtt 780 tagtcttttt gtcttttatt tcaggtcccg gatccggtgg tggtgcaaat caaagaactg 840 ctcctcagtg gatgttgcct ttacttctag gcctgtacgg aagtgttact tctgctctaa 900 aagctgcgga attgtacccg cggccgatcc accggtccgg aattcccggg atatcgtcga 960 cccacgcgtc cgggccccac gctgcgcacc cgcgggttg ctaggccat gagcagcgga 1020 ggaagcggag gaggagtgcc cgaghaagg ggagcgtgc tgtttaggag aggaaccgga 1080 cagagcgatg actccgatat ctgggacgac accgctctga tcaggccta tgacaagcc 1140 gtggcctcct tcaagcacgc tctgagaat gtgagacctc cggcaacct 1200 aagaccacccc ccagaggaa gccccccag aagaacaagt ccagagaa gatacccgcc 1260 gctagcctcc agcagtgga agtgggcgat aagtgcagcg ccattggag cgaggatgga 1320 tgcatctacc ccgccaccat tgccagcatc gacttcaaga gggagacatg cgtggtggtg 1380 tataccggat acggaatag agaggagcag aatctgagcg atctgctgtc cccatctgc 1440 gaggtggcca attatatcga gcagaacgcc caagagaacg aggaacgaag ccaagtgtcc 1500 accgatgaga gcgagaactc cagaagcccc ggaacaagt ccgacaacat caacccaag 1560 agccgcccctt ggaacagctt tctgccct cccccccca tgcccggccc tagactggga 1620 cccggcaagc ccggactgaa gttcaacgga cccccccctc ctcccccccccccccctcct 1680 catctgctga gctgctggct cccccctttc cctagcggcc cccccattat ccccccccct 1740 ccccctatct gtcccgacag cctcgatgac gctgacgccc tcggaagcat gctgatcagc 1800 tggtacatga gcggctacca caccggatac tacatgggct tcagacagaa ccagaaggag 1860 ggcagatgct cccactctct gaactgagga gaaatgctgg catagagcag cactaaatga 1920 caccactaaa gaaacgatca gacagatcta gtataacccg ggccaaaagc tcagtataac 1980 ccgggccaaa agctcgacat aattcgagca aaaagctaac ataattcgag caaaaagctc 2040 ttgacaaaca ccattgtcac actccaacaa acaccattgt cacactccaa caaacaccat 2100 tgtcacactc caccatagac agctggttga aggggaccaa aacagctggt tgaaggggac 2160 caaaacagct ggttgaaggg gaccaaacaa gcttatcgat accgtcgact agagctcgct 2220 gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc 2280 cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg 2340 catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca 2400 agggggagga ttgggaagtc tagagcaggc atgctgggga gagatcgatc tgaggaaccc 2460 ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga 2520 ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc 2580 agagagggag tggcc 2595 <210> 24 <211> 2595 <212> DNA <213> Artificial Sequence <220> <223> EXG209-LmiR122-HmiR133 <400> 24 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatt cacgcgtgga 120 tctgaattca attcacgcgt ggtacctctg gtcgttacat aacttacggt aaatggcccg 180 cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata 240 gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc 300 cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac 360 ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg 420 cagtacatct actcgaggcc acgttctgct tcactctccc catctccccc ccctccccac 480 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 540 ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 600 gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 660 ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagcg ggatcagcca 720 ccgcggtggc ggcctagagt cgacgaggaa ctgaaaaacc agaaagttaa ctggtaagtt 780 tagtcttttt gtcttttatt tcaggtcccg gatccggtgg tggtgcaaat caaagaactg 840 ctcctcagtg gatgttgcct ttacttctag gcctgtacgg aagtgttact tctgctctaa 900 aagctgcgga attgtacccg cggccgatcc accggtccgg aattcccggg atatcgtcga 960 cccacgcgtc cgggccccac gctgcgcacc cgcgggtttg ctatggcgat gagcagcggc 1020 ggcagtggtg gcggcgtccc ggagcaggag gattccgtgc tgttccggcg cggcacaggc 1080 cagagcgatg attctgacat ttgggatt acagcactga taaaagcata tgataaagct 1140 gtggcttcat ttaagcatgc tctaaagaat ggtgacattt gtgaaacttc gggtaaacca 1200 aaaaccacac ctaaaagaaa acctgctaag aagaataaa gccaaaagaa gatactgca 1260 gcttccttac aacagtggaa agttggggac aaatgttctg ccattggtc agaagacggt 1320 tgcatttacc cagctaccat tgctcaat gattttaaga gagaaacctg tgttgtggtt 1380 tacactggat atggaatag agaggagcaa aatctgtccg atctactttc cccaatctgt 1440 gagtagcta attatataga acagaatgct cagagaatg aaatgaag ccaagtttca 1500 acagatgaaa gtgagaactc caggtctcct ggaataat cagatacaat caagcccaa 1560 tctgctccat ggaactcttt tctccctcca ccacccca tgccaggcc aagactggga 1620 sccaggaaagc caggtctaaa attcaatggc sccaccggc sccaccsssssssssssssss 1680 cacttactat catgctggct gcctccattt ccttctggac caccaataat tccccacca 1740 cctcccatat gtccagattc tcttgat gctgatgctt tgggagtat gttaatttca 1800 tggtacatga gtggctatca tactggctat tatatgggtt ttagacaaaa tcaaaaagaa 1860 ggaaggtgct cacattcctt aaattaagga gaaatgctgg catagagcag cactaaatga 1920 caccactaaa gaaacgatca gacagatcta gtataacccg ggccaaaagc tcagtataac 1980 ccgggccaaa agctcgacat aattcgagca aaaagctaac ataattcgag caaaaagctc 2040 ttgacaaaca ccattgtcac actccaacaa acaccattgt cacactccaa caaacaccat 2100 tgtcacactc caccatagac agctggttga aggggaccaa aacagctggt tgaaggggac 2160 caaaacagct ggttgaaggg gaccaaacaa gcttatcgat accgtcgact agagctcgct 2220 gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc 2280 cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg 2340 catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca 2400 agggggagga ttgggaagtc tagagcaggc atgctgggga gagatcgatc tgaggaaccc 2460 ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga 2520 ccaaaggtcg cccgacgcc gggctttgcc cgggcggcct cagtgagcga gcgagcgc 2580 agagaggag tggcc 2595 <210> 25 <211> 2594 <212> DNA <213> Artificial Sequence <220> <223> EXG211-LmiR122-HmiR133 <400> 25 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc cgggcgtcg ggcgacctt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatg cacgcgtgga 120 tctgagttca attcacgcgt ggtacccgtt acataactta cggtaaatgg cccgcctggc 180 tgaccgccca acgacccccg cccattgacg tcaatagtaa cgccaatagg gactttccat 240 tgacgtcaat gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat 300 catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattgt 360 gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc 420 gctattacca tggtcgaggt gagccccacg ttctgcttca ctctccccat ctcccccccc 480 tccccacccc caatttgta tttatttatt ttttaattat ttgtgcagc gatgggggcg 540 gggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 600 aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tccttttatg 660 gcgaggcggc ggcggcggcg gcctataaa aagcgaagcg cgcggcggc gggagtcgct 720 gcgacgctgc cttcgcccg tgcccgctc cgcgcgc tcgcgcgcc cgcccggct 780 ctgactgacc gcgttactcc cacaggtgag cgggcgggac ggccctctc ctccgggctg 840 taattagctg agcaagaggt aagggtttaa gggatggttg gttggtgggg tattaatgtt 900 taattacctg gagcacctgc ctgaaatcac ttttttcag gaattcccgg gatatcgtcg 960 acccacgcgt ccgggcccca cgctgcgcac ccggggccac catggccatg agcagcggag 1020 gaagcggagg aggagtgccc gagcaagagg acagcgtgct gtttaggaga ggaaccggac 1080 agagcgatga ctccgatatc tgggacgaca ccgctctgat caaggcctat gacaaagccg 1140 tggcctcctt caagcacgct ctgaagaatg gcgatatctg tgagacctcc ggcaaaccta 1200 agaccacccc caagagaag cccgccaaga agaacaagtc ccagaagaag aataccgccg 1260 ctagcctcca gcagtggaaa gtgggcgata agtgcagcgc catttggagc gaggatggat 1320 gcatctaccc cgccaccatt gccagcatcg acttcaagag ggagacatgc gtggtggtgt 1380 ataccggata cggaatagagaggaggaga atctgagcga tctgctgtcc cccatctgcg 1440 aggtggccaa tatatcgag cagaacgccc aagagaacga gaacgaaagc caagtgtcca 1500 ccgatgagag cgagaactcc agaagccccg gaacaagtc cgacaacacatc aacccaaga 1560 gcgccccttg gaacagcttt ctgcctcctc ccccccccat gcccggccct agactgggac 1620 ccggcaagcc cggactgaag ttcaacggac cccccccctcc tcctcccccc cctcctcctc 1680 atctgctgag ctgctggctc ccccctttcc ctagcggccc ccccattatc cccccccctc 1740 cccctatctg tcccgacagc ctcgatgacg ctgacgccct cggaagcatg ctgatcagct 1800 ggtacatgag cggctaccac accggatact acatgggctt cagagaac cagaaggagg 1860 gcagatgctc ccactctctg aactgaggag aaatgctggc atagagcagc actaaatgac 1920 accactaag aaacgatcag acgatctag tataacccgg gccaaaagct cagtataacc 1980 cgggccaaaa gctcgacata attcgagca aaagctaca taattcgagc aaaaagctct 2040 tgacaacac cattgtcaca ctccacaaa caccattgtc acacccac aaacaccatt 2100 gtcacactcc accatagaca gctggttgaa ggggaccaaa acagctggtt gaaggggacc 2160 aaaacagctg gttgaagggg accaacaag cttatcgata ccgtcgacta gagctcgctg 2220 atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgccct cccccgtgcc 2280 ttccttgacc ctggaaggtg ccactcccac tgtccttcc tataaaatg aggaaattgc 2340 atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa 2400 gggggaggat tgggagtct agagcaggca tgctgggag agatcgatct gaggaacccc 2460 tagtgatgga gttggccact cccctctgc gcgctcgctc gctcactgag gccgggcgac 2520 caaagtcgc ccgacgcccg ggctttgccc gggcggcccc agtgagcgag cgagcgcgca 2580 Gagaggt ggcc 2594 <210> 26 <211> 735 <212> PRT <213> Artificial Sequence <220> <223> AAV2 (UniProt: P03135-1) <400> 26 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser 1 5 10 15 Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro 20 25 30 Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser Gly Thr Gly 145 150 155 160 Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln Pro Pro 180 185 190 Ala Ala Pro Ser Gly Leu Gly Thr Asn Thr Met Ala Thr Gly Ser Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn His Tyr 260 265 270 Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His 275 280 285 Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp 290 295 300 Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val 305 310 315 320 Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu 325 330 335 Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr 340 345 350 Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp 355 360 365 Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser 370 375 380 Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser 385 390 395 400 Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu 405 410 415 Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg 420 425 430 Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr 435 440 445 Asn Thr Pro Ser Gly Thr Thr Thr Gln Ser Arg Leu Gln Phe Ser Gln 450 455 460 Ala Gly Ala Ser Asp Ile Arg Asp Gln Ser Arg Asn Trp Leu Pro Gly 465 470 475 480 Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Ser Ala Asp Asn Asn 485 490 495 Asn Ser Glu Tyr Ser Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly 500 505 510 Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys Asp 515 520 525 Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val Leu Ile Phe Gly Lys 530 535 540 Gln Gly Ser Glu Lys Thr Asn Val Asp Ile Glu Lys Val Met Ile Thr 545 550 555 560 Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr 565 570 575 Gly Ser Val Ser Thr Asn Leu Gln Arg Gly Asn Arg Gln Ala Ala Thr 580 585 590 Ala Asp Val Asn Thr Gln Gly Val Leu Pro Gly Met Val Trp Gln Asp 595 600 605 Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr 610 615 620 Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys 625 630 635 640 His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn 645 650 655 Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe Ala Ser Phe Ile Thr Gln 660 665 670 Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys 675 680 685 Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr 690 695 700 Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr Asn Gly Val Tyr 705 710 715 720 Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735 <210> 27 <211> 738 <212> PRT <213> Artificial Sequence <220> <223> AAV8 (Uniprot Q8JQF8_9VIRU) <400> 27 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Gln Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile 145 150 155 160 Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln 165 170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro 180 185 190 Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ala Ala Gly Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser 210 215 220 Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val 225 230 235 240 Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245 250 255 Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ala Thr Asn Asp 260 265 270 Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn 275 280 285 Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn 290 295 300 Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser Phe Lys Leu Phe Asn 305 310 315 320 Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala 325 330 335 Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln 340 345 350 Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe 355 360 365 Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn 370 375 380 Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr 385 390 395 400 Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Thr Tyr 405 410 415 Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser 420 425 430 Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu 435 440 445 Ser Arg Thr Gln Thr Thr Gly Gly Thr Ala Asn Thr Gln Thr Leu Gly 450 455 460 Phe Ser Gln Gly Gly Pro Asn Thr Met Ala Asn Gln Ala Lys Asn Trp 465 470 475 480 Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Gly 485 490 495 Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Ala Gly Thr Lys Tyr His 500 505 510 Leu Asn Gly Arg Asn Ser Leu Ala Asn Pro Gly Ile Ala Met Ala Thr 515 520 525 His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Asn Gly Ile Leu Ile 530 535 540 Phe Gly Lys Gln Asn Ala Ala Arg Asp Asn Ala Asp Tyr Ser Asp Val 545 550 555 560 Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr 565 570 575 Glu Glu Tyr Gly Ile Val Ala Asp Asn Leu Gln Gln Gln Asn Thr Ala 580 585 590 Pro Gln Ile Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val 595 600 605 Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile 610 615 620 Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe 625 630 635 640 Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val 645 650 655 Pro Ala Asp Pro Pro Thr Thr Phe Asn Gln Ser Lys Leu Asn Ser Phe 660 665 670 Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu 675 680 685 Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr 690 695 700 Ser Asn Tyr Tyr Lys Ser Thr Ser Val Asp Phe Ala Val Asn Thr Glu 705 710 715 720 Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg 725 730 735 Asn Leu <210> 28 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> AAVrh8 (Uniprot Q808Y3_9VIRU) <400> 28 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn 260 265 270 Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn 370 375 380 Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr 405 410 415 Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val 435 440 445 Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser 450 455 460 Gln Ala Gly Pro Ser Ser Met Ala Asn Gln Ala Arg Asn Trp Val Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Asn 485 490 495 Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn 500 505 510 Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys 515 520 525 Asp Asp Asp Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly 530 535 540 Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile 545 550 555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu 565 570 575 Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln 580 585 590 Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln 595 600 605 Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700 Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735 <210> 29 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> AAV9 (Uniprot Q6JC40_9VIRU) <400> 29 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735 <210> 30 <211> 738 <212> PRT <213> Artificial Sequence <220> <223> AAVrh10 (Uniprot Q808W5_9VIRU) <400> 30 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile 145 150 155 160 Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln 165 170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro 180 185 190 Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser 210 215 220 Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val 225 230 235 240 Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245 250 255 Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp 260 265 270 Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn 275 280 285 Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn 290 295 300 Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn 305 310 315 320 Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala 325 330 335 Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln 340 345 350 Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe 355 360 365 Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn 370 375 380 Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr 385 390 395 400 Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr 405 410 415 Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser 420 425 430 Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu 435 440 445 Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu 450 455 460 Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp 465 470 475 480 Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser 485 490 495 Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His 500 505 510 Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr 515 520 525 His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met 530 535 540 Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val 545 550 555 560 Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr 565 570 575 Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala 580 585 590 Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val 595 600 605 Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile 610 615 620 Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe 625 630 635 640 Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val 645 650 655 Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe 660 665 670 Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu 675 680 685 Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr 690 695 700 Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp 705 710 715 720 Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg 725 730 735 Asn Leu <210> 31 <211> 735 <212> PRT <213> Artificial Sequence <220> <223> AAV2v <400> 31 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser 1 5 10 15 Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro 20 25 30 Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser Gly Thr Gly 145 150 155 160 Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln Pro Pro 180 185 190 Ala Ala Pro Ser Gly Leu Gly Thr Asn Thr Met Ala Thr Gly Ser Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn His Tyr 260 265 270 Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His 275 280 285 Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp 290 295 300 Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val 305 310 315 320 Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu 325 330 335 Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr 340 345 350 Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp 355 360 365 Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser 370 375 380 Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser 385 390 395 400 Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu 405 410 415 Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg 420 425 430 Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Phe Leu Ser Arg Thr 435 440 445 Asn Thr Pro Ser Gly Thr Thr Thr Gln Ser Arg Leu Gln Phe Ser Gln 450 455 460 Ala Gly Ala Ser Asp Ile Arg Asp Gln Ser Arg Asn Trp Leu Pro Gly 465 470 475 480 Pro Cys Tyr Arg Gln Gln Gly Val Ser Lys Val Ser Ala Asp Asn Asn 485 490 495 Asn Ser Glu Phe Ser Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly 500 505 510 Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys Asp 515 520 525 Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val Leu Ile Phe Gly Lys 530 535 540 Gln Gly Ser Glu Lys Thr Asn Val Asp Ile Glu Lys Val Met Ile Thr 545 550 555 560 Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr 565 570 575 Gly Ser Val Ser Thr Asn Leu Gln Ser Gly Asn Thr Gln Ala Ala Thr 580 585 590 Ala Asp Val Asn Thr Gln Gly Val Leu Pro Gly Met Val Trp Gln Asp 595 600 605 Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr 610 615 620 Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys 625 630 635 640 His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn 645 650 655 Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe Ala Ser Phe Ile Thr Gln 660 665 670 Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys 675 680 685 Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr 690 695 700 Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr Asn Gly Val Tyr 705 710 715 720 Ser Glu Pro Arg Pro Ile Gly Thr Arg Phe Leu Thr Arg Asn Leu 725 730 735 <210> 32 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> AAV44-9 <400> 32 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn 260 265 270 Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn 370 375 380 Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr 405 410 415 Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val 435 440 445 Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser 450 455 460 Gln Ala Gly Pro Ser Asn Met Ala Ser Gln Ala Arg Asn Trp Val Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Asn 485 490 495 Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn 500 505 510 Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly 530 535 540 Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile 545 550 555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu 565 570 575 Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln 580 585 590 Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln 595 600 605 Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700 Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735 <210> 33 <211> 294 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of SMN protein (wt) <400> 33 Met Ala Met Ser Ser Gly Gly Ser Gly Gly Gly Val Pro Glu Gln Glu 1 5 10 15 Asp Ser Val Leu Phe Arg Arg Gly Thr Gly Gln Ser Asp Asp Ser Asp 20 25 30 Ile Trp Asp Asp Thr Ala Leu Ile Lys Ala Tyr Asp Lys Ala Val Ala 35 40 45 Ser Phe Lys His Ala Leu Lys Asn Gly Asp Ile Cys Glu Thr Ser Gly 50 55 60 Lys Pro Lys Thr Thr Pro Lys Arg Lys Pro Ala Lys Lys Asn Lys Ser 65 70 75 80 Gln Lys Lys Asn Thr Ala Ala Ser Leu Gln Gln Trp Lys Val Gly Asp 85 90 95 Lys Cys Ser Ala Ile Trp Ser Glu Asp Gly Cys Ile Tyr Pro Ala Thr 100 105 110 Ile Ala Ser Ile Asp Phe Lys Arg Glu Thr Cys Val Val Val Tyr Thr 115 120 125 Gly Tyr Gly Asn Arg Glu Glu Gln Asn Leu Ser Asp Leu Leu Ser Pro 130 135 140 Ile Cys Glu Val Ala Asn Asn Ile Glu Gln Asn Ala Gln Glu Asn Glu 145 150 155 160 Asn Glu Ser Gln Val Ser Thr Asp Glu Ser Glu Asn Ser Arg Ser Pro 165 170 175 Gly Asn Lys Ser Asp Asn Ile Lys Pro Lys Ser Ala Pro Trp Asn Ser 180 185 190 Phe Leu Pro Pro Pro Pro Pro Met Pro Gly Pro Arg Leu Gly Pro Gly 195 200 205 Lys Pro Gly Leu Lys Phe Asn Gly Pro Pro Pro Pro Pro Pro Pro Pro 210 215 220 Pro Pro His Leu Leu Ser Cys Trp Leu Pro Pro Phe Pro Ser Gly Pro 225 230 235 240 Pro Ile Ile Pro Pro Pro Pro Pro Ile Cys Pro Asp Ser Leu Asp Asp 245 250 255 Ala Asp Ala Leu Gly Ser Met Leu Ile Ser Trp Tyr Met Ser Gly Tyr 260 265 270 His Thr Gly Tyr Tyr Met Gly Phe Arg Gln Asn Gln Lys Glu Gly Arg 275 280 285 Cys Ser His Ser Leu Asn 290 <210> 34 <211> 882 <212> DNA <213> Artificial Sequence <220> <223> SMN nucleic acid sequence (wt) <400> 34 atggcgatga gcagcggcgg cagtggtggc ggcgtcccgg agcaggagga ttccgtgctg 60 ttccggcgcg gcacaggcca gagcgatgat tctgacattt gggatgatac agcactgata 120 aaagcatatg ataaagctgt ggcttcattt aagcatgctc taaagaatgg tgacatttgt 180 gaaacttcgg gtaaaccaaa aaccacacct aaaagaaaac ctgctaagaa gaataaaagc 240 caaaagaaga atactgcagc ttccttacaa cagtggaaag ttggggacaa atgttctgcc 300 atttggtcag aagacggttg catttaccca gctaccattg cttcaattga ttttaagaga 360 gaaacctgtg ttgtggttta cactggatat ggaaatagag aggagcaaaa tctgtccgat 420 ctactttccc caatctgtga agtagctaat aatatagaac agaatgctca agagaatgaa 480 aatgaaagcc aagtttcaac agatgaaagt gagaactcca ggtctcctgg aaataaatca 540 gataacatca agcccaaatc tgctccatgg aactcttttc tccctccacc accccccatg 600 ccagggccaa gactgggacc aggaaagcca ggtctaaaat tcaatggccc accaccgcca 660 ccgccaccac caccacccca cttactatca tgctggctgc ctccatttcc ttctggacca 720 ccaataattc ccccaccacc tcccatatgt ccagattctc ttgatgatgc tgatgctttg 780 ggaagtatgt taatttcatg gtacatgagt ggctatcata ctggctatta tatgggtttt 840 agacaaaatc aaaaagaagg aaggtgctca cattccttaa at 882 <210> 35 <211> 882 <212> DNA <213> Artificial Sequence <220> <223> Codon-optimized SMN nucleic acid sequence <400> 35 atggccatga gcagcggagg aagcggagga ggagtgcccg agcaagagga cagcgtgctg 60 tttaggagag gaaccggaca gagcgatgac tccgatatct gggacgacac cgctctgatc 120 aaggcctatg acaaagccgt ggcctccttc aagcacgctc tgaagaatgg cgatatctgt 180 gagacctccg gcaacctaa gaccacccc aagaggaagc ccgccaagaa gaacaagtcc 240 cagaagaaga ataccgccgc tagcctccag cagtggaaag tgggcgataa gtgcagcgcc 300 atttggagcg aggatggatg catctacccc gccaccattg ccagcatcga cttcaagagg 360 gagacatgcg tggtggtgta taccggatac ggaatagag aggagcagaa tctgagcgat 420 ctgctgtccc ccatctgcga ggtggccaat atatcgagc agaacgccca agagacgag 480 aacgaaagcc aagtgtccac cgatgagagc gagaactcca gaagccccgg aaacaagtcc 540 ugaracatca aaccagag cgccccttgg aacagctttc tgcctcctcc ccccccatg 600 cccggcccta gactgggacc cggcaagccc ggactgaagt tcaacggacc cccccctcct 660 cctccccccc ctcctcctca tctgctgagc tgctgctcc cccttccc tagcggcccc 720 cccattatcc cccccctcc ccctatctgt cccgacagcc tcgatgacgc tgacgccctc 780 ggaagcatgc tgatcagctg gtacatgagc ggctaccaca ccggatacta catgggctc 840 agacagaacc agaaggagggg cagatgctcc cactctctga ac 882 <210> 36 <211> 850 <212> DNA <213> Artificial Sequence <220> <223> Exemplary promoter sequence (1) <400> 36 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240 catgacctta tgggactttc ctacttggca gtacatctac tcgaggccac gttctgcttc 300 actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 360 ttttgtgcag cgatgggggc gggggggggg ggggggcgcg cgccaggcgg ggcggggcgg 420 ggcgaggggc ggggcggggc gaggcggaga ggtgcggcgg cagccaatca gagcggcgcg 480 ctccgaaagt ttccttttat ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc 540 gcgcggcggg cgggagcggg atcagccacc gcggtggcgg cctagagtcg acgaggaact 600 gaaaaaccag aaagttaact ggtaagttta gtctttttgt cttttatttc aggtcccgga 660 tccggtggtg gtgcaaatca aagaactgct cctcagtgga tgttgccttt acttctaggc 720 ctgtacggaa gtgttacttc tgctctaaaa gctgcggaat tgtacccgcg gccgatccac 780 cggtccggaa ttcccgggat atcgtcgacc cacgcgtccg ggccccacgc tgcgcacccg 840 cgggtttgct 850 <210> 37 <211> 796 <212> DNA <213> Artificial Sequence <220> <223> Exemplary Promoter Sequence (2) <400> 37 ccgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat 60 tgacgtcaat agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac 120 ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg ccccctattg 180 acgtcaatga cggtaaatgg cccgcctggc attgtgccca gtacatgacc ttatgggact 240 ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtc gaggtgagcc 300 ccacgttctg cttcactctc cccatctccc ccccctcccc acccccaatt ttgtatttat 360 ttatttttta attattttgt gcagcgatgg gggcgggggg gggggggggg cgcgcgccag 420 gcggggcggg gcggggcgag gggcggggcg gggcgaggcg gagaggtgcg gcggcagcca 480 atcagagcgg cgcgctccga aagtttcctt ttatggcgag gcggcggcgg cggcggccct 540 ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgac gctgccttcg ccccgtgccc 600 cgctccgccg ccgcctcgcg ccgcccgccc cggctctgac tgaccgcgtt actcccacag 660 gtgagcgggc gggacggccc ttctcctccg ggctgtaatt agctgagcaa gaggtaaggg 720 tttaagggat ggttggttgg tggggtatta atgtttaatt acctggagca cctgcctgaa 780 atcacttttt ttcagg 796 <210> 38 <211> 448 <212> DNA <213> Artificial Sequence <220> <223> Core promoter (hSyn) sequence <400> 38 agtgcaagtg ggttttagga ccaggatgag gcggggtggg ggtgcctacc tgacgaccga 60 ccccgaccca ctggacaagc acccaacccc cattccccaa attgcgcatc ccctatcaga 120 gagggggagg ggaaacagga tgcggcgagg cgcgtgcgca ctgccagctt cagcaccgcg 180 gacagtgcct tcgcccccgc ctggcggcgc gcgccaccgc cgcctcagca ctgaaggcgc 240 gctgacgtca ctcgccggtc ccccgcaaac tccccttccc ggccaccttg gtcgcgtccg 300 cgccgccgcc ggcccagccg gaccgcacca cgcgaggcgc gagatagggg ggcacgggcg 360 cgaccatctg cgctgcggcg ccggcgactc agcgctgcct cagtctgcgg tgggcagcgg 420 aggagtcgtg tcgtgcctga gagcgcag 448 <210> 39 <211> 304 <212> DNA <213> Artificial Sequence <220> <223> CMV enhancer <400> 39 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 300 catg 304 <210> 40 <211> 420 <212> DNA <213> Artificial Sequence <220> <223> ProC3 Enhancer <400> 40 gatgaattcc gccggaaact aggtccggag gactgccgga aacacctgta atcaagccgc 60 cggaaacctg ttgtggccgt atgccggaaa cgtcttaatt ggacgtgccg gaaactcttt 120 taatgagttc gccggaaacc agaccagccg agctgccgga aaccggttat atagaacggc 180 cggaaacggt ccacaggaaa aagccggaaa cacccaaacg gttagcgccg gaaacgactg 240 gggaggacgt gccggaaacg tactatctga agatgccgga aacacttgaa agctccaagc 300 cggaaacggg cccgtgcgga tagccggaaa ctgacggtac acggccgccg gaaacactac 360 ttgtatggta gccggaaact tgggcgtggc tggggccgga aacgctcgag atctgcgatc 420 <210> 41 <211> 450 <212> DNA <213> Artificial Sequence <220> <223> ProA5 enhancer <400> 41 cctggaggcc ttcctggaag aagagatcct ggcaccgcac aaagagaagc acaggctttc 60 cagggctgag gagagggagg tcaagtgagg cccaggtgcc cctgcctgag cctgtgtccc 120 cagaaacctc ctctccctct catcaccccc acatcctccc tgccactccc cgcagctccc 180 tgtggccaag tgcactgcag cactcggctc tgctccacaa acggtctgct ccactccagg 240 aaggccacct cctccccccc cccccacctc cggctgtcac cactcaccgc tctagcctcc 300 agggggtggg gaccccagag ctggacacac cccatcgaag ccccacagct cagccagccg 360 gacagactca cggtcggact caagaccccg gagccctgag gtgggcagcg cgccagggtt 420 cctcgcagcc tcttcaaggt cagtgcaagt 450 <210> 42 <211> 472 <212> DNA <213> Artificial Sequence <220> <223> ProB15 enhancer <400> 42 cagcccccgg gccctcctcc tccctctgcc tttttaaggg acgccctcca gggcgacccc 60 ggagggcgga cttgccaagc tgaagagaat cagtcaaaaa tccgcccaca ggggacacat 120 catttaaata aatgtgtttc tttgcccgaa cagaagttca gataggctcg attatcatta 180 attctgggtt tcacgtaacg agaggaaaca caggttgcaa taaaaataaa aaaatggttt 240 gaaatcaatt ttaactcatt ttgaacgtcc tcacacgttt gacaaaccga tttgtttcag 300 gagacttgct aatatctaaa tcggtgacag ggtgtttgct gtgagtgtgg ctctggaaaa 360 gttattaagc gttataaaaa aaatgatgta atgaaattct aattaatggg agggaagtgc 420 caacaaatca ctccttaaaa tattaacgct atcaaagaac agctggagaa gg 472 <210> 43 <211> 675 <212> DNA <213> Artificial Sequence <220> <223> ProC3 Enhancer <400> 43 gaaacagctg agggtgccca gccggaaact cgaaatcaac gtaggccgga aactattcga 60 tgaattccgc cggaaactag gtccggagga ctgccggaaa cacctgtaat caagccgccg 120 gaaacctgtt gtggccgtat gccggaaacg tcttaattgg acgtgccgga aactctttta 180 atgagttcgc cggaaaccag accagccgag ctgccggaaa ccggttatat agaacggccg 240 gaaacggtcc acaggaaaaa gccggaaaca cccaaacggt tagcgccgga aacgactggg 300 gaggacgtgc cggaaacgta ctatctgaag atgccggaaa cacttgaaag ctccaagccg 360 gaaacgggcc cgtgcggata gccggaaact gacggtacac ggccgccgga aacactactt 420 gtatggtagc cggaaacttg ggcgtggctg gggccggaaa cgctcgagat ctgcgatctg 480 catctcaatt agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact 540 ccgcccagtt ccgcccattc tccgccccat cgctgactaa ttttttttat ttatgcagag 600 gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc 660 ctaggctttt gcaaa 675 <210> 44 <211> 1178 <212> DNA <213> Artificial Sequence <220> <223> EF1a enhancer <400> 44 ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60 ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120 gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180 gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtaagtgcc 240 gtgtgtggtt cccgcgggcc tggcctcttt acgggttatg gcccttgcgt gccttgaatt 300 acttccactg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360 agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420 ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480 tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540 aagatagtct tgtaaatgcg ggccaagatc tgcaca...

Claims

1. A nucleic acid comprising: (i) a nucleic acid region, the nucleic acid region comprising a nucleic acid sequence encoding an SMN protein, wherein the amino acid sequence of the SMN protein is SEQ ID NO: 33; (ii) a synthetic promoter, wherein the synthetic promoter comprises a CMV enhancer and an hSyn promoter, wherein the nucleic acid sequence of the CMV enhancer is SEQ ID NO: 39, and the nucleic acid sequence of the hSyn promoter is SEQ ID NO:

38.

2. The nucleic acid of claim 1, wherein the nucleic acid sequence encoding the SMN protein is shown in SEQ ID NO:

34.

3. An adeno-associated virus (AAV) vector comprising the nucleic acid of claim 1.

4. The adeno-associated virus (AAV) vector of claim 3, wherein the AAV vector is derived from AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, AAV44-9, or a combination thereof.

5. An rAAV vector comprising the nucleic acid sequence shown in SEQ ID NO:

51.

6. A recombinant AAV (rAAV) particle comprising: (a) the nucleic acid of claim 1; and (b) a capsid protein derived from AAV1, AAV2, AAV2i8, AAV3, AAV3-B, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV13, AAV-DJ, AAV LK03, AAVrh74, or AAV44-9.

7. A pharmaceutical composition comprising the nucleic acid of any one of claims 1 to 2, the vector or rAAV vector of any one of claims 3 to 5, or the rAAV particle of claim 6 and a pharmaceutically acceptable excipient.

8. A method for enhancing the expression of SMN protein in cells in vitro, the method comprising contacting the cells with the nucleic acid of claim 1 or 2, the vector or rAAV vector of any one of claims 3 to 5, or the rAAV particle of claim 6.

9. Use of a nucleic acid as claimed in claim 1 or 2, a vector or rAAV vector as claimed in any one of claims 3 to 5, or a rAAV particle as claimed in claim 6 in the preparation of a medicament for treating a disease or condition in a subject, wherein the disease or condition is SMA.

10. The use according to claim 9, wherein the disease or disorder is SMA-I, SMA-II, SMA-III or SMA-IV.

11. The method of claim 9 or 10, wherein the subject is under 2 years old.

Images