A ShN / AINV5-4D gene for regulating plant germination rate and its application

Abstract

The present invention discloses a ShN / AINV5‑4D gene for regulating the germination rate of plants and its application. The nucleotide sequence of the ShN / AINV5‑4D gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. In the early stage of the present invention, a mutant Atinve with delayed seed germination was obtained by screening Arabidopsis mutants. The gene ShN / AINV5‑4D was genetically transformed into the Arabidopsis mutant Atinve using Agrobacterium GV3101 for gene function verification, and three strains, namely, complement strains #1, #8, and #16, were obtained. Through seed germination tests, it was found that ShN / AINV5‑4D can promote seed germination and increase the germination rate of seeds.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a ShN / AINV5-4D gene for regulating plant germination rate and an application thereof. Background Art

[0002] Seeds are specialized reproductive organs of gymnosperms and angiosperms. Seed germination is a crucial developmental event in the life cycle of seed plants, marking the beginning of a new life cycle and determining when a plant enters a natural or agricultural ecosystem. Under natural conditions, to withstand adverse growth conditions, seeds regulate their dormancy by altering their metabolic processes, initiating the physiological process of seed germination at the appropriate time and under appropriate environmental conditions. Premature and viable seed germination significantly influences the yield and quality of the plant's later fruiting. Therefore, seed germination is closely linked to crop yield and economic returns, and is of vital importance to agricultural production.

[0003] Seed germination can be divided into three main phases based on the water absorption process: the water absorption phase, the lag phase, and the re-water absorption phase. Seed germination involves multiple biological changes, including DNA repair, mitochondrial biogenesis, mRNA synthesis, protein synthesis and degradation, and post-translational modification. Studies have shown that expression of the AtINV gene in Arabidopsis is associated with the growth and development of floral organs and seeds. Increased cell wall invertase activity in Arabidopsis accelerates flowering and increases seed yield by nearly 30%. Inhibiting N / AINV gene expression in tobacco leads to impaired pollen development and male sterility. Inhibiting INVINH1 in tomato enhances INV activity, delays leaf senescence, and increases seed and fruit yield. Summary of the Invention

[0004] The purpose of the present invention is to deeply explore the gene function of ShN / AINV5-4D gene in seed germination, so as to provide important guiding significance for breeding varieties with high seed germination rate using modern biotechnology.

[0005] The present invention provides a ShN / AINV5-4D gene for regulating plant germination rate, the nucleotide sequence of which is shown in SEQ ID NO.1, specifically:

[0006] ATGGGAATCGCGGAGGTGGCTCTCCACACCATGCCGGGGGCGCTCACCACCCACTCCCCGGCATCC

[0007] ATTCTGTCCCTCAGGGCAGTCGCTAGGAGGAGGAACAGGAACACCAATGCGGTGCCCAACGTCAG

[0008] GGCACTGCAAGGCCTCCTAAGGATCCCGAGGCTGAGGTCCGTCAGGCGGCTGTGCCAGCGGATCG

[0009] ATGACCTTGCGAGGGTCACAGAGGGGAACGGGACTTGGGTCAAGGATGCCATGAATAGCGCCGGC

[0010] CAGGTTCTTGGCGACGTCAGCGTGCCTGGTCAGGCTGTAGGTGGCAATGGTGGTCTAAATGGGAGT

[0011] GCTGCCAAGCCTCCACCTCAAAGGCGGAAGTCCTCATCGGTTGAGGATGAGGCCTGGGAACTTCTG

[0012] CAAGAGTCAATGGTTTACTATTGTGGTAGTCCTGTTGGGACCATTGCAGCCAACGATCCAAATGACA

[0013] GTGACCCGGTGAACTACGATCAGGTGTTTATTCGGGACTTCATACCATCCGGCATTGCTTTTCTACTG

[0014] AAGGGGGAATATGAAATTGTGCGTAATTTCATTCTACACACCCTTCAGCTTCAGAGCTGGGAGAAG

[0015] ACAATGGACTGCCATAGTCCAGGTCAAGGTTTAATGCCCGCCAGCTTCAAAGTGCGGACAATTCCG

[0016] CTTGATGGTGATGAGGATGCAACTGAGGAAGTCTTGGATCCTGATTTTGGGGAGGCCGCAATAGGC

[0017] CGCGTGGCACCTGTTGATTCAGGTCTATGGTGGATCATATTGCTTAGGGCATATGGAAAATGTTCAGG

[0018] GGATCTGTCAGTACAGGAGAGAATTGATGTCCAGACTGGAATGAAAATGATTCTGAAGCTTTGTTTA

[0019] GCTGATGGTTTCGACATGTTCCCTACATTACTCGTAACTGATGGTTCATGCATGATTGATCGTCGAAT

[0020] GGGAATCCATGGGCATCCACTTGAAATTCAGGCACTCTCTATTCAGCCCTCTTGTGTGCGTGAG

[0021] ATGTTGACTCCCAGAAGACGGATCAGCTGACTTAATCCGCGCCCTGAACAATAGACTTATTGCACTGT

[0022] CCTTTCATATCAGGGAGTACTACTGGCTTGGACATGCAAAATTGAATGAGATATATCGATATAAAAACA

[0023] GAAGAATATTCTTATGATGCTGTGAACAAGTTCAACATATACCCCGATCAGATTTCTCCATGGCTTGT

[0024] TGAGTGGATACCTCCTAAGGGGGGTTACTTTATTGGAAACCTCCAGCCAGCTCATATGGACTTCCGA

[0025] TTCTTTTCACTGGGAAATTTATGGTCAATAGTAAGCAGCTTGGCAACAACTCATCAGTCACATGCCA

[0026] TTTTAGATCTTTATTGAGTCTAAATGGTCTGATTTAGTGGCAGAGATGCCACTGAAGATATGCTATCCT

[0027] GCTCTTGAGAACCAGGAATGGAAGATCATCACAGGGAGTGACCCTAAAAACACGCCTGGTCGTAC

[0028] CACAATGGAGGATCCTGGCCAACATACTGTGGCAGCTCACTGTGGCATGCATCAAGATGAACAGA

[0029] CCAGAGCTTGCAGCCAAAGCTATAGAAGTAGCTGAGAGGCGTATTGCTACAGACAAATGGCCTGAA

[0030] TACTACGACACCAAGAAAGCACGCTTCATTGGGAAACAGGCACGGCTGTACCAAACGTGGTCTATT

[0031] GCTGGGTTCCTAGTAGCCAAGCTACTGATAGAAAAACCAGACGCTGCTAGGATTCTGTGGAACGAT

[0032] GAGGATGCAGAAATCCTTAATGCTTTGAGCACAAACAGAAAACGGGGCAAGAAAGTGTTGAAGAAAACATACATTGTGTGA.

[0033] The present invention also provides a protein encoded by the ShN / AINV5-4D gene, the amino acid sequence of which is shown in SEQ ID NO. 2, specifically:

[0034] *.

[0035] The protein encoded by the ShN / AINV5-4D gene is localized in chloroplasts, important organelles in plant photosynthesis. ShN / AINV5-4D may play a role in chloroplast photosynthesis and improve the germination rate of Arabidopsis seeds. The ShN / AINV5-4D gene and its biomaterials can be used to improve germplasm resources and enhance the germination rate of Arabidopsis seeds.

[0036] The present invention also provides a biological material containing the ShN / AINV5-4D gene, which is a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium.

[0037] The recombinant expression vector can be constructed using existing plant expression vectors, such as binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment. When constructing a recombinant expression vector using the ShN / AINV5-4D gene, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before the transcription initiation nucleotide. These promoters can be used alone or in combination with other plant promoters. Furthermore, when constructing a recombinant expression vector using the ShN / AINV5-4D gene, enhancers, including translational enhancers and transcriptional enhancers, can be used. These enhancer regions can be the ATG start codon or adjacent start codons, but must be in frame with the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons can be derived from a wide range of sources, including natural or synthetic sources. The translation initiation region can be derived from the transcriptional initiation region or a structural gene.

[0038] The recombinant expression vector carrying the ShN / AINV5-4D gene can be transformed into plant cells or tissues through conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc.

[0039] The expression cassette particularly refers to the expression cassette containing the ShN / AINV5-4D gene.

[0040] The transgenic cell line refers in particular to an artificially constructed transgenic cell line stably expressing the ShN / AINV5-4D gene or the protein encoded by the ShN / AINV5-4D gene.

[0041] The recombinant bacteria particularly refer to Escherichia coli or Agrobacterium constructed using the ShN / AINV5-4D gene.

[0042] The present invention also provides a primer for amplifying the ShN / AINV5-4D gene, the primer sequence is shown in SEQ ID NO.3-4, specifically:

[0043] F: CTCCCCTTGCTCCGTGGATCC ATGGGAATCGCGGAGGTGG; (the underline is the homologous recombination sequence);

[0044] R: GTCCTTGTAGTCAGAAGGCCT CACAATGTATGTTTTCTTCAACACTTTCTTGCC (the underlined sequence is the homologous recombination sequence).

[0045] Furthermore, the present invention also protects the use of the ShN / AINV5-4D gene, the protein encoded by the ShN / AINV5-4D gene, or the biological material containing the gene in regulating plant seed germination. The biological material refers to a recombinant expression vector, expression cassette, transgenic cell line, or recombinant bacteria containing the ShN / AINV5-4D gene.

[0046] Furthermore, the present invention also protects the use of the ShN / AINV5-4D gene, the protein encoded by the ShN / AINV5-4D gene, and the biological material containing the gene in plant germplasm improvement. The biological material refers to a recombinant expression vector, expression cassette, transgenic cell line, or recombinant bacteria containing the ShN / AINV5-4D gene.

[0047] Furthermore, the present invention also protects the use of the ShN / AINV5-4D gene, the protein encoded by the ShN / AINV5-4D gene, or biological materials containing the gene in plant breeding, wherein the purpose of the breeding is to cultivate plant varieties with high seed germination rates. The biological materials include recombinant expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria containing the ShN / AINV5-4D gene.

[0048] In the early stage of the present invention, a mutant Atinve with delayed seed germination was obtained through screening of Arabidopsis mutants. The gene ShN / AINV5-4D was genetically transformed into the Arabidopsis mutant Atinve using Agrobacterium GV3101 for gene function verification, and three complementation strains, #1, #8, and #16, were obtained. Seed germination experiments found that ShN / AINV5-4D can promote seed germination and increase the seed germination rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 It is a sugarcane ShN / AINV5-4D gene clone.

[0050] Figure 2 It is the PCR identification of the transgenic Arabidopsis ShN / AINV5-4D gene.

[0051] Figure 3 PCR identification of transgenic Arabidopsis Bar gene.

[0052] Figure 4 Comparison of seed germination rates of transgenic Arabidopsis lines #1, #8, #16, wild-type lines, and mutant Atinve. DETAILED DESCRIPTION

[0053] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0054] Example 1

[0055] 1. CDS sequence of sugarcane ShN / AINV5-4D gene

[0056] The CDS sequence of sugarcane ShN / AINV5-4D gene was cloned by homologous cloning. According to the OsN / AINV5 sequence of rice, forward primer (5'-CTCCCCTTGCTCCGTGGATCCATGGGAATCGCGGAGGTGG-3') and reverse primer (5'-GTCCTTGTAGTCAGAAGGCCTCACAATGTATGTTTTCTTCAACACTTTCTTGCC-3') were designed. The target gene ShN / AINV5-4D was amplified using sugarcane cDNA as a template. The reagents used were Max DNA Polymerase (TaKaRa Code No. R045A). PCR amplification reaction system and reaction conditions are shown in Table 1.

[0057] Table 1

[0058]

[0059] Take 5 μL of PCR product and perform 1% agarose gel electrophoresis. Figure 1 The results showed a single amplified product band of approximately 1812 bp in length, consistent with the target product length, indicating successful PCR amplification and the generation of a PCR product of the target length. The PCR product was sequenced to obtain the cDNA sequence of the sugarcane ShN / AINV5-4D gene. The nucleotide sequence of the ShN / AINV5-4D gene described herein is shown in SEQ ID NO. 1.

[0060] 2. Amino acid sequence encoded by the sugarcane ShN / AINV5-4D gene

[0061] The full-length cDNA sequence of the sugarcane ShN / AINV5-4D gene was converted into an amino acid sequence using Snapgene software. It was determined that a total of 603 amino acids were encoded, namely the encoded protein of the ShN / AINV5-4D gene of the present invention. The amino acid sequence of the encoded protein is shown in SEQ ID NO. 2.

[0062] 3. Construction of expression vector

[0063] The PCR product was electrophoresed on 1% agarose gel, excised and recovered using a gel recovery kit, and then mixed with the expression vector pCB302 (kept in our laboratory, cited in “Nannan Zhang, et al., Engineering Artificial MicroRNAs for Multiplex Gene Silencing and Simplified Transgenic Screen, Plant Physiology, Volume 178, Issue 3, November 2018, Pages 989-1001, https: / / doi.org / 10.1104 / pp.18.00828 ”) were linearized and then homologous recombination vectors were ligated. The specific operation was referred to the ClonExpress II One Step Cloning Kit (C112) of Nanjing Novozymes Biotech Co., Ltd.

[0064] Take 10 μL of the homologous and homologous product to transform E. coli DH5α competent cells. After transformation, spread it on kanamycin-resistant LB solid medium and culture it at 37°C for 12 hours. Perform PCR identification of the bacterial liquid. Pick 10 single colonies for PCR identification. The identification primers are as follows:

[0065] The forward primer was 35S PPDK-F (5'-GTCACGTAGTAAGCAGCTCTCGG-3') and the reverse primer of the target gene was (5'-ATCGTAGTTCACTGGGTCACTG-3').

[0066] The PCR amplification reaction system and reaction conditions are shown in Table 2.

[0067] Table 2

[0068]

[0069] 5 μL of the PCR product was run on a 1% agarose gel electrophoresis to detect the target band, which was approximately 530 bp. 100 μL of the bacterial suspension corresponding to 3-5 positive bands was sampled for sequencing. The bacterial suspension containing the correct sequence was saved for plasmid extraction and transfection into Agrobacterium tumefaciens GV3101 for genetic transformation.

[0070] 4. Genetic transformation of Arabidopsis thaliana and screening of homozygous lines

[0071] (1) The optimal transformation period is when Arabidopsis has the most flower buds and the fewest siliques.

[0072] (2) Pick a single colony of Agrobacterium carrying the corresponding expression vector and place it in the LB liquid culture medium of the corresponding resistance in a shaker until it is saturated.

[0073] (3) Collect the cells, remove the supernatant, and dilute with resuspension solution to an OD value of approximately 0.8.

[0074] (4) Add Silwet-77 to a final concentration of 0.02% to 0.05% by mass and mix well.

[0075] (5) Soak the flower buds of the plants in the transformation solution for about 2 minutes. Place the transfected plants in the dark for 16 to 24 hours, and then harvest the T1 generation transgenic plant seeds after normal light culture.

[0076] (6) After two consecutive generations of screening, the T3 generation homozygous strains were obtained, namely #1, #8, and #16.

[0077] 5. PCR identification of transgenic Arabidopsis

[0078] The surviving transgenic Arabidopsis plants were marked with serial numbers using a pipette tip. The transgenic DNA was extracted from the leaves of the Arabidopsis thaliana plant and identified by PCR using specific primers. The primers for the target gene ShN / AINV5-4D were: forward primer 35S PPDK-F (5'-GTCACGTAGTAAGCAGCTCTCGG-3') and reverse primer (5'-ATCGTAGTTCACTGGGTCACTG-3'). The primers for the Bar gene were:

[0079] Bar-F: 5'-ACAAGCACGGTCAACTTCC-3', Bar-R: 5'-CTTCAGCAGGTGGGTGTAG-3'. The PCR products were detected using 1% agarose gel. Figure 2 、 Figure 3 shown.

[0080] Depend on Figure 2-3 It can be seen that transgenic lines #1, #8, and #16 can all amplify the specific target fragment and the resistance gene (Bar gene), proving that the target vector has been successfully integrated into the Arabidopsis genome.

[0081] 6. Transgenic Arabidopsis germination test

[0082] The obtained Arabidopsis thaliana Atinve mutant (Gene ID: At5g22510, SALK_138953) was complemented with homozygous lines #1, #8, #16 and wild-type Arabidopsis thaliana WT and Atinve mutant seeds (purchased from TAIR website)

[0083] https: / / www.arabidopsis.org / ) were planted in MS medium, and seed germination tests were performed under normal growth conditions. The seed germination rates of Arabidopsis thaliana at 24 h, 32 h, 40 h, and 48 h were counted.

[0084] like Figure 4 As shown, at 24 hours, the germination rate of the mutant Atinve was 46.1%, the germination rate of WT was 70.4%, and the germination rates of transgenic Arabidopsis #1, #8, and #16 were 79.3%, 76.7%, and 78.0%, respectively. The results of variance analysis showed that the P values were all less than 0.01, indicating extremely significant differences.

[0085] At 32 hours, the germination rate of the mutant Atinve was 68.9%, the germination rate of the WT was 86.7%, and the germination rates of the transgenic Arabidopsis #1, #8, and #16 were 92.5%, 92.2%, and 91.4%, respectively. The results of variance analysis showed that the P values were all less than 0.01, indicating extremely significant differences.

[0086] At 40 hours, the germination rate of the mutant Atinve was 73.4%, the germination rate of the WT was 92.5%, and the germination rates of the transgenic Arabidopsis #1, #8, and #16 were 94.1%, 93.6%, and 92.8%, respectively. The results of variance analysis showed that the P values were all less than 0.01, indicating extremely significant differences.

[0087] At 48 hours, the germination rate of the mutant Atinve was 79.0%, the germination rate of WT was 93.2%, and the germination rates of transgenic Arabidopsis #1, #8, and #16 were 94.6%, 94.2%, and 93.3%, respectively. The results of variance analysis showed that there was no significant difference, but the germination rate of the Arabidopsis mutant Atinve was still lower than that of the WT and complemented lines #1, #8, and #16.

[0088] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. ShN / AINV5-4D Application of a gene or its encoded protein or a biological material containing the gene in promoting germination of Arabidopsis seeds, ShN / AINV5-4D The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. ShN / AINV5-4D Application of a gene or its encoded protein or a biological material containing the gene in plant breeding, wherein the breeding purpose is to cultivate plant varieties with high seed germination rate, wherein the plant is Arabidopsis thaliana, ShN / AINV5-4D The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, characterized in that The biological material is a recombinant expression vector, an expression cassette or a recombinant bacterium.

Images