Markers for diagnosing neuropathic pain and their applications

Abstract

The present invention discloses a marker for diagnosing neuropathic pain and its application, wherein the marker includes XLOC_035479, miR-183 and mTOR, wherein XLOC_035479 is located at 168847439-168849101 of chromosome 5, with a total length of 1663bp. The present invention firstly discovers that the combination of LncRNA (XLOC_035479) and miR-183 can be used to diagnose neuropathic pain, and further regulates the role of mTOR-mediated spinal neuron autophagy in neuropathic pain, which can provide a potential therapeutic target for neuropathic pain.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a marker for diagnosing neuropathic pain and an application thereof. Background Art

[0002] Neuropathic pain (NP) is pain caused directly by damage or disease of the somatic sensory system, such as diabetic peripheral neuropathy, trigeminal neuralgia, neuropathy after trauma or chemotherapy, phantom limb pain, cancer pain, etc. With the aging of the global population, the increase in the incidence of diabetes and cancer pain after chemotherapy, the incidence of NP has increased year by year. The International Pain Society believes that the incidence of NP is about 3.3%-8.2%, the prevalence of NP in the general population is as high as 8.0%, and the incidence of NP in diabetic patients is as high as 22%, among which there are about 90 million NP patients in China. NP has a long course and is not cured, which seriously affects the quality of life of patients and brings heavy economic burden to patients, their families and society. NP has become a major public health problem. However, since the pathogenesis of NP is not fully understood, the diagnosis and treatment of NP still face great challenges. Discovering new targets for intervention in NP has extremely important social and clinical value.

[0003] Long non-coding RNA (LncRNA) is a type of RNA with a length greater than 200 nt and no or little protein encoding capability. It was initially thought to have no biological function. With the widespread application of high-throughput sequencing technology, the rich biological functions of LncRNA have been continuously discovered in various organisms. It can regulate gene expression at multiple levels, including affecting protein ubiquitination degradation, binding to initiation factors to regulate gene translation, forming complementary double strands to interfere with mRNA shearing, increasing stability after binding to mRNA to upregulate gene expression, and combining with microRNA (miRNA) to form competing endogenous RNA (ceRNA), thereby affecting the occurrence and development of diseases. So far, reports have shown that LncRNA plays a functional role in the etiology of various human diseases. More and more researchers have also confirmed that LncRNA is involved in the pathogenesis of NP. LncRNA may appear as a biomarker for prediction, prognosis, diagnosis and treatment, but the biological function and mechanism of LncRNA in regulating NP are still unclear.

[0004] miRNAs are endogenous non-coding small single-stranded RNAs with a length of 21-25 nucleotides. They are highly conserved during evolution and have become "micro-managers" of gene expression, extensively regulating complex cellular life activities. miRNAs mainly cause degradation of target gene mRNA or inhibit its translation by binding to the 3'-untranslated region (3'-UTR). Current studies have confirmed that miRNA plays an important role in regulating cell autophagy after peripheral nerve injury. Shi et al. found that miR-195 was upregulated after peripheral nerve injury, and inhibiting the expression of miR-195 could activate autophagy, inhibit neuroinflammation, and reduce NP. Xie et al. found that miR-183 inhibited NP by targeting and regulating the mTOR / VEGF signaling pathway in the CCI rat model. Therefore, how to discover markers for the diagnosis of neuropathic pain at the molecular level has important clinical significance and practical value. Summary of the invention

[0005] The purpose of the present invention is to provide a marker for diagnosing neuropathic pain and its application. In order to achieve the purpose of the present invention, the following technical scheme is proposed:

[0006] The present invention provides a marker for diagnosing neuropathic pain, wherein the marker comprises XLOC_035479, miR-183 and mTOR, wherein XLOC_035479 is located at 168847439-168849101 of chromosome 5, with a total length of 1663 bp.

[0007] In a preferred embodiment of the present invention, the expression of XLOC_035479 and mTOR is upregulated, and the expression of miR-183 is downregulated.

[0008] Another aspect of the present invention also relates to a kit for diagnosing neuropathic pain, wherein the kit is used for quantitatively detecting the expression of XLOC_035479, miR-183 and mTOR.

[0009] Another aspect of the present invention also relates to a drug for treating neuropathic pain, wherein the drug is used to knock out, inactivate or down-regulate the expression of XLOC_035479.

[0010] In a preferred embodiment of the present invention, the drug further comprises an agent for overexpressing miR-183.

[0011] Another aspect of the present invention also relates to the use of the above marker in preparing a reagent for diagnosing neuropathic pain.

[0012] Another aspect of the present invention also relates to the use of the above-mentioned medicine for preparing a medicine for treating neuropathic pain.

[0013] The beneficial effect of the present invention is that the present invention has discovered for the first time that the combination of LncRNA (XLOC_035479) and miR-183 can be used to diagnose neuropathic pain, and further regulate the role of mTOR-mediated spinal neuron autophagy in neuropathic pain, which can provide a potential therapeutic target for neuropathic pain. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 In vitro experiments detected the expression of XLOC_035479, miR-183 and mTOR; Note: (A) qRT-PCR showed that glutamate stimulation could enhance the mRNA expression of XLOC_035479 and mTOR in PC12 cells; while the mRNA expression of miR-183 was downregulated; (BC) Western blotting showed that glutamate stimulation could enhance the protein expression of mTOR in PC12 cells. *P<0.05; **P<0.01.

[0015] Figure 2 Mechanical pain in SNI rats was measured at different time points; Note: Mechanical pain in SNI rats was measured at different time points, *P<0.05.

[0016] Figure 3 In vivo experiments detected the expression of XLOC_035479, miR-183 and mTOR; Note: (A) qRT-PCR showed that the mRNA expression of XLOC_035479 and mTOR in the spinal cord tissue after SNI was upregulated; the mRNA expression of miR-183 was downregulated; (B) Western blotting showed that the protein expression of mTOR in the spinal cord tissue after SNI was upregulated. *P<0.05; **P<0.01.

[0017] Figure 4 The tactile pain of XLOC_035479- / - rats was reduced; Note: There was no significant difference between the two control groups (WT Sham group and KO sham group); compared with the WT SNI group, the mechanical pain threshold of the KO SNI group increased, and the difference was statistically significant, *P<0.5.

[0018] Figure 5 Screening of XLOC_035479 siRNA; Note: qRT-PCR was used to detect the efficiency of siRNA transfection of XLOC_035479.

[0019] Figure 6Knockdown of XLOC_035479 inhibits the autophagic activity of PC12 cells; Note: (A) GFP-LC3 detection interferes with XLOC_035479 in glutamate-induced PC12 cells, reducing the autophagic activity of PC12 cells; (BC) qRT PCR results show that interference with XLOC_035479 in glutamate-induced PC12 cells downregulates the mRNA expression of LC3II / I and upregulates the mRNA expression of P62; (DF) Western Blotting results show that interference with XLOC_035479 in glutamate-induced PC12 cells downregulates the protein expression of LC3II / I and upregulates the protein expression of P62.

[0020] Figure 7 XLOC_035479 and miR-183 regulate the autophagic activity of PC12 cells; Note: LC3-GFP analysis detects the autophagic activity of PC12 cells regulated by XLOC_035479 and miR-183. Blue: DAPI; Green: LC3-GFP.

[0021] Figure 8 XLOC_035479 and miR-183 mediate autophagy in PC12 cells; Note: (AB) qRT-PCR showed that overexpression of miR-183 inhibited glutamate-induced PC12 cells, downregulated the mRNA level of LC3II / I, and increased the mRNA level of p62; (CE) Simultaneous knockdown of XLOC_035479 and inhibition of miR-183 resulted in upregulation of the protein level of LC3II / I and downregulation of the protein level of p62. DETAILED DESCRIPTION

[0022] In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be purchased through commercial channels.

[0024] Embodiment 1:

[0025] 1.1 Materials and methods

[0026] 1.1.1 Experimental animals

[0027] Healthy male SD rats (Saibono Biotechnology Co., Ltd., Beijing) weighed 220±20g and were 6-8 weeks old. The rats were kept in an SPF clean environment with an indoor temperature of 20℃ and a day / night cycle of 12 / 12h. They were free to eat and drink.

[0028] 1.1.2 Cell lines

[0029] Rat pheochromocytoma cells (PC12 cells) were purchased from the American Culture Collection (ATCC) agent.

[0030] 1.2 Experimental methods

[0031] 1.2.1 Construction of SNI rat model

[0032] Twenty-four male SD rats were randomly divided into 4 groups (6 rats in each group): WT sham group, WT SNI group, KO sham group and KOSNI group. The basal pain threshold was measured one day before modeling.

[0033] After intraperitoneal injection of 10% chloral hydrate (0.3ml / 100g) for anesthesia, the rats were fixed in a prone position on a rat fixing frame, and a perforated towel was laid to expose the right lower limb of the rat and cut off the hair of the rat. Iodine and alcohol disinfection was performed three times, a pad was placed under the right hind limb, and the right hind limb was fixed with tape at the same time. A longitudinal incision of about 15 to 20mm was made along the right posterior midline of the thigh to expose the subcutaneous muscle. After blunt separation of the biceps femoris, semitendinosus, and semimembranosus with hemostatic forceps, the white and thick sciatic nerve (common peroneal nerve, tibial nerve, and sural nerve) was separated, and the right foot twitched after stimulation. The common peroneal nerve and tibial nerve were ligated, and the lower end of the ligature was cut using 9-0 non-invasive sutures, and about 2mm of nerve tissue was intercepted, the muscles and skin were sutured, and iodine was used for disinfection. After anesthesia, the rats in the sham operation group were only incised to expose the right sciatic nerve (common peroneal nerve, tibial nerve, and sural nerve), but no clamping was performed. The muscles and skin were sutured and disinfected with iodine.

[0034] 1.2.2 Measurement of plantar mechanical pain

[0035] Three days before the start of the experiment, the rats were placed in isolation chambers for 30 minutes each time. The purpose was to allow the rats to adapt to the experimental environment and experimenters in advance to reduce the risk of stress and bites. The experimental environment should be kept quiet and well controlled, with constant temperature and humidity, and the test should be carried out between 9:00 and 11:00 every day. Pain hypersensitivity tests were performed 1 day before surgery, 1 day, 3 days, 5 days, and 7 days after surgery.

[0036] On the day of the test, 30 minutes before measuring the mechanical pain in the plantar, the rats were placed in an elevated mesh floor test cage, and the exploration and grooming activities in the cage were stopped, and the rats became relaxed and still. Using the plantar pain measurement system (Guangzhou Zhixiang Biotechnology Co., Ltd.), the experimenter held the stimulation sensor and vertically stimulated the last two paws on the outside. When the stimulation intensity gradually increased until the rat felt pain, the rat would retract its paw, and the system would automatically record and display the maximum force applied (in g). If there was an ambiguous response (such as walking or grooming), the stimulation was repeated and the threshold was recorded again. Licking or shaking the hind paw after stimulation is a behavioral sign related to pain. Repeat the mechanical stimulation twice, with an interval of about 5 minutes each time, record the threshold, and then calculate the mean and standard deviation of the mechanical withdrawal threshold.

[0037] 1.2.3 Heart perfusion and sampling

[0038] First, install the perfusion device and infusion needle. Prepare 4-5 50ml syringes filled with pre-cooled PBS solution in advance. Use 50ml pre-cooled 1× PBS solution to flush the pipes of the perfusion device to remove the residue in the pipes, and keep the rest for later use. Place scissors, tweezers and hemostatic forceps in a suitable position on the operating table.

[0039] After injecting the rat with 10% chloral hydrate anesthesia (0.3 ml / 100 g), place it on its back on the operating table. Test the degree of anesthesia by pinching the reaction method. Make sure the animal is unresponsive before starting the following operations. Make an incision along the diaphragm with a scalpel in the abdomen, and use sharp scissors to cut the tissue attached to the bottom of the diaphragm to ensure that the chest cavity can be entered. Take a large pair of scissors, with the blunt end facing down, and cut through the left thorax. Cut through the rib cage one to two centimeters laterally to open the chest cavity. Use hemostats to open it and expose the heart. Prepare blood drainage and infusion equipment. Fix the heart with forceps (the heart should still be beating) and insert the needle directly into the beating part of the left ventricle, leaving 5 mm exposed vertically. Be careful not to insert the needle too far to prevent puncturing the ventricular wall and affecting the circulation of the solution. Fix the needle to the input port with hemostats. Use scissors to cut a hole in the atrium to ensure free flow of the solution. Start injecting pre-cooled 1× PBS solution, first fast and then slow, at a slow and steady flow rate of about 20 ml / min into the animal. Generally, a rat is injected with 100-200 ml of 1× PBS solution. If the solution cannot flow out freely or the solution flows out of the animal's nostrils or mouth, the needle should be reset. When the blood is almost drained, stop the perfusion. Use the spinal cord blowout method to obtain the sample.

[0040] Disinfect the dissecting instruments with 70% ethanol and rinse them with physiological saline or a pressure cooker in advance. Make a blow-out device: install the 200ml pipette tip on the outlet of a 5ml disposable syringe. The tip should be trimmed to a point where the round hole is slightly smaller than the thickness of the vertebral canal of the animal's lumbar enlargement. When using it, press the tip tightly against the vertebral canal to ensure that the liquid pushed out by the syringe directly impacts the spinal cord in the vertebral canal through the pipette tip.

[0041] After cardiac perfusion, the rats were decapitated directly, and the ribs on both sides of the thoracic and lumbar vertebrae were cut with bone shears to obtain the required segmental vertebrae (2 segments upward at the head end and 2 segments downward at the tail end to prevent damage to the spinal cord of the required segment). 5 ml of sterile pre-cooled 1×PBS solution was drawn with the aforementioned device, and the outlet of the device was aligned with the tail end of the spinal canal of the obtained spine to ensure sealing, and the other end of the spinal canal was facing the culture dish containing pre-cooled 1×PBS. The syringe was pushed quickly, and the spinal cord was separated from the spinal canal under the action of the water flow and fell into the culture dish, and the dura mater was peeled off.

[0042] Use scissors to cut the spinal cord into 3 sections of 1 cm. Obtain specimens of equal length from the corresponding parts of the sham operation group in the same way. Process and fix them in three ways. Store in RNA later solution for qRT-PCR; fix the isolated spinal cord with 4% paraformaldehyde for 1 hour, then precipitate in 10%-20%-30% gradient sugar, embed in embedding agent, and prepare for frozen sections; freeze in liquid nitrogen for Western blotting.

[0043] 1.2.4 Obtaining RNA sequence and protein information of XLOC_035479, miR-183, and mTOR

[0044] The RNA sequence information of XLOC_035479 and mTOR was obtained through Nucleotide (https: / / www.ncbi.nlm.nih.gov / nucleotide / ) in the NCBI database. The sequence information of miR-183 was obtained using miRbase (http: / / www.mirbase.org). The protein sequence information of mTOR and AGO2 was obtained using Uniprot (https: / / www.uniprot.org). All RNA and protein sequence information were saved in FASTA format.

[0045] 1.2.5 Homology analysis of lncRNAs in different species and prediction of their coding capacity

[0046] The sequences of the full-length homology of XLOC_035479 in the mouse and rat genomes were analyzed by the UCSC database (http: / / genome.ucsc.edu / ). The protein coding ability of XLOC_035479 was predicted using NCBI's Open Reading Frame Finder (ORF Finder, https: / / www.ncbi.nlm.nih.gov / orffinder / ) and the online sequence protein coding ability prediction tool Coding Potential Calculator (CPC, http: / / cpc.cbi.pku.edu.cn / ).

[0047] 1.2.6 Glutamate stimulation of PC12 cells

[0048] When the cells grow to the logarithmic growth phase, drug treatment can be performed.

[0049] Disinfect the clean bench with ultraviolet light for 30 minutes.

[0050] Incubate RPIM1640 complete medium containing 10% horse serum and 5% fetal bovine serum, 0.25% trypsin solution, and 1×PBS in a water bath at 37°C for 30 min.

[0051] Inoculate the cell suspension into a new dish or bottle containing 4 ml of complete culture medium at a ratio of 1:3.

[0052] The cells were cultured in an incubator at 37°C with 5% CO2.

[0053] After 8 hours, the cell adhesion was observed, and the culture medium was replaced with RPIM1640 culture medium containing 2% HS and 1% FBS, and the cells were left to stand overnight.

[0054] The corresponding volume of glutamate was added to the RPIM1640 medium containing 2% HS and 1% FBS to make the final concentration of glutamate 5 mmol / L. The corresponding volume of PBS as glutamate was added to the medium in the control group as a control.

[0055] Three replicate wells were set for each sample in the experimental group and the control group.

[0056] The cells were placed in a 37.5°C, 5% CO2 incubator and cultured for 24 hours.

[0057] 1.2.7 RNA extraction and reverse transcription-real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qRT-PCR)

[0058] (1) Extraction of total cellular RNA

[0059] Aspirate the culture medium, turn the culture dish upside down on filter paper, absorb the culture medium as much as possible, and place the culture dish on ice.

[0060] For 6-well culture dishes, add 1000 μl Trizol and pipette repeatedly to fully lyse the cells. Observe that the cell lysate changes from viscous to clear without obvious cell clumps.

[0061] The cell lysate was transferred to a 1.5 ml RNase-free EP tube and placed at room temperature for 5 min.

[0062] Add 200 μl of chloroform, cover the tube tightly, shake thoroughly for 15 seconds to mix the chloroform and cell lysate thoroughly, and let stand on ice for 3 minutes.

[0063] Centrifuge at 12000RPM, 4°C for 15 min.

[0064] After centrifugation, the solution can be seen to be divided into three phases: the upper layer is a transparent aqueous phase, the middle layer is protein, the lower layer is red chloroform and the phenol component in TRIzol, and the RNA is in the aqueous phase.

[0065] Carefully aspirate about 400 μl of supernatant and transfer to a new enzyme-free EP tube, being careful not to aspirate the middle layer.

[0066] Add 500 μl of isopropanol, mix thoroughly with the aqueous phase by pipetting, and let stand on ice for 10 min.

[0067] Centrifuge at 12000RPM, 4℃ for 10min, carefully discard the supernatant, and white precipitate can be seen adhering to the bottom side wall of the EP tube.

[0068] Add 1000 μl of 75% ethanol (75% ethanol is prepared with RNase-free ddH2O: anhydrous ethanol = 1:3) to wash the RNA precipitate.

[0069] Centrifuge at 7500RPM, 4°C for 5 min, carefully discard the supernatant and retain the RNA precipitate.

[0070] Open the tube cap and allow the RNA precipitate to dry naturally, then add 20 μl RNase-free ddH2O to dissolve the RNA precipitate.

[0071] Incubate at 55-60℃ for 10 minutes in a constant temperature heater or water bath to fully dissolve the RNA.

[0072] Take 1 μl RNA solution and measure the OD260 and OD280 of each RNA sample on a NanoDrop ND-1000 spectrophotometer to calculate the concentration. The remaining RNA should be reverse transcribed immediately or stored in a -80 degree refrigerator for later use.

[0073] (2) Extraction of total RNA from tissues

[0074] At least half an hour in advance, place the adapter of the tissue grinder in a -80 degree refrigerator to pre-cool. And wash the 3mm and 4mm grinding beads in DEPC water overnight for later use.

[0075] Cut the tissue blocks into appropriate sizes, rinse with sterile PBS 1-2 times, and place the samples and grinding beads (one each of 3 mm and 4 mm) into a 1.5 ml EP tube.

[0076] Spinal cord tissues stored in a -80 degree refrigerator (i.e., spinal cord tissues taken from the SNI model experimental group constructed by gene knockout rats and wild-type rats and the Sham control group) were placed on clean filter paper. About 20-50 mg of tissue blocks were taken from each sample, placed in a clean 1.5 ml EP tube, and quickly placed on ice for storage.

[0077] Quickly add 1000 μl of Trizol into the EP tube.

[0078] Add 200 μl of chloroform, cover the tube tightly, shake thoroughly for 15 seconds to mix the chloroform and cell lysate thoroughly, and let stand on ice for 3 minutes.

[0079] Place a 1.5 ml EP tube into the adapter, install it into the tissue grinder, set the working parameters to 65 Hz, 30 s, 30 s interval, repeat 3 times, and grind the spinal cord tissue.

[0080] After the equipment is finished running, centrifuge at 12000RPM, 4℃ for 15min. Carefully aspirate about 400μl of supernatant and transfer to a new enzyme-free EP tube, making sure not to aspirate the middle layer.

[0081] Add 500 μl of isopropanol, mix the aqueous phase thoroughly by pipetting, and let stand on ice for 10 min.

[0082] Centrifuge at 12000RPM, 4℃ for 10min, carefully discard the supernatant, and white precipitate can be seen adhering to the bottom side wall of the EP tube.

[0083] Add 1000 μl of 75% ethanol (75% ethanol is prepared with RNase-free ddH2O: anhydrous ethanol = 1:3) to wash the RNA precipitate.

[0084] Centrifuge at 7500RPM, 4°C for 5 min, carefully discard the supernatant and retain the RNA precipitate.

[0085] Open the tube cap and allow the RNA precipitate to dry naturally, then add 50 μl RNase-free ddH2O to dissolve the RNA precipitate.

[0086] Take 1 μl RNA solution and measure the OD260 and OD280 of each RNA sample on a NanoDrop ND-1000 spectrophotometer to calculate the concentration. The remaining RNA should be reverse transcribed immediately or stored in a -80 degree refrigerator for later use.

[0087] (3) Primer design and synthesis

[0088] The Nucleotide tool of the NCBI database (https: / / www.ncbi.nlm.nih.gov / nucleotide / ) was used to search for the mRNA sequence of the gene to be detected; and the BLAST online software was used to design specific primers (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi); the miRbase database (http: / / www.mirbase.org) was used to obtain the mature sequence of miRNA; the designed primer sequence and the relevant information of the mature miRNA mature sequence were submitted to Guangzhou Ruibo Biotechnology Co., Ltd. for product synthesis.

[0089] Table 1 Primer sequence information

[0090]

[0091] (4) Reverse transcription

[0092] Reverse transcription of mRNA

[0093] The reverse transcription step of mRNA was carried out strictly according to the instructions of TOYOBO FSK-101ReverTra Ace-a kit: Prepare the following mixture in a Microtube.

[0094] Table 2 Preparation of mixed solution (1)

[0095]

[0096] After keeping at 65°C for 5 min, the mixture was rapidly cooled on ice for 1 min.

[0097] Prepare the following reverse transcription reaction solution in the above-mentioned Microtube tube, with a total volume of 20 μl.

[0098] Table 3 Preparation of mixed solution (2)

[0099]

[0100] Mix slowly.

[0101] Carry out reverse transcription reaction according to the following conditions:

[0102] 30℃; 10min (when using Random Primer)

[0103] 42℃; 20min

[0104] 99℃; 5min

[0105] 4℃;∞

[0106] Store cDNA at -20°C.

[0107] Reverse transcription of miRNA

[0108] The reverse transcription step of miRNA was carried out strictly according to the instructions of TIANGEN KR211-01 miRcute enhanced miRNA cDNA first-strand synthesis kit.

[0109] Prepare the following solutions in an RNase-free PCR tube.

[0110] Table 4 Preparation of mixed solution (3)

[0111]

[0112] Mix the above solutions and incubate at 85°C for 5 minutes to open the RNA secondary structure. Then immediately place on ice to prevent RNA renaturation and restore the secondary structure.

[0113] Prepare the following solution in another RNase-free PCR tube.

[0114] Table 5 Preparation of mixed solution (4)

[0115]

[0116] Mix slowly.

[0117] The reverse transcription reaction was performed according to the following conditions:

[0118] 42℃; 60min (miRNA Poly A tailing reaction and reverse transcription reaction)

[0119] 95℃; 3min (enzyme inactivation reaction)

[0120] 4℃;∞

[0121] Store cDNA at -20°C.

[0122] (5) Real-time quantitative PCR (qRT-PCR)

[0123] qRT-PCR reaction of mRNA

[0124] The qRT-PCR reaction steps of mRNA were strictly carried out according to the instructions of TB Green Premix Ex Taq II (TII RNaseH Plus, TaKaRa, RR820A) kit.

[0125] Three replicate wells were added for each gene to be detected, and the qRT-PCR reaction solution was prepared in each well according to the following components.

[0126] Table 6 Preparation of mixed solution (5)

[0127]

[0128] The qRT-PCR reaction was performed according to the following reaction parameters:

[0129] Pre-denaturation:

[0130] 95℃, 30s(Ramp Rate 4.4℃ / s)

[0131] 1 cycle

[0132] PCR reaction:

[0133] 95℃, 5s(Ramp Rate 4.4℃ / s)

[0134] 60℃, 30s (Ramp Rate 2.2℃ / s, Acquisition Mode: Single)

[0135] 40 cycles

[0136] melt:

[0137] 95℃,5s

[0138] 60℃, 60s(Ramp Rate 2.2℃ / s)

[0139] 1 cycle

[0140] Cooling:

[0141] 50℃, 30s(Ramp Rate 2.2℃ / s)

[0142] 1 cycle

[0143] qRT-PCR reaction of miRNA

[0144] The miRNA qRT-PCR reaction steps were strictly carried out according to the instructions of the Fastking one-step reverse transcription-fluorescence quantification (SYBR Green, TIANGEN, FP313-01) kit.

[0145] Three replicate wells were added for each gene to be detected, and the qRT-PCR reaction solution was prepared in each well according to the following components.

[0146] Table 7 Preparation of mixed solution (6)

[0147]

[0148] The qRT-PCR reaction was performed according to the following reaction parameters:

[0149] Reverse transcription:

[0150] 50℃,30min

[0151] 1 cycle

[0152] Pre-denaturation:

[0153] 95℃,2min

[0154] 1 cycle

[0155] PCR reaction:

[0156] 94℃, 20s

[0157] 50-60℃,20s

[0158] 68℃,20s

[0159] 35-45 cycles

[0160] Experimental results analysis

[0161] The data were analyzed using the data analysis software of the LightCycler / LightCycler 480 System (Roche Diagnostics) fluorescence quantitative PCR instrument, and the 2^-ΔΔCt method was used for calculation.

[0162] 1.2.8 Western Blotting

[0163] (1) Extraction of total protein from adherent monolayer cells

[0164] Prepare RIPA cell lysis buffer: add 10 μl 100 mM protease inhibitor PMSF to 1 ml RIPA lysis buffer, shake well and place on ice.

[0165] Discard the culture supernatant and turn the culture dish upside down on filter paper to absorb the culture medium as much as possible.

[0166] For 6-well plates, add 3 ml of 4°C precooled 1× PBS to each well and wash three times. Shake on a shaker for 1 min, then discard the 1× PBS and place the plate on ice.

[0167] Add 400 μl of pre-prepared cell lysis solution (containing PMSF) to each well and place on a shaker for 30 minutes. It is best to lyse on ice.

[0168] After lysis, use a clean scraper to quickly scrape the cells to the side of the culture flask, and use a pipette to transfer the cell fragments and lysate to a 1.5 ml EP tube.

[0169] The cells were disrupted using an ultrasonic disruptor at a power of 35 W for 10 s with an interval of 5 s, repeated 3 times.

[0170] Centrifuge at 12000 RPM for 5 min at 4°C.

[0171] The supernatant after centrifugation was transferred into 0.5 ml EP tubes and stored at -20°C.

[0172] (2) Extraction of total tissue protein

[0173] At least half an hour in advance, place the adapter of the tissue grinder in a -80 degree refrigerator to pre-cool. And wash the 3mm and 4mm grinding beads in DEPC water overnight for later use.

[0174] Cut the tissue blocks into appropriate sizes, rinse with sterile PBS 1-2 times, and place the samples and grinding beads (one each of 3 mm and 4 mm) into a 1.5 ml EP tube.

[0175] After adding 400 μl of cell lysis solution (containing PMSF protease inhibitor), the EP tube was placed in the adapter and installed in the tissue grinder. The working parameters were set to 65 Hz, 30 s, 30 s interval, repeated 3 times, and the spinal cord tissue was ground.

[0176] After the equipment is finished running, use an ultrasonic disruptor to disrupt the cells, with a power of 35W, 10s, and an interval of 5s, repeated 3 times.

[0177] Centrifuge at 12000RPM for 10-20min at 4℃ and take the supernatant.

[0178] Dispense into 0.5 ml EP tubes and store at -20°C.

[0179] (3) BCA method to measure protein concentration

[0180] The steps for determining the sample protein concentration were strictly followed in accordance with the instructions of the BCA protein quantification kit (Thermo, USA).

[0181] Dilute the sample by taking 4 μl of protein sample and adding it to 96 μl of deionized water to dilute the sample 25 times.

[0182] 25 μl of standard or protein sample was added to each well of a 96-well plate.

[0183] Add 200 μl BCA working solution (Solution A: Solution B = 50:1) to each well. Shake evenly for 30 seconds. Cover the well with the lid.

[0184] Standard assay: Incubate the reaction at 37°C for 30 min or at room temperature for 2-16 hours.

[0185] Intensification assay: Incubate the reaction at 60°C for 15 min.

[0186] The plate was cooled to room temperature.

[0187] The absorbance at 562 nm was measured on a microplate reader.

[0188] Absorbance correction: Subtract the absorbance of the blank tube from the absorbance of the standards and samples.

[0189] A standard curve was drawn by combining the known concentrations of the BSA standards and the corrected absorbance values.

[0190] The protein concentration was calculated based on the corrected absorbance of each protein sample with reference to the standard curve.

[0191] (4) Preparation of protein samples

[0192] Adjust the concentration of the protein sample with RIPA lysis buffer, add 1 / 4 of the existing volume of 5×SDS loading buffer, place in a 100°C water bath for 5 minutes to fully denature the protein, centrifuge at 12000RPM, 4°C, 15 minutes and place in a -80°C refrigerator for long-term storage.

[0193] (5) SDS-PAGE protein electrophoresis

[0194] The SDS-PAGE protein electrophoresis steps were carried out strictly according to the instructions of the SDS-PAGE gel rapid preparation kit (Biyuntian, p0012ac).

[0195] Select the appropriate gel concentration according to the molecular weight of the target protein, prepare the stacking gel (upper gel) and separation gel (lower gel) according to the instructions, fix them on the electrophoresis tank, and add a sufficient amount of 1× electrophoresis buffer.

[0196] Use a pipette and gel injection gun tip to add an equal amount of total protein (recommended: 50 mg) to the electrophoresis gel wells, and add 10 μl of marker protein to each of the blank wells on both sides.

[0197] Turn on the power supply and run the stacking gel at 80V for 20 minutes. After the sample enters the separation gel, adjust the voltage to 180V and stop electrophoresis when the indicator bromophenol blue band in the sample runs to the bottom.

[0198] (6) Transfer

[0199] Cut the PVDF membrane and cut a corner in advance, then place it in methanol for 3 minutes for activation.

[0200] Place the PVDF membrane, sponge and filter paper in pre-cooled 1× transfer buffer for later use.

[0201] Open the transfer clip and keep the black side horizontal. Place sponge pad-3 layers of filter paper-SDS PAGE gel-PVDF membrane-3 layers of filter paper-sponge pad-white side (positive electrode) in sequence on the black side (negative electrode). The entire operation is carried out in 1× transfer solution. Note that the filter papers on both sides of the membrane cannot touch each other, otherwise a short circuit will occur.

[0202] Place the transfer clip into the wet transfer tank, add pre-cooled 1× transfer solution, and start transfer. At the same time, place ice cubes around the electrophoresis tank to prevent excessive heat generated during electrophoresis.

[0203] The wet transfer conditions are generally set at 300mA constant current for 1.5-2h.

[0204] (7) Antibody hybridization

[0205] 1) Closed

[0206] After the transfer is completed, immediately place the PVDF membrane in the pre-prepared 1×TBST washing solution and rinse for 1-2 minutes to wash off the transfer solution on the membrane. Prepare 5% skim milk with 1×TBST washing solution and block the PVDF membrane on a shaker at room temperature for 1 hour, recover the blocking solution, and wash with 1×TBST washing solution for 5 minutes × 3 times.

[0207] 2) Primary antibody incubation

[0208] Dilute the primary antibody in 5% BSA at a ratio of 1:1000 and incubate at 4°C overnight. Recover the primary antibody. Add 1×TBST solution and wash for 5 min x 5 times.

[0209] 3) Secondary antibody incubation

[0210] Dilute the horseradish peroxidase (HRP) labeled secondary antibody in 1×TBST at 1:2000. Incubate on a shaker for 1 hour. Recover the secondary antibody. Wash with 1×TBST solution for 5 minutes x 3 times.

[0211] (8) Protein detection and gel image analysis

[0212] 1) Protein detection

[0213] The A solution and B solution in the Amersham ECL Prime Western Blotting Detection Regent (RPN2232, Cytiva) developer and fixer kit were prepared in a volume ratio of 1:1, and then evenly dropped on the PVDF membrane. The image was exposed using a chemiluminescence instrument, and the picture was taken and saved.

[0214] 2) Gel image analysis

[0215] The molecular weight and net optical density of the target band were analyzed using a gel image processing system, and the protein grayscale of the band was obtained using Image J.

[0216] 1.2.8 Statistical analysis

[0217] All data were independently repeated more than three times, and the data were expressed as mean ± standard deviation (Mean ± SD). For data that followed normal distribution, the t test was used for comparison between two groups; the one-way ANOVA method was used for comparison of differences between multiple groups, with P < 0.05 as the test level. Statistical analysis and graphics were completed using Prism 8.0 software.

[0218] 1.3 Experimental Results

[0219] 1.3.1 Molecular characteristics of XLOC_035479

[0220] XLOC_035479 is a new unannotated lncRNA with distinct characteristics in terms of gene sequence, location and biological information. XLOC_035479 is located on chromosome 5 (chr5:168847439-168849101) and has a total length of 1663bp. Through the UCSC database, it can be observed that XLOC_035479 has a highly conserved region between humans, mice and rats. Its high homology between species and high evolutionary conservation suggest its important biological significance.

[0221] 1.3.2 In vitro assays to detect the expression of XLOC_035479, miR-183, and mTOR

[0222] To preliminarily verify the analysis results of sequencing, PC12 cells were stimulated with 10mmol glutamate, and qRT-PCR experiments were performed on XLOC_035479 and miR-183 24 hours later, and qRT-PCR and Western blotting experiments were performed on mTOR. The results showed that under glutamate stimulation of PC12 cells, the expression of XLOC_035479 and mTOR was significantly upregulated, with statistically significant differences (P<0.01); while the expression of miR-183 was downregulated, with statistically significant differences (P<0.05) ( Figure 1 ).

[0223] 1.3.3 SNI rat model induced NP

[0224] In order to study the lncRNAs differentially expressed in the spinal cord tissue of NP induced by the SNI rat model, the SNI rat model was first constructed, and the mechanical withdrawal threshold (MWT) of the rats was measured 1 day before surgery, 1 day, 3 days, 5 days and 7 days after surgery to verify whether the SNI model of rats was successfully established. The results showed that there was no significant change in the Sham group rats after surgery compared with before surgery. The MWT of the SNI group rats dropped to 3.07+0.49g on the first day after surgery, which was significantly lower than that of the Sham group. Since then, their MWT has remained at this level, indicating that the SNI-induced NP model was successfully established ( Figure 2 ; Table 9).

[0225] Table 9 Comparison of MWT between two groups of rats at different time points (g)

[0226]

[0227] Note: *P<0.05.

[0228] 1.3.4 In vivo assay to detect the expression of XLOC_035479, miR-183 and mTOR

[0229] To analyze whether XLOC_035479 plays a role in the NP model, the SNI rat model was further constructed. The spinal cord tissue was taken on the 8th day and total RNA was extracted for qRT-PCR to analyze the expression of XLOC_035479, miR-183 and mTOR. The results showed that compared with the Sham group, the expression of XLOC_035479 and mTOR in the SNI group was significantly upregulated, and the difference was statistically significant (P<0.01); while the expression of miR-183 was significantly downregulated, and the difference was statistically significant (P<0.01) ( Figure 3 ). In vitro and in vivo experiments preliminarily verified that the expression changes of XLOC_035479, miR-183 and mTOR were consistent with the results of bioinformatics analysis, laying a foundation for further experiments.

[0230] It was preliminarily confirmed that after nerve injury, the expression of XLOC_035479 and mTOR was significantly upregulated, while the expression of miR-183 was downregulated. These experimental results were basically consistent with the results of bioinformatics analysis, laying the foundation for further research on the relationship between XLOC_035479, mTOR and miR-183.

[0231] 1.4 Conclusion

[0232] In this example, a new LncRNA named XLOC_035479 was discovered for the first time through LncRNA chip analysis. This RNA was significantly upregulated in NP and significantly correlated with cell autophagy activity. Next, by obtaining the full-length sequence of XLOC_035479 and subsequent bioinformatics analysis, it was found that XLOC_035479 did not have the ability to encode protein. At the same time, in vivo and in vitro verification showed that XLOC_035479 and mTOR were significantly increased after nerve injury, while miR-183 was downregulated.

[0233] Example 2

[0234] 2.1 Materials and methods

[0235] 2.1.1 Experimental animals

[0236] Healthy male SD rats (Saibono Biotechnology Co., Ltd., Beijing) weighed 220±20g and were 6-8 weeks old. The rats were kept in an SPF clean environment with an indoor temperature of 20℃ and a day / night cycle of 12 / 12h. They were free to eat and drink.

[0237] XLOC_035479 gene knockout rats constructed by CRISPR / Cas9 technology were purchased from (Saiye Biotechnology Co., Ltd., Guangzhou), and the subsequent breeding conditions were the same as those of SD rats.

[0238] 2.1.2 Experimental methods

[0239] (1) Construction of SNI rat model: The steps were the same as the experimental method in Example 1.

[0240] (2) Pain behavior measurement: The steps are the same as the experimental method in Example 1.

[0241] (3) Heart perfusion and sampling: The steps are the same as the experimental method in Example 1.

[0242] (4) Cell culture: The steps are the same as the experimental method in Example 1 (including cell recovery, cell passaging and cell cryopreservation).

[0243] (5) Cell transfection

[0244] The cell lines were passaged one day before transfection to a confluence of 30%-50%. Lipofectamine 2000 or Lipofectamine TM RNAiMAX transfection reagent, siRNA / miRNA working concentration is 50nM, and Opti-MEM medium is used for transfection.

[0245] For example, if a 24-well plate is used, the surface area of ​​each well is 1.9 cm2, and the amount of culture medium is 500 μl, that is, 1.25 μl of siRNA mother solution (20uM) is taken and dissolved in 100 μl Opti-MEM culture medium as liquid A, and 1 μl of Lipofectamine 2000 or Lipofectamine TM RNAiMAX was dissolved in Opti-MEM medium as solution B. After mixing solution B for 5 minutes, solution A and solution B were mixed, and after standing for 20 minutes, they were added to the cell culture plate. The above operation is for each well.

[0246] After 4 hours of incubation, the medium was changed to cell growth medium.

[0247] For gene level detection, samples were collected after 24-36 hours, and for protein level detection, samples were collected after 36-48 hours for subsequent experiments.

[0248] Synthesis and design of specific siRNA

[0249] Table 10 siRNA sequence information

[0250]

[0251] (6) microRNA mimics and inhibitors

[0252] The miR-183 mimics and inhibitors were commissioned to Ruibo Biotechnology Co., Ltd. for synthesis and design.

[0253] Basic information: Universal miRNA mimic Ncontrol#24 for human, mouse, and rat

[0254] Mature miRNA name: cel-miR-67-3p

[0255] Mature miRNA ID: MIMAT0000039

[0256] Mature miRNA sequence: UCACAACCUCCUAGAAAGAGUAGA

[0257] Product specification: 5nmol

[0258] Purification method: Standard purification

[0259] (7) Western Blotting

[0260] The steps are the same as the experimental method in Example 1.

[0261] (8) qRT-PCR

[0262] The steps are the same as the experimental method in Example 1.

[0263] Table 11 Primer sequence information

[0264]

[0265] (9) Statistical analysis

[0266] All data were independently repeated more than three times, and the data were expressed as mean ± standard deviation (Mean ± SD). For data that followed normal distribution, the t test was used for comparison between two groups; the one-way ANOVA method was used for comparison of differences between multiple groups, with P < 0.05 as the test level. Statistical analysis and graphics were completed using Prism 8.0 software.

[0267] 2.3 Experimental Results

[0268] 2.3.1 Reduced mechanical pain in XLOC_035479- / - rats

[0269] We used the CRISPR / Cas9 system to construct XLOC_035479 knockout rats (XLOC_035479- / -), and constructed the SNI model to measure the mechanical threshold of the same animals at different time points. The results of mechanical threshold measurement showed that there was no significant difference between the WT Sham group and the KO sham group; the KO SNI group had an upregulation of mechanical pain compared with the WT SNI group, and the difference was statistically significant (P<0.5). This suggests that XLOC_035479 is involved in the progression of NP ( Figure 4 , Table 12).

[0270] Table 12 Comparison of MWT of four groups of rats at different time points (g)

[0271]

[0272] _035479siRNA

[0273] In order to explore the biological function of XLOC_035479 in PC12 cells, three siRNAs with different binding sites of XLOC_035479 were designed to transfect PC12 cells, and the transfection efficiency was detected by qRT-PCR. Finally, due to its high inhibition efficiency, si-XLOC_035479-1 was selected for further experiments ( Figure 5 ).

[0274] 2.3.3 XLOC_035479 activates autophagy in PC12 cells

[0275] As we learned earlier, XLOC_035479 was significantly upregulated in PC12 cells induced by glutamate. Bioinformatics analysis showed that XLOC_035479 was involved in cellular autophagy. Therefore, the following study explored the changes in autophagy activity of XLOC_035479 in PC12 cells. GFP-LC3 analysis confirmed that after glutamate stimulation, the autophagy activity of PC12 cells was significantly enhanced ( Figure 6 A); knockdown of XLOC_035479 can significantly inhibit glutamate-induced autophagy. qRT-PCR and Western Blotting experiments further proved that after glutamate stimulation, LC3II / I levels increased significantly, p62 levels were significantly downregulated, and autophagy was activated; while after knockdown of XLOC_035479, the results were the opposite ( Figure 6 BF). These data indicate that the expression of XLOC_035479 can activate autophagy, while inhibition of XLOC_035479 expression inhibits autophagy, suggesting that XLOC_035479 affects the development of NP by mediating autophagic activity.

[0276] 2.3.4 miR-183 inhibits autophagy in PC12 cells

[0277] Co-expression analysis has shown that XLOC_035479 interacts with miR-183. XLOC_035479 can activate autophagy in PC12 cells, so how does miR-183 affect the autophagy process in PC12 cells? It is worth exploring whether XLOC_035479 and miR-183 mediate autophagy through the ceRNA mechanism.

[0278] GFP-LC3 analysis confirmed that after glutamate stimulation, autophagic activity of PC12 cells was significantly enhanced; overexpression of miR-183 could significantly inhibit glutamate-induced autophagy, while simultaneous knockdown of XLOC_035479 and inhibition of miR-183 could enhance autophagic activity inhibited by miR-183 ( Figure 7 ). qRT-PCR and Western blot experiments further demonstrated that after glutamate stimulation, LC3II / I levels increased significantly, p62 levels decreased significantly, and autophagy was activated; however, after overexpression of miR-183, the results were the opposite. Knockdown of XLOC_035479 and inhibition of miR-183 can increase markers related to autophagy activity ( Figure 8 ). After the above analysis, XLOC_035479 and miR-183 regulated the autophagic activity of PC12 cells.

[0279] 2.4 Conclusion

[0280] In this example, we provide a series of evidences to prove that XLOC_035479 and miR-183 are new regulatory factors involved in autophagy. First, knocking down XLOC_035479 using siRNA can specifically inhibit autophagy-related markers; second, overexpressing miR-183 using miRNA mimics can specifically inhibit autophagy-related markers; third, PC12 cells were treated with miRNA inhibitors and XLOC_035479 siRNA at the same time, and it was found that miR-183 could reverse the inhibitory effect of XLOC_035479 on autophagy.

[0281] The above describes the preferred embodiments of the present invention, but it is not intended to limit the present invention. Those skilled in the art may make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present invention.

Claims

1. A marker for diagnosing neuropathic pain for use in preparing a reagent for diagnosing neuropathic pain, the marker comprising XLOC_035479, miR-183 and mTOR, wherein XLOC_035479 is located at 168847439-168849101 of chromosome 5, with a total length of 1663 bp.

2. The use according to claim 1, wherein the expression of XLOC_035479 and mTOR is upregulated, and the expression of miR-183 is downregulated.

Images