A kit for detecting nasopharyngeal carcinoma

Abstract

The present invention discloses a kit for detecting nasopharyngeal carcinoma, and the use of a reagent for methylation typing of CpG sites in the Wp promoter region of Epstein-Barr virus in saliva in the preparation of a kit for diagnosing nasopharyngeal carcinoma. The present invention establishes a method and a kit for detecting and diagnosing nasopharyngeal carcinoma for the Wp promoter region of Epstein-Barr virus, and the method and the kit greatly improve the success rate of the existing technology detection. The success rate of the nasopharyngeal carcinoma detection method using saliva samples is higher, and it has a better application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of nasopharyngeal carcinoma detection, and more specifically, to a kit for detecting nasopharyngeal carcinoma. Background Art

[0002] Nasopharyngeal carcinoma refers to a malignant tumor that occurs in the posterior wall of the nasopharynx and the pharyngeal recess. It is one of the most common malignant tumors in my country, and its incidence rate ranks first among malignant tumors of the ear, nose and throat. The five-year survival rate of early-stage nasopharyngeal carcinoma after treatment is relatively high, while the five-year survival rate of mid- and late-stage nasopharyngeal carcinoma is relatively low. Since the early stage of the disease basically has no symptoms, a large number of nasopharyngeal carcinoma patients have already progressed to the mid- and late stages of the disease when they first visit the doctor. Therefore, promoting early screening, early diagnosis and early treatment of nasopharyngeal carcinoma is the key to improving the prognosis of nasopharyngeal carcinoma.

[0003] A large number of studies have shown that the incidence of nasopharyngeal carcinoma is closely related to Epstein-Barr virus (EBV) infection. According to the "Technical Program for Tumor Screening, Early Diagnosis and Early Treatment" formulated by the Ministry of Health of my country, it is recommended to screen for plasma EBV antibodies in people aged 30-59 in areas with a high incidence of nasopharyngeal carcinoma, and to perform nasopharyngeal endoscopy or MRI clinical examinations on people with positive EBV antibodies, as well as further pathological biopsy for confirmation. However, studies have shown that the existing screening strategy based on EB virus antibodies still has some limitations, and the positive predictive value is not high, only about 4%.

[0004] Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is the most common type of heritable variation in humans, and a large number of studies have shown that it is associated with susceptibility to nasopharyngeal carcinoma: for example, the Chinese patents "Kit for detecting SNP sites of nasopharyngeal carcinoma susceptibility genes", "A functional SNP of osteopontin related to the risk of nasopharyngeal carcinoma and its application", "Kit and gene chip for predicting the risk of nasopharyngeal carcinoma", etc. SNP polymorphism is to find people susceptible to nasopharyngeal carcinoma from a genetic perspective. Its phenotype is innate and cannot reflect whether an individual has already developed nasopharyngeal carcinoma. It can only be said that individuals with dangerous phenotypes have a higher probability of developing the disease in their lifetime than other individuals. Therefore, risk prediction based on SNP polymorphism cannot directly detect the occurrence of nasopharyngeal carcinoma and is used for early screening and diagnosis of nasopharyngeal carcinoma.

[0005] Previous studies have shown that EBV is mainly transmitted among people through saliva, that is, the virus enters B lymphocytes through the epithelial cells of the oropharyngeal mucosa, and establishes a long-term systemic latent infection by infecting and transforming B lymphocytes. Such EBV-infected B lymphocytes are more likely to accumulate in the oropharyngeal lymphoid tissue. Under certain conditions, EBV lurking in B lymphocytes will be activated, lyse and release EBV, enter the oropharyngeal cells, and after further lysis and replication, release the virus into the saliva to infect new host cells.

[0006] Existing literature shows that the EB virus genome is in a highly methylated state in nasopharyngeal carcinoma, which controls gene expression and establishes a long-term latent type II infection.

[0007] Although EB virus infected people will release EB virus into saliva, the study found that the EB virus DNA in the saliva of nasopharyngeal carcinoma patients will undergo significant methylation modification, that is, in the saliva of normal people, the methylation density of most CpG sites on EB virus DNA is less than 50%, while in the saliva of nasopharyngeal carcinoma patients, the methylation density of most CpG sites on EB virus DNA is greater than 50%. According to this newly discovered rule, by conducting liquid biopsy of saliva, that is, detecting methylation typing of specific CpG sites of EB virus, non-invasive detection of nasopharyngeal carcinoma can be achieved. The currently reported detection site is located in the Cp promoter region (Chinese patent "Application of reagents for methylation typing of EB virus CpG sites in saliva in the preparation of nasopharyngeal carcinoma diagnostic kits"), but existing literature shows that the saliva EB virus load varies greatly between different individuals. Individuals with low EB virus load will face the problem of low detection success rate, which directly affects the detection effect. Therefore, the development of efficient detection technology is an important prerequisite for the application of nasopharyngeal carcinoma saliva biopsy schemes. Summary of the invention

[0008] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a kit for detecting nasopharyngeal carcinoma.

[0009] The first object of the present invention is to provide a reagent for methylation typing of CpG sites in the Wp promoter region of EB virus in saliva for use in preparing a diagnostic kit for nasopharyngeal carcinoma.

[0010] The second object of the present invention is to provide a set of detection primers for detecting nasopharyngeal carcinoma.

[0011] The third object of the present invention is to provide a set of detection probes for detecting nasopharyngeal carcinoma.

[0012] The fourth object of the present invention is to provide a kit for detecting nasopharyngeal carcinoma.

[0013] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0014] The methylation of EB virus exists in different forms in the saliva of NPC patients and healthy controls. It is speculated that the entire EB virus genome is very different in NPC patients and healthy controls. Therefore, it is proposed to use the region where the Wp promoter is located as a detection target. EB virus contains 4 internal repeat regions, namely IR1, IR2, IR3, and IR4. The longest IR1 is also the region where the Wp promoter is located. It is located at 12001bp to 35355bp of the EBV reference genome (NC_007605.1) and contains 8 tandem repeat sequences.

[0015] The present invention claims to protect the use of a reagent for methylation typing of CpG sites in the Wp promoter region of Epstein-Barr virus in saliva in the preparation of a nasopharyngeal carcinoma diagnostic kit. Specifically, the Wp promoter region is located at 12001 bp to 35355 bp of NC_007605.1 of the Epstein-Barr virus genome.

[0016] Preferably, the CpG site is one or more of the CpG sites located at 12420bp, 12428bp, 12432bp, 15492bp, 15500bp, 15504bp, 18564bp, 18572bp, 18576bp, 21636bp, 21644bp, 21648bp, 24708bp, 24716bp, 24720bp, 27780bp, 27788bp, 27792bp, 30852bp, 30860bp, 30864bp, 33924bp, 33932bp and 33936bp of the Epstein-Barr virus genome, and the Epstein-Barr virus genome is NC_007605.1.

[0017] Preferably, the reagents include detection primers and / or detection probes.

[0018] Preferably, the nucleotide sequence of the detection primer is as shown in SEQ ID NO: 1-2.

[0019] The detection primers are:

[0020] Forward primer: GGGTAGAGATAGGTAGGGT (SEQ ID NO: 1);

[0021] Reverse primer: CTCTACCTCCCAAACTTACC (SEQ ID NO: 2).

[0022] Preferably, the nucleotide sequence of the detection probe is as shown in SEQ ID NO: 3-4.

[0023] The detection probe is:

[0024] Methylation probe (probe 1): FAM-TTTCGAGGAGGCGTTCGGAGTG-BHQ1 (SEQ ID NO: 3);

[0025] Unmethylated probe (probe 2): HEX-TTTTGAGGAGGTGTTTGGAGTG-BHQ1 (SEQ ID NO: 4).

[0026] As a specific embodiment, the reagents include detection primers and detection probes.

[0027] Forward primer: GGGTAGAGATAGGTAGGGT (SEQ ID NO: 1);

[0028] Reverse primer: CTCTACCTCCCAAACTTACC (SEQ ID NO: 2);

[0029] Methylation probe (probe 1): FAM-TTTCGAGGAGGCGTTCGGAGTG-BHQ1 (SEQ ID NO: 3);

[0030] Unmethylated probe (probe 2): HEX-TTTTGAGGAGGTGTTTGGAGTG-BHQ1 (SEQ ID NO: 4).

[0031] The above detection primers and detection probes can detect all the following CpG sites, and the positions of each CpG site on the EBV genome (NC_007605.1) are:

[0032] In repeat sequence 1: 12420 bp, 12428 bp and 12432 bp;

[0033] in repeat sequence 2: 15492 bp, 15500 bp, and 15504 bp;

[0034] In repeat sequence 3: 18564 bp, 18572 bp and 18576 bp;

[0035] In repeat sequence 4: 21636 bp, 21644 bp and 21648 bp;

[0036] In repeat sequence 5: 24708 bp, 24716 bp and 24720 bp;

[0037] In repeat sequence 6: 27780 bp, 27788 bp and 27792 bp;

[0038] In repeat sequence 7: 30852 bp, 30860 bp and 30864 bp;

[0039] In repeat sequence 8: 33924bp, 33932bp and 33936bp.

[0040] The present invention also claims a group of detection primers for detecting nasopharyngeal carcinoma, whose nucleotide sequences are shown in SEQ ID NOs: 1-2.

[0041] The present invention also claims a set of detection probes for detecting nasopharyngeal carcinoma, the nucleotide sequences of which are primers shown in SEQ ID NOs: 3-4.

[0042] The present invention also claims a kit for detecting nasopharyngeal carcinoma, which contains a reagent for methylation typing of CpG sites in the Wp promoter region of EB virus in saliva.

[0043] Preferably, the CpG site is one or more of the CpG sites located at 12420bp, 12428bp, 12432bp, 15492bp, 15500bp, 15504bp, 18564bp, 18572bp, 18576bp, 21636bp, 21644bp, 21648bp, 24708bp, 24716bp, 24720bp, 27780bp, 27788bp, 27792bp, 30852bp, 30860bp, 30864bp, 33924bp, 33932bp and 33936bp of the Epstein-Barr virus genome, and the Epstein-Barr virus genome is NC_007605.1.

[0044] Preferably, the reagent is the detection primer and / or the detection probe

[0045] Preferably, it also contains probe-based q-PCR reagents.

[0046] The q-PCR reagents of the probe method are q-PCR 2×master mix and enzyme-free water.

[0047] As a specific embodiment, the kit contains the detection primers, the detection probes and q-PCR reagents of the probe method.

[0048] Wherein, the detection primer is:

[0049] Forward primer: GGGTAGAGATAGGTAGGGT (SEQ ID NO: 1);

[0050] Reverse primer: CTCTACCTCCCAAACTTACC (SEQ ID NO: 2);

[0051] The detection probe is:

[0052] Methylation probe (probe 1): FAM-TTTCGAGGAGGCGTTCGGAGTG-BHQ1 (SEQ ID NO: 3);

[0053] Unmethylated probe (probe 2): HEX-TTTTGAGGAGGTGTTTGGAGTG-BHQ1 (SEQ ID NO: 4).

[0054] How to use it:

[0055] 1. PCR reaction

[0056] The 20 μl reaction system contained 10 μl 2×master mix, 0.75 μl forward primer, 0.75 μl reverse primer, 0.8 μl methylation probe (probe 1), 0.8 μl methylation probe (probe 1) 2, 4.9 μl enzyme-free water, and 2 μl bisulfite-treated saliva DNA template.

[0057] The reaction conditions were 95 °C for 5 min, followed by 45 cycles, each cycle set at 95 °C for 15 s, 58 °C for 60 s, and finally 40 °C for 30 s.

[0058] 2. Calculate the degree of methylation:

[0059] After q-PCR is completed, the relative methylation level (ML) of the CpG site is calculated. The calculation formula of ML value is: 2 -[Ct(m)-Ct(u)] ,

[0060] CT m is the CT value after amplification of the amplification primer and methylation probe at the site, CT u It is the CT value after amplification of the site by the amplification primer and the non-methylated probe.

[0061] If only one of the CT values ​​is detected after q-PCR is completed for the sample, the other CT value is defined as 45 and substituted into the calculation formula to calculate the relative methylation degree. If neither CT value is detected after q-PCR is completed for the sample, the sample is defined as a test failure.

[0062] 3. Result determination

[0063] ML=1 was set as the cutoff value, that is, ML>1, reflecting that the number of methylated EB virus DNA molecules in saliva was greater than that of unmethylated EB virus DNA molecules, indicating the occurrence of nasopharyngeal carcinoma; conversely, ML<1 indicated that there was no occurrence of nasopharyngeal carcinoma; ML=1 indicated a suspected nasopharyngeal carcinoma patient.

[0064] Compared with the prior art, the present invention has the following beneficial effects:

[0065] The present invention establishes a method and a kit for detecting and diagnosing nasopharyngeal carcinoma for the Wp promoter region of Epstein-Barr virus, which greatly improves the success rate of the existing technology detection, making the success rate of the nasopharyngeal carcinoma detection method using saliva samples higher and having better application prospects. DETAILED DESCRIPTION

[0066] The present invention is further described in detail below in conjunction with the specification and specific examples, which are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0067] Example 1 A method for diagnosing nasopharyngeal carcinoma by detecting the methylation typing of CpG sites in the Wp promoter region of Epstein-Barr virus in saliva samples

[0068] 1. Primer and probe sequences designed for the Wp promoter region (12001bp to 35355bp of EB virus genome NC_007605.1):

[0069] Forward primer: GGGTAGAGATAGGTAGGGT (SEQ ID NO: 1);

[0070] Reverse primer: CTCTACCTCCCAAACTTACC (SEQ ID NO: 2);

[0071] Methylation probe (probe 1): FAM-TTTCGAGGAGGCGTTCGGAGTG-BHQ1 (SEQ ID NO: 3);

[0072] Unmethylated probe (probe 2): HEX-TTTTGAGGAGGTGTTTGGAGTG-BHQ1 (SEQ ID NO: 4).

[0073] 2. Reaction system and reaction conditions of PCR reaction

[0074] The 20 μl reaction system contains 10 μl 2×master mix, 0.75 μl forward primer, 0.75 μl reverse primer, 4.9 μl enzyme-free water, and 2 μl bisulfite-treated saliva DNA.

[0075] The reaction conditions were 95 °C for 5 min, followed by 45 cycles, each cycle set at 95 °C for 15 s, 58 °C for 60 s, and finally 40 °C for 30 s.

[0076] 3. Calculate the degree of methylation:

[0077] After q-PCR is completed, the relative methylation level (ML) of the CpG site is calculated. The calculation formula of ML value is: 2 -[Ct(m)-Ct(u)] ,

[0078] CT m is the CT value after amplification of the amplification primer and methylation probe at the site, CT u It is the CT value after amplification of the amplification primer and non-methylation probe of the site. If only one of the CT values ​​is detected after q-PCR is completed for the sample, the other CT value is defined as 45 and substituted into the calculation formula to calculate the relative methylation degree. If neither CT value is detected after q-PCR is completed for the sample, the sample is defined as a test failure.

[0079] 4. Result determination

[0080] Since the methylation properties of EBV in the saliva of NPC patients and healthy controls are quite different, ML=1 was directly set as the cutoff value, that is, ML>1, reflecting that the number of methylated EBV DNA molecules in the saliva is greater than the number of unmethylated EBV DNA molecules, indicating the occurrence of NPC; conversely, ML<1 indicates that there is no occurrence of NPC; ML=1 indicates that the patient is suspected of NPC.

[0081] Comparative Example 1 A method for diagnosing nasopharyngeal carcinoma by detecting the methylation typing of CpG sites in the Cp promoter region of EBV in saliva samples

[0082] 1. Primer and probe sequences designed for Cp:

[0083] Forward primer: GAGTGTTATTTTTGGAATAGTAG,

[0084] Reverse primer: TTAAACTCTCTTATTAACTATAATC,

[0085] Methylation probe (probe 1): FAM-TGAATTTTGTTGGCGGGAGAAGGA-BHQ1, unmethylation probe (probe 2): HEX-TGAATTTTGTTGGTGGGAGAAGGA-BHQ1;

[0086] 2. Reaction system and reaction conditions of PCR reaction

[0087] Same as Example 1.

[0088] 3. Calculate the degree of methylation:

[0089] Same as Example 1.

[0090] 4. Result determination

[0091] Same as Example 1.

[0092] Example 2 Comparison of detection limits for methylation detection in Wp promoter region and Cp promoter region

[0093] 1. Experimental Methods

[0094] The DNA of nasopharyngeal carcinoma biopsy tissue was used as a positive reference. The DNA sample of nasopharyngeal carcinoma biopsy tissue was diluted 10 times according to the EB virus content in the sample, and 6 dilutions were continuously performed, and the samples were tested simultaneously using the methods of Example 1 and Comparative Example 1. Both methods were biologically repeated 5 times.

[0095] 2. Experimental Results

[0096] The results are shown in Table 1 below. The experimental results show that: (1) The detection method of Example 1 has a lower CT value than that of Comparative Example 1, with a difference of about 3 CT values, that is, a difference of about 8 times; (2) The detection method of Example 1 can detect a lower number of EB virus methylation conditions, which is almost an order of magnitude higher than the detection method of Comparative Example 1.

[0097] Table 1:

[0098]

[0099]

[0100] Example 3 Comparison of the detection success rate and detection failure rate of methylation detection of Wp promoter region and Cp promoter region

[0101] 1. Experimental Methods

[0102] The methods of Example 1 and Comparative Example 1 were used to detect saliva DNA samples from 137 NPC patients and 150 non-NPC controls, all of whom were recruited from the nasopharyngeal clinic of the Cancer Center of Sun Yat-sen University. Among them, 137 NPC patients were diagnosed as NPC patients after nasopharyngeal biopsy, and 150 non-NPC controls were diagnosed as nasopharyngeal mucositis after nasopharyngeal biopsy to exclude NPC. The detection success rate and detection failure rate were calculated.

[0103] Among them, the success rate of detection = the number of samples with successful detection / the total number of samples detected,

[0104] The failure rate of detection = the number of samples that failed to be detected / the total number of samples detected.

[0105] 2. Experimental Results

[0106] 1. Comparison of test success rate and test failure rate

[0107] The results are shown in Table 2 below.

[0108] Table 2:

[0109]

[0110] In the nasopharyngeal carcinoma patient group, the detection success rate of the detection method of Example 1 was 64.23%, and the detection success rate of the detection method of Comparative Example 1 was 45.26%. The detection success rate of the detection method of Example 1 was about 19% higher than that of the detection method of Comparative Example 1.

[0111] In the non-nasopharyngeal carcinoma control group, the detection success rate of the detection method of Example 1 was 76.67%, and the detection success rate of the detection method of Comparative Example 1 was 65.33%. The detection success rate of the detection method of Example 1 was about 11% higher than that of the detection method of Comparative Example 1.

[0112] Taking NPC patients and non-NPC controls as a whole, the detection success rate of the detection method of Example 1 was 70.73%, and the detection success rate of the detection method of Comparative Example 1 was 55.75%. The detection success rate of the detection method of Example 1 was about 15% higher than that of the detection method of Comparative Example 1.

[0113] 2. Comparison of sensitivity and specificity

[0114] The results are shown in Table 3 below.

[0115] Table 3:

[0116]

[0117] Taking COV=1 as the cutoff value, a value greater than 1 is judged as nasopharyngeal carcinoma, and a value less than 1 is judged as non-nasopharyngeal carcinoma. In the samples successfully detected by the method of Example 1, the sensitivity was 75%, the specificity was 97.39%, the area under the curve (AUC) was 0.8771, and the Youden index was 0.7239. Compared with the detection method of Comparative Example 1, its area under the curve and Youden index were both higher, showing a better diagnostic effect.

[0118] Example 5 A kit for diagnosing nasopharyngeal carcinoma by detecting the methylation status of the EB virus Wp promoter region in saliva samples

[0119] 1. Composition

[0120] Detection probes, detection probes and probe-based q-PCR reagents,

[0121] Among them, the detection primers are:

[0122] Forward primer: GGGTAGAGATAGGTAGGGT (SEQ ID NO: 1);

[0123] Reverse primer: CTCTACCTCCCAAACTTACC (SEQ ID NO: 2);

[0124] The detection probes are:

[0125] Methylation probe (probe 1): FAM-TTTCGAGGAGGCGTTCGGAGTG-BHQ1 (SEQ ID NO: 3);

[0126] Unmethylated probe (probe 2): HEX-TTTTGAGGAGGTGTTTGGAGTG-BHQ1 (SEQ ID NO: 4).

[0127] The q-PCR reagents for the probe method are 2× master mix and enzyme-free water.

[0128] 2. Usage

[0129] 1. PCR reaction

[0130] The 20 μl reaction system contained 10 μl 2×master mix, 0.75 μl forward primer, 0.75 μl reverse primer, 0.8 μl methylation probe (probe 1), 0.8 μl methylation probe (probe 1) 2, 4.9 μl enzyme-free water, and 2 μl bisulfite-treated saliva DNA.

[0131] The reaction conditions were 95 °C for 5 min, followed by 45 cycles, each cycle set at 95 °C for 15 s, 58 °C for 60 s, and finally 40 °C for 30 s.

[0132] 2. Calculate the degree of methylation:

[0133] After q-PCR is completed, the relative methylation level (ML) of the CpG site is calculated. The calculation formula of ML value is: 2 -[Ct(m)-Ct(u)] ,

[0134] CT m is the CT value after amplification of the amplification primer and methylation probe at the site, CT u It is the CT value after amplification of the site by the amplification primer and the non-methylated probe.

[0135] If only one of the CT values ​​is detected after q-PCR is completed for the sample, the other CT value is defined as 45 and substituted into the calculation formula to calculate the relative methylation density. If neither CT value is detected after q-PCR is completed for the sample, the sample is defined as a test failure.

[0136] 3. Result determination

[0137] ML=1 was set as the cutoff value, that is, ML>1, indicating that the number of methylated EB virus DNA molecules in saliva was greater than the number of unmethylated EB virus DNA molecules, indicating the occurrence of nasopharyngeal carcinoma; conversely, ML<1 indicated that there was no occurrence of nasopharyngeal carcinoma; ML=1 indicated a suspected nasopharyngeal carcinoma patient.

Claims

1. Use of a reagent for methylation typing of CpG sites in the Wp promoter region of Epstein-Barr virus in saliva in the preparation of a diagnostic kit for nasopharyngeal carcinoma, characterized in that: The CpG sites are CpG sites located at 12420bp, 12428bp, 12432bp, 15492bp, 15500bp, 15504bp, 18564bp, 18572bp, 18576bp, 21636bp, 21644bp, 21648bp, 24708bp, 24716bp, 24720bp, 27780bp, 27788bp, 27792bp, 30852bp, 30860bp, 30864bp, 33924bp, 33932bp and 33936bp of the Epstein-Barr virus genome, and the Epstein-Barr virus genome is NC_007605.

1.

2. The use according to claim 1, characterized in that: The reagents include detection primers and detection probes.

3. The use according to claim 2, characterized in that: The nucleotide sequences of the detection primers are shown in SEQ ID NOs: 1-2.

4. The use according to claim 2, characterized in that: The nucleotide sequence of the detection probe is shown in SEQ ID NOs: 3-4.

5. A kit for detecting nasopharyngeal carcinoma, characterized in that: The invention contains a reagent for methylation typing of CpG sites in the Wp promoter region of Epstein-Barr virus in saliva, wherein the CpG sites are CpG sites located at 12420bp, 12428bp, 12432bp, 15492bp, 15500bp, 15504bp, 18564bp, 18572bp, 18576bp, 21636bp, 21644bp, 21648bp, 24708bp, 24716bp, 24720bp, 27780bp, 27788bp, 27792bp, 30852bp, 30860bp, 30864bp, 33924bp, 33932bp and 33936bp of the Epstein-Barr virus genome, and the Epstein-Barr virus genome is NC_007605.

1.

6. The kit according to claim 5, characterized in that The reagents include detection primers and detection probes.

7. The kit according to claim 6, characterized in that The nucleotide sequences of the detection primers are shown in SEQ ID NOs: 1-2.

8. The kit according to claim 6, characterized in that The nucleotide sequence of the detection probe is shown in SEQ ID NO: 3-4.

Images