Aspergillus oryzae with multiple resistance and its isolation method and application

Abstract

The application discloses a multi-resistant aspergillus oryzae and a separation method and application thereof, and the aspergillus oryzae is a strain A. oryzae TH004, which is preserved in the China General Microbiological Culture Collection Center and has a preservation number of CGMCC No. 40448. The aspergillus oryzae is obtained through separation, purification and screening from Daqu, and has characteristics of high saccharifying power, high temperature resistance, acid resistance and ethanol resistance. The application can be applied to the production of wine, especially Daqu, and can improve the saccharifying power. The application has important values in aspects of saving grain, improving efficiency, energy saving and emission reduction.

Description

Technical Field

[0001] This invention relates to the field of Aspergillus oryzae, specifically to an Aspergillus oryzae with multiple tolerances, its isolation method, and its applications. Background Technology

[0002] Baijiu (Chinese liquor) enterprises consume a large amount of grain annually for brewing. Improving production efficiency and reducing grain and energy consumption are of significant value to both enterprises and society. Starter culture (Yeast starter) provides essential microorganisms for baijiu brewing, and its saccharification power determines the utilization rate of grain and the yield of baijiu. Developing high-saccharification-power molds and using them in starter production can improve the saccharification power of starter, thereby saving grain, reducing energy consumption, and increasing benefits for both enterprises and society.

[0003] The production of yeast starter and the fermentation process in cellars often involve harsh environmental conditions, such as high temperature, low pH, and high alcohol content. These conditions severely affect the growth and survival of molds, thus impacting their application effectiveness. It is difficult for a single mold strain to simultaneously possess characteristics such as high saccharification power, high temperature resistance, acid resistance, and ethanol resistance. Therefore, developing superior molds that can meet all these conditions remains an important research direction.

[0004] Furthermore, factors such as different regions, raw materials, and production processes can also affect the application effectiveness of molds. Enriching the microbial resource bank and increasing the availability of high-quality mold resources for enterprises is also of great significance in solving these problems. Summary of the Invention

[0005] The purpose of this invention is to provide a multi-resistance Aspergillus oryzae, its isolation method, and its application, in order to solve the problems of insufficient saccharification power and adaptability of existing Aspergillus oryzae.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A multi-tolerant Aspergillus oryzae strain, A. oryzae TH004, was deposited at the China General Microbiological Culture Collection Center on December 25, 2022, with accession number CGMCC No. 40448.

[0008] The strain A. oryzae TH004 grows well at 25-45℃.

[0009] The strain A. oryzae TH004 grows well under conditions of pH 2-7.

[0010] The strain A. oryzae TH004 grows well under conditions of 0-6% vol ethanol.

[0011] The culture conditions for the bran koji produced by inoculating the strain A. oryzae TH004 were optimized using response surface methodology.

[0012] Furthermore, through response surface methodology optimization, it was determined that the saccharification power of the bran koji produced by the strain A. oryzae TH004 was significantly improved under the conditions of 28°C, 49.54% moisture content, and 6.62% inoculum size.

[0013] A method for isolating Aspergillus oryzae with multiple tolerances includes the following steps:

[0014] Step 1: Separate and purify molds from high-saccharification-capacity Daqu (a type of starter culture);

[0015] Step 2: Detect the saccharification power of the mold obtained in Step 1, and screen out Aspergillus oryzae strains with high saccharification power based on the detection results.

[0016] Step 3: Test the tolerance of Aspergillus oryzae obtained in Step 2, and screen the Aspergillus oryzae strain with multiple tolerances based on the test results.

[0017] The application of a multi-tolerant Aspergillus oryzae in alcohol production to improve the saccharification power of alcohol raw materials.

[0018] A method for improving the saccharification power of yeast involves adding Aspergillus oryzae, which has multiple tolerances, to the yeast raw materials to improve the saccharification power of the yeast.

[0019] Compared with the prior art, the advantages of the present invention are:

[0020] This invention provides a *Aspergillus oryzae* strain with multiple excellent properties, including high temperature resistance, acid resistance, ethanol resistance, and high saccharification power, as well as its isolation method and optimization method for wheat bran koji cultivation conditions. The *Aspergillus oryzae* strain of this invention can be applied to alcoholic beverages, especially koji, and can improve saccharification power. This invention has significant value in terms of saving grain, improving efficiency, and reducing energy consumption and emissions. Attached Figure Description

[0021] Figure 1 This is a comparison chart of saccharification power in molds. Note: Different lowercase letters indicate significant differences (P < 0.05); all values ​​in the chart are repeated more than 3 times.

[0022] Figure 2 Agarose gel electrophoresis image of PCR amplification of ITS1-5.8S-ITS2. Where: -, negative control; A, TH001; B, TH002; C, TH003; D, TH004; E, TH005; F, TH006; G, TH007; H, TH008.

[0023] Figure 3Agarose gel electrophoresis images of PCR amplification of D1-D2. Wherein: -, negative control; A, TH001; B, TH002; C, TH003; D, TH004; E, TH005; F, TH006; G, TH007; H, TH008.

[0024] Figure 4 Phylogenetic tree diagram based on ITS1-5.8S-ITS2 sequence information.

[0025] Figure 5 Phylogenetic tree diagram based on D1-D2 sequence information.

[0026] Figure 6 This is a comparison graph showing the growth of mold at different temperatures. Note: Different lowercase letters indicate significant differences (P < 0.05); all values ​​in the graph are repeated more than three times.

[0027] Figure 7 This is a comparison of mold growth at different pH levels. Note: Different lowercase letters indicate significant differences (P < 0.05); all values ​​in the figure are repeated more than three times.

[0028] Figure 8 This is a comparison of mold growth under different ethanol concentrations. Note: Different lowercase letters indicate significant differences (P < 0.05); all values ​​in the figure are repeated more than three times.

[0029] Figure 9 This is a comparison of the saccharification power of molds at different culture temperatures. Note: Different lowercase letters indicate significant differences (P < 0.05); all values ​​in the figure are repeated more than three times.

[0030] Figure 10 This is a comparison of the saccharification power of molds at different pH levels. Note: Different lowercase letters indicate significant differences (P < 0.05); all values ​​in the figure are repeated more than three times.

[0031] Figure 11 The graph shows the effect of incubation temperature on the saccharification power of TH004 in the production of wheat bran koji. Note: All values ​​in the graph are repeated at least three times.

[0032] Figure 12 The graph shows the effect of moisture content on the saccharification power of TH004 in the production of bran koji. Note that all values ​​in the graph are repeated at least three times.

[0033] Figure 13 The graph shows the effect of inoculum amount on the saccharification power of TH004 in the production of bran koji. All values ​​in the graph are repeated at least three times.

[0034] Figure 14 This is a surface plot and contour plot showing the interaction between temperature and water content.

[0035] Figure 15 Surface plots and contour plots showing the interaction between temperature and inoculum amount.

[0036] Figure 16 The graphs and contour plots show the interaction between moisture content and inoculum amount.

[0037] Figure 17 A comparison of the saccharification power of the bran koji prepared for TH004 before and after optimization. * indicates p < 0.05; all values ​​in the figure are repeated more than three times. Detailed Implementation

[0038] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0039] Example 1: Isolation and Identification of Highly Saccharifying Fungi

[0040] 1. Selection of high-saccharification-strength Daqu (a type of starter culture)

[0041] The laboratory possessed seven different types of strong-aroma Daqu (a type of starter culture), numbered DQ1, DQ2, DQ3, DQ4, DQ5, DQ6, and DQ7. The saccharification power of each of the seven Daqu types was measured, and the results are shown in Table 1. Daqu DQ2 and DQ7 exhibited higher saccharification powers, reaching 626.82 U / g and 442.77 U / g, respectively. Therefore, in subsequent screening for high-saccharification-power molds, isolation was primarily conducted from Daqu DQ2 and DQ7.

[0042] Table 1 Comparison of saccharification power of different types of Daqu (a type of starter culture)

[0043]

[0044] 2. Isolation and purification of strains

[0045] Strains were isolated and purified by repeated streak plating from Daqu (a type of Chinese liquor).

[0046] 3. Screening of strains with high saccharification ability

[0047] The presence of hydrolytic enzymes in molds was determined using the clear zone method. Isolated molds were inoculated onto PDA agar medium containing soluble starch and cultured for 3 days. Iodine solution was added, and the size of the clear zone around the colony was observed based on the blue color change of starch upon contact with iodine to determine the presence and activity of hydrolytic enzymes and saccharifying enzymes. The initially screened molds were inoculated into bran koji and cultured for 3 days. Saccharification power was then detected using the DNS method. After extensive experiments, eight strains with high saccharification power were finally obtained: TH001, TH002, TH003, TH004, TH005, TH006, TH007, and TH008. Their saccharification power is as follows: Figure 1 As shown, their saccharification power is all above 1100 U / g.

[0048] 4. Identification of strains with high saccharification ability

[0049] 4.1 Extraction of genomic DNA from the strain

[0050] Genomic DNA was extracted from TH001, TH002, TH003, TH004, TH005, TH006, TH007, and TH008 using a fungal genomic DNA rapid extraction kit.

[0051] 4.2 PCR amplification

[0052] Genomic DNA was used as a template for PCR amplification. Universal primers ITS1 / ITS4 and NL1 / NL4 were used to amplify the DNA fragments in the ITS1-5.8S-ITS2 and D1-D2 regions, respectively. The PCR reaction system is shown in Table 2. The PCR amplification program was: 96℃ for 10 min; 98℃ for 10 s, 53℃ for 15 s, 72℃ for 15 s, 35 cycles; 72℃ for 10 min; stored at 16℃.

[0053] Table 2 Preparation of PCR reaction solution

[0054]

[0055]

[0056] 4.3 Gel electrophoresis detection of amplification products

[0057] Take 4 μL of the amplification product, add 1 μL of loading buffer, mix well, and then perform electrophoresis on a 1% agarose gel. The results are as follows: Figure 2 , Figure 3 As shown, the amplification bands of the 8 strains were all relatively simple, with lengths ranging from 750 to 1000 bp.

[0058] 4.4 DNA sequencing and sequence alignment

[0059] The purified PCR products were sent to BGI Genomics Co., Ltd. in Shanghai for sequencing, and the ITS1-5.8S-ITS2 and D1-D2 sequences of TH001, TH002, TH003, TH004, TH005, TH006, TH007, and TH008 were obtained. The sequence information is as follows.

[0060] >TH001's ITS1-5.8S-ITS2 sequence:

[0061] TGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCA

[0062] CCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGC

[0063] CGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCT

[0064] GTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTC

[0065] AACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

[0066] TAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCAC

[0067] ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTG

[0068] CCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA

[0069] CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGG

[0070] GCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCA

[0071] ATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

[0072] GCATAT

[0073] >ITS1 - 5.8S - ITS2 sequence of TH002:

[0074] TGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCA

[0075] CCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGC

[0076] CGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCT

[0077] GTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTC

[0078] AACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

[0079] TAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCAC

[0080] ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTG

[0081] CCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA

[0082] CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGG

[0083] GCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCA

[0084] ATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

[0085] GCAT

[0086] >ITS1 - 5.8S - ITS2 sequence of TH003:

[0087] CGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACC

[0088] CGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCG

[0089] GGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGT

[0090] CTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAA

[0091] CAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATA

[0092] ACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATT

[0093] GCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCC

[0094] ATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACG

[0095] GGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGC

[0096] TTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAAT

[0097] CTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGC

[0098] ATAT

[0099] >ITS1-5.8S-ITS2 sequence of TH004:

[0100] TGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCA

[0101] CCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGC

[0102] CGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCT

[0103] GTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTC

[0104] AACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

[0105] TAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCAC

[0106] ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTG

[0107] CCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA

[0108] CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGG

[0109] GCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCA

[0110] ATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

[0111] GCATATCAAT

[0112] >ITS1 - 5.8S - ITS2 sequence of TH005:

[0113] TGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCA

[0114] CCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGC

[0115] CGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCT

[0116] GTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTC

[0117] AACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

[0118] TAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCAC

[0119] ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTG

[0120] CCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA

[0121] CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGG

[0122] GCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCA

[0123] ATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

[0124] GCATA

[0125] >ITS1-5.8S-ITS2 sequence of TH006:

[0126] TGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCA

[0127] CCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGC

[0128] CGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCT

[0129] GTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTC

[0130] AACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

[0131] TAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCAC

[0132] ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTG

[0133] CCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA

[0134] CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGG

[0135] GCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCA

[0136] ATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

[0137] GCAT

[0138] >ITS1 - 5.8S - ITS2 sequence of TH007:

[0139] ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTC

[0140] CCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGC

[0141] CGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAAC

[0142] TCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACT

[0143] TTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATG

[0144] CGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACG

[0145] CACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTG

[0146] CTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGG

[0147] GGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTAT

[0148] GGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAA

[0149] ATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACT

[0150] TAAGCATAT

[0151] >ITS1 - 5.8S - ITS2 sequence of TH008:

[0152] TGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCA

[0153] CCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGC

[0154] CGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCT

[0155] GTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTC

[0156] AACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

[0157] TAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCAC

[0158] ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTG

[0159] CCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA

[0160] CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGG

[0161] GCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCA

[0162] ATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

[0163] GCATA

[0164] >Sequence of D1 / D2 of TH001:

[0165] GCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAG

[0166] CGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAAT

[0167] TTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGG

[0168] CCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTG

[0169] TGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGT

[0170] GGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAG

[0171] TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCAC

[0172] GTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTT

[0173] CAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTT

[0174] TGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTA

[0175] TAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCA

[0176] CGGACGCTGGCATAATGGTCGTAAACGACCCGT

[0177] >D1 / D2 sequence of TH002:

[0178] GAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGG

[0179] CAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTG

[0180] CAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCG

[0181] TCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGA

[0182] AGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGT

[0183] AAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAG

[0184] AGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTG

[0185] AAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAG

[0186] CCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGG

[0187] GCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAG

[0188] CCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGG

[0189] ACGCTGGCATAATGGTCGTAAACGACCCGTCT

[0190] >D1 / D2 sequence of TH003:

[0191] AGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGC

[0192] AAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGC

[0193] AGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGT

[0194] CAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAA

[0195] GCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTA

[0196] AATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGA

[0197] GTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGA

[0198] AATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGC

[0199] CGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGG

[0200] CGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGC

[0201] CGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGG

[0202] ACGCTGGCATAATGGTCGTAAACGACCCG

[0203] >Sequence of D1 / D2 of TH004:

[0204] AGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAA

[0205] GCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAA

[0206] TTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGG

[0207] CCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTG

[0208] TGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGT

[0209] GGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAG

[0210] TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCAC

[0211] GTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTT

[0212] CAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTT

[0213] TGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTA

[0214] TAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCA

[0215] CGGACGCTGGCATAATGGTCGTAAACGACCCGTCTTG

[0216] >Sequence of D1 / D2 of TH005:

[0217] AGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAA

[0218] GCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAA

[0219] TTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGG

[0220] CCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTG

[0221] TGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGT

[0222] GGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAG

[0223] TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCAC

[0224] GTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTT

[0225] CAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTT

[0226] TGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTA

[0227] TAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCA

[0228] CGGACGCTGGCATAATGGTCGTAAACGACCCGTCTTG

[0229] >D1 / D2 sequence of TH006:

[0230] CGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGC

[0231] GGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATT

[0232] TGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGC

[0233] CGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGT

[0234] GAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTG

[0235] GTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGT

[0236] AGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCAC

[0237] GTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTT

[0238] CAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTT

[0239] TGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTA

[0240] TAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCA

[0241] CGGACGCTGGCATAATGGTCGTAAACGACCCGTCT

[0242] > D1 / D2 sequence of TH007:

[0243] TGGTCCGTGGGTTCAAGACGGGTCGTTTACGACCATTATGCCAGCGTCCGT

[0244] GCCGAAGCGCGTTCCTCGGTCCAGGCTGGCCGCATTGCACTCCCGGCTATA

[0245] AGGTGCCCCGGAGGGCACTACATTCCGGGAGCCTTTGACCGGCCGCCCAA

[0246] ACCGACGCTGGCCCGCCCCCAGGGAAGTACACCGGCACGAATGCCGGCTG

[0247] AACCCTGGAGGCGAGTCTGGTCGCAAGCGCTTCCCTTTCAACAATTTCACG

[0248] TGCTTTTTAACTCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTG

[0249] TGCGCTATCGGTCTCCGGCCAGTATTTAGCTTTAGATGAAATTTACCACCCA

[0250] TTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGG

[0251] GCGCGGACACCCCATCCCAGACGGGATTCTCACCCTCTCTGACGGCCCGTT

[0252] CCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACA

[0253] ATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCAC

[0254] TCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTTTTTGATA

[0255] TGCA

[0256] >D1 / D2 sequence of TH008:

[0257] AGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAA

[0258] GCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAA

[0259] TTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGG

[0260] CCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTG

[0261] TGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGT

[0262] GGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAG

[0263] TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCAC

[0264] GTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTT

[0265] CAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTT

[0266] TGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTA

[0267] TAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCA

[0268] CGGACGCTGGCATAATGGTCGTAAACGACCCG

[0269] The sequences were submitted to the NCBI database for BLAST alignment, and the results showed that all eight molds were Aspergillus oryzae. A phylogenetic tree was constructed based on their sequences. Figure 4 , Figure 5 The results showed that they all clustered with *A. oryzae*. Therefore, the above 8 molds were all *A. oryzae*, and were named *A. oryzae TH001*, *A. oryzae TH002*, *A. oryzae TH003*, *A. oryzae TH004*, *A. oryzae TH005*, *A. oryzae TH006*, *A. oryzae TH007*, and *A. oryzae TH008*, respectively.

[0270] Example 2: Tolerance test of high-saccharification fungi and optimization of bran koji culture conditions

[0271] 1. Mold tolerance test

[0272] 1.1 High temperature resistance

[0273] The mold spore suspension was prepared to a concentration of 10. 6 1 mL of spore suspension was inoculated into PDA liquid medium and incubated at 25℃, 30℃, 35℃, 40℃, and 45℃ at 180 rpm on shakers. Samples were taken after 72 hours, dried in an oven, and the dry weight was measured. Figure 6 As shown, the eight mold strains grew well at temperatures ranging from 25 to 40°C; however, at 45°C, the dry weight of the molds decreased significantly. In conclusion, all eight mold strains can grow within a temperature range of 25–45°C.

[0274] 2.2 Acid resistance

[0275] The mold spore suspension was prepared to a concentration of 10. 6 1 mL of spore suspension was inoculated into PDA liquid medium at pH 2, 3, 4, 5, 6, or 7 and incubated at 28°C and 180 rpm. Samples were taken after 72 hours, dried in an oven, and the dry weight was determined. Figure 7 As shown, all eight mold species can grow within a pH range of 2–7, indicating that they can adapt to the acidic environment of brewing.

[0276] 2.3 Ethanol resistance

[0277] The mold spore suspension was prepared to a concentration of 10. 61 mL of spore suspension was inoculated into PDA liquid medium with ethanol contents of 0%, 2%, 4%, and 6% vol, and cultured at 28°C and 180 rpm. Samples were taken after 72 hours, dried in an oven, and the dry weight was determined. Figure 8 As shown, all eight mold strains exhibited good ethanol tolerance when the ethanol volume fraction ranged from 0% to 4%. However, when the ethanol volume fraction was 6%, the dry weight of the molds decreased significantly, with TH002 and TH004 showing higher dry weights than the other molds. Therefore, TH002 and TH004 possess higher ethanol tolerance.

[0278] 2. Effects of cultivation conditions on the saccharification power of bran koji

[0279] 2.1 Effect of temperature on the saccharification power of bran koji

[0280] Spore suspensions of 8 mold strains were prepared to a concentration of 10. 6 1 mL of spore suspension was inoculated onto wheat bran to prepare bran koji, and then incubated in constant temperature incubators at 25℃, 30℃, 35℃, 40℃, and 45℃ respectively. After 72 h, the saccharification power of the bran koji was detected using the DNS method. Figure 9 As shown, the saccharification power of bran koji cultured from the eight mold strains was high at 25–35℃; at 40℃, the saccharification power of the bran koji decreased; at 45℃, the saccharification power of TH001, TH004, TH006, and TH007 was higher than that of other strains. Therefore, the temperature has a relatively small impact on the saccharification power of bran koji prepared from TH001, TH004, TH006, and TH007.

[0281] 2.2 Effect of pH on the saccharification power of bran koji

[0282] Spore suspensions of 8 mold strains were prepared to a concentration of 10. 6 1 mL of spore suspension was inoculated onto wheat bran to prepare bran koji, which was then placed in bran koji at pH 3, 4, 5, 6, and 7 and incubated at 28°C. After 72 hours, the saccharification power of the bran koji was detected using the DNS method. Figure 10 As shown, the saccharification power of bran koji cultured by the eight mold strains was relatively stable at pH 4–7; however, the saccharification power decreased at pH 3. The bran koji prepared by TH001, TH002, TH003, TH004, TH006, and TH008 showed higher saccharification power than other strains at different pH levels.

[0283] Based on the above data on the heat resistance, acid resistance, ethanol resistance, and saccharification power of the mold, mold TH004 is superior in all aspects. Therefore, it was selected as the strain for subsequent optimization and application. The mold A. oryzae TH004 in this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit name is A. oryzae TH004, the accession number is CGMCC No. 40448, and the deposit date is December 25, 2022.

[0284] 3. Optimization of wheat bran koji culture conditions for mold TH004 using response surface methodology.

[0285] 3.1 Single-factor experiment

[0286] The effects of culture temperature, moisture content, and inoculum size on the saccharification power of bran koji inoculated with mold were investigated. Figures 11-13 These three single factors all significantly affected the saccharification power of TH004-inoculated bran koji. Therefore, they were used as factors for subsequent response surface methodology optimization.

[0287] 3.2 Box-Behnken Experiment on Impact Factor

[0288] Following the central composite design principle, a three-factor, three-level Box-Behnken experiment was designed. Temperature, moisture content, and inoculum size were used as independent variables, and the coding levels of the experimental factors are shown in Table 3.

[0289] Table 3 Factors and Levels in Response Surface Analysis

[0290]

[0291] The experiment consisted of 17 experimental points, with the saccharification power after 72 hours of bran koji cultivation as the response value. The experimental scheme and results are shown in Table 4.

[0292] Table 4. Response Surface Analysis Scheme and Experimental Results

[0293]

[0294]

[0295] The following equation was obtained by performing multiple regression analysis on the above results:

[0296] Saccharification power = 1717.65 + 9.36*A - 62.32*B - 18.82*C - 2.67*A*B - 4.52*A*C

[0297] +10.50*B*C-327.04*A 2 -340.42*B 2-301.92*C 2

[0298] Analysis of variance was performed on the model, and the results are shown in Table 5. The model F-value is 237.48, P < 0.0001, indicating that the model is highly significant; the lack-of-fit term P = 0.7015 > 0.05, indicating that the model lack of fit is not significant, suggesting that the experimental error is mainly caused by random error.

[0299] The model's coefficient of determination R 2 =0.9967, adjustment factor R 2 (adj.R 2 The model's accuracy (Adeq Precision = 0.9925) indicates that it can explain 99.25% of the variation in saccharification power during the cultivation of koji made from wheat bran inoculated with TH004. The signal-to-noise ratio (Adeq Precision = 36.100) is greater than 4, indicating high goodness of fit and reliability. Therefore, this model can be used to analyze and predict the saccharification power of koji made from wheat bran inoculated with TH004 mold.

[0300] The CV value, or coefficient of variation of the saccharification power of bran koji, represents the accuracy of the experiment. The CV value of this model is 2.11%, which is relatively small, indicating that the experiment is reliable and has certain statistical significance.

[0301] Table 5. Results of ANOVA for the Regression Model

[0302]

[0303] Based on the experimental results, surface diagrams and contour maps of the interactions between various factors were drawn. Figure 14-16 The contour plot visually illustrates the relationship between any two factors and the response value of saccharification power. Prediction results indicate that the response value of saccharification power has an extreme point, namely, 1720.9 U / g. At this point, the corresponding values ​​for the three independent variables are temperature 28.04℃, moisture content 49.54%, and inoculum size 6.62%.

[0304] 3.3 Model Validation

[0305] To verify whether the saccharification power of the bran koji made from TH004 inoculated bran met the predicted results, the bran koji was cultured under the predicted conditions and the saccharification power was measured after 72 hours of culture. The results are as follows: Figure 17 As shown, the glycemic power before optimization was 1682.905 U / g; the glycemic power after optimization was 1834.257 U / g, which was 8.99% higher than that before optimization.

[0306] This invention selects high-saccharification-capacity Daqu (a type of starter culture), and isolates eight high-saccharification-capacity bacterial strains from it. After molecular biological identification, these strains were determined to be *Aspergillus oryzae*, and named A.oryzae TH001, A.oryzae TH002, A.oryzae TH003, A.oryzae TH004, A.oryzae TH005, A.oryzae TH006, A.oryzae TH007, and A.oryzae TH008, respectively. By testing their heat resistance, acid resistance, and ethanol resistance, a high-saccharification-capacity mold, TH004, was obtained, exhibiting resistance to all three conditions. The saccharification power of TH004-based bran koji was optimized using response surface methodology. When the koji culture conditions were 28℃, 49.54% moisture content, and 6.62% inoculum, the saccharification power of TH004-based bran koji after 72 hours of culture was 1834.257 U / g, which was 8.99% higher than before optimization.

[0307] In summary, this study isolated a high-saccharification-power Aspergillus oryzae TH004 strain that is resistant to high temperatures, acids, and ethanol. Optimizing the culture conditions for inoculating this strain with wheat bran significantly improved the saccharification power of the bran koji. This invention has significant value in saving grain, improving efficiency, and reducing energy consumption and emissions; its application in enterprises can increase both corporate and social benefits.

[0308] The Aspergillus oryzae TH004 of this invention is deposited at the China General Microbiological Culture Collection Center, at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 40448 and deposit date of December 25, 2022.

[0309] The embodiments described herein are merely preferred embodiments of the invention and are not intended to limit the concept and scope of the invention. Any modifications and improvements made by those skilled in the art to the technical solutions of the invention without departing from the design concept of the invention should fall within the protection scope of the invention. The technical content for which protection is sought in this invention has been fully described in the claims.

Claims

1. A type of Aspergillus oryzae with multiple tolerances ( Aspergillus oryzae ), characterized in that, The Aspergillus oryzae is a strain A. oryzae TH004 was deposited at the China General Microbiological Culture Collection Center on December 25, 2022, with accession number CGMCC No. 40448.

2. The Aspergillus oryzae with multiple tolerances according to claim 1, characterized in that, The strain A. oryzae TH004 grows well under conditions of 25-45℃.

3. The Aspergillus oryzae with multiple tolerances according to claim 1, characterized in that, The strain A. oryzae TH004 grows well under conditions with a pH of 2-7.

4. The Aspergillus oryzae with multiple tolerances according to claim 1, characterized in that, The strain A. oryzae TH004 grows well under conditions with an ethanol content of 2-6% vol.

5. The Aspergillus oryzae with multiple tolerances according to claim 1, characterized in that, The strain A. oryzae TH004 uses response surface methodology to optimize and improve the saccharification power of bran koji.

6. The Aspergillus oryzae with multiple tolerances according to claim 5, characterized in that, The strain was determined through response surface methodology optimization. A. oryzae The saccharification power of TH004-inoculated koji produced under the conditions of 28℃, 49.54% moisture content, and 6.62% inoculation amount is significantly improved.

7. The application of Aspergillus oryzae with multiple tolerances as described in any one of claims 1-6 in the production of alcoholic beverages.

8. A method for improving the saccharification power of yeast, characterized in that, Add the Aspergillus oryzae with multiple tolerances as described in any one of claims 1-6 to the yeast starter raw material to improve the saccharification power of the yeast starter.

Images