Application of a rice OsLOX10 gene in regulating rice salt-alkali stress resistance

Abstract

The present invention is based on rice, and the corresponding plants are screened out by knocking out and overexpressing the OsLOX10 gene, and the salt-alkali stress resistance experiment is carried out on the corresponding plant seedlings. OsLOX10 overexpression enhances the resistance of rice seedlings to salt-alkali stress. For salt-alkali stress of pH=10, the survival rate of the overexpressed plants on the 5th day is significantly higher than that of the blank sample and the gene knockout plants. For the plants 7 days after rehydration, the survival rate of the OsLOX10 overexpressed plants is significantly higher than that of the blank sample and the gene knockout plants. Among them, for the overexpressed plants, when the relative expression amount of the OsLOX10 gene is 100 to 150 times that of the rice plants that have not been gene-edited is used as a benchmark, the survival rate of the corresponding gene-edited plants is the highest. The present invention provides a new technical solution for improving the salt-alkali stress resistance of rice, especially improving the alkaline stress resistance of rice.

Description

Technical Field

[0001] The invention belongs to the fields of botany and biotechnology, and particularly relates to an application of a rice OsLOX10 gene in regulating the salt-alkali stress resistance of rice. Background Art

[0002] Lipoxygenase (LOX; EC 1.13.11.12), also known as lipoxygenase or lipoxygenase, is a dioxygenase containing non-heme iron or manganese. It specifically catalyzes the oxygenation reaction of polyunsaturated fatty acids (PUFA) with a cis-1,4-pentadiene structure in the body. In higher plants, linolenic acid (LeA) and linoleic acid (LA) in unsaturated fatty acids are mainly used as reaction substrates. At present, the LOXs gene family has been found in many species (soybean, corn, Arabidopsis, rice, barley, tomato, potato and tea tree), etc. It is widely present in different organs and tissues of plants, such as roots, stems, leaves, flowers, fruits and seeds of plants, and has different expression abundances.

[0003] On the other hand, plants face various survival pressures during their life history, including biotic stresses (diseases, insect pests) and abiotic stresses (drought, low temperature, high temperature, salt stress, and mechanical damage, etc.). Rice is the main food crop in my country, and research on the salt-alkali resistance of rice has always been a hot topic in the field. In the prior art, rice varieties with excellent salt-alkali resistance are usually obtained by the following two methods, one is through hybridization, and the other is through gene editing technology. With regard to gene editing technology, there have been reports on regulating the salt-alkali resistance of rice by editing rice OsCSN5 genes, OsG2 genes, ONAC103 genes, etc. However, there are no reports on regulating the salt-alkali stress resistance of rice by the OsLOX10 gene.

[0004] Technical Solution

[0005] In order to obtain a new rice variety with good salt-alkali stress resistance, the present invention provides an application of rice OsLOX10 gene in regulating rice salt-alkali stress resistance, wherein the OsLOX10 gene is the gene shown in SEQ NO: 1 or its complementary gene, and the OsLOX10 gene in this patent is also called LOX10 gene.

[0006] The present invention first provides a method for knocking out the OsLOX10 gene, comprising: selecting an OsLOX10 knockout target site, introducing the target site by PCR amplification, and finally constructing a CRISPR / Cas9 knockout vector of the gene by using the Golden Gate cloning method.

[0007] The present invention further comprises a gene knockout vector prepared based on the above method, wherein a vector DNA fragment carrying the OsLox10-CRISPR-Cas9 knockout target is integrated into rice callus cells through Agrobacterium and induced to differentiate into seedlings.

[0008] The present invention further provides a method for overexpressing the OsLOX10 gene, comprising: performing PCR amplification using a plasmid containing the target gene as a template, then performing ligation and transformation to construct an OsLOX10 overexpression vector, integrating the overexpression vector into rice callus cells through Agrobacterium and inducing differentiation into seedlings.

[0009] The present invention further provides a method for influencing the resistance of rice seedlings to saline-alkali stress by regulating the expression of LOX10 in rice.

[0010] The present invention cultivates rice seedlings to the 3-leaf stage in a light culture box, then treats them with 25mM Na2CO3 pH=10.0 for 5 days, then rehydrates them for 7 days and calculates the survival rate. The present invention finds through experiments that overexpression of the OsLOX10 gene enhances the resistance of rice to saline-alkali stress.

[0011] In the present invention, in order to obtain good resistance of rice to salt-alkali stress, the overexpression of the OsLOX10 gene or the increase of the expression level or expression activity of the protein encoded by the gene in rice is: through fluorescent quantitative analysis, the relative expression level of the OsLOX10 gene is not less than 100 times, preferably, the relative expression level of the OsLOX10 gene is 100 to 150 times, based on rice plants that have not been gene-edited.

[0012] In the present invention, the alkali stress resistance refers to stress resistance in an alkaline environment, particularly the salt-alkali stress resistance of rice in an alkaline environment with a pH value of not less than 10.0.

[0013] The present invention has experimentally found that overexpression of the OsLOX10 gene enhances the resistance of rice seedlings to saline-alkali stress. For saline-alkali stress of pH=10, the activity of the overexpressed plants on the 5th day was significantly higher than that of the blank sample and the gene knockout plants. Seven days after rehydration, the survival rate of the plants overexpressing the OsLOX10 gene was significantly higher than that of the blank sample and the gene knockout plants. For the overexpressed seedlings, the preferred relative expression of the OsLOX10 gene is 100 to 150 times that of the rice plants that have not been gene-edited, and within this range, the resistance of rice to saline-alkali stress is better. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Figure 1 is a schematic diagram of the agarose gel electrophoresis analysis results of the OsLOX10 gene CDS amplification products;

[0015] Among them, M=DL5000 marker; 2:LOX10.

[0016] Figure 2 : Schematic diagram of the construction of OsLOX10 gene knockout and overexpression vectors.

[0017] Figure 3 Figure 1: Flow chart of Agrobacterium-mediated rice genetic transformation.

[0018] Figure 4 Schematic diagram of OsLOX10 gene mutation types.

[0019] Figure 5 Figure 2: Detection results of relative expression of OsLOX10 gene.

[0020] Figure 6 The results showed that overexpression of OsLOX10 gene enhanced the resistance of rice seedlings to saline-alkali stress.

[0021] Among them, A: OsLOX10 gene overexpression salt-alkali stress treatment diagram, B: survival rate after rehydration for 7 days. DETAILED DESCRIPTION

[0022] The present invention provides the following specific embodiments to further illustrate the technical solutions of the present invention.

[0023] This example first provides a method for cloning the rice OsLOX10 gene.

[0024] After searching the NCBI website, the corresponding primers were designed, and the OsLOX10 gene was cloned using rice Kitaake cDNA as a template. The amplification primers are as follows: LOX10-CDS-F is as shown in SEQ NO: 7, and LOX10-CDS-R is as shown in SEQ NO: 8.

[0025] LOX10-CDS-F: AGGTAGCTAGTAGTACGATGCAG

[0026] LOX10-CDS-R: ACACGAGAAGAGAAATGTTGCT

[0027] The PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO was used for amplification. The PCR amplification system was as follows: Primer Star 10μL, ddH2O 7μL, Primer-F 1.5μL, Primer-R 1.5μL, and template DNA 1μL. After adding the sample, mix and centrifuge. The PCR amplification procedure was as follows: 98℃ pre-denaturation for 2min; 98℃ denaturation for 10s, 65℃ annealing for 30s, 72℃ extension for 90s, a total of 34 cycles; 72℃ extension for 10min; 4℃ constant temperature. The OsLOX10 gene CDS was obtained from Kitaake. After amplification, the PCR product was detected by agarose gel electrophoresis, and the amplified product was recovered by gel and sent to the company for sequencing, that is, the OsLOX10 gene CDS was obtained from Kitaake. After sequencing, the CDS region of the OsLOX10 gene has a gene with a sequence as shown in SEQ NO: 1 or a complementary sequence thereof; the protein encoded by the OsLOX10 gene has an amino acid sequence as shown in SEQ NO: 2.

[0028] The second aspect of this embodiment is to provide a method for constructing an OsLOX10 gene knockout vector.

[0029] The accession number of OsLOX10 gene LOC_Os11g36719 was logged into the CRISPR-PLANT (https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) website for prediction of CRISPR / Cas9 knockout targets. At the same time, appropriate target sequences were selected as gRNA targets in different segments of the coding region or protein active sites (the red ones are targets below), and then the target sequences were logged into the CRISPR RGEN Tools (http: / / www.rgenome.net / cas-offinder / ) website for off-target analysis.

[0030] Then PCR amplification was performed to introduce the target site. Finally, the CRISPR / Cas9 knockout vector of the pHUE411 gene was constructed using the Golden Gate cloning method.

[0031] Transformation of recombinant plasmid into DH5α competent cells

[0032] 1. Take 5 μL of the ligation product and transfer it to the DH5α competent cells that have been packaged. Mix gently and let it stand on ice for about 30 minutes.

[0033] 2. Heat shock at 42°C for 90 seconds and place on ice for 3 minutes.

[0034] 3. Add 500 μL LB liquid culture medium and shake at 220 rpm and 37°C for 1 hour.

[0035] 4. After taking out, centrifuge at 3000rpm for 3min. Collect about 100μL of the precipitate and spread it evenly on the Kan plate. Place it in a 37℃ incubator for overnight culture.

[0036] 5. Select a single colony and send it to the company for sequencing, and successfully construct the LOX10-Cas9 vector. Use the specific sequencing primers provided by the vector: OsU3-FD3 such as SEQ NO: 9, TaU3-RD such as SEQ NO: 10.

[0037] OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3'

[0038] TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3'

[0039] Extraction of recombinant plasmid

[0040] The positive strains with correct sequencing were transferred to LB liquid medium containing Kan for expansion culture (about 50 mL) and then plasmid extraction was performed. Plasmid extraction was performed using the SanPrep column plasmid DNA small-scale extraction kit provided by Shanghai Shenggong Bioengineering Co., Ltd., and the specific steps are shown in its instructions.

[0041] Transformation of recombinant plasmid into Agrobacterium (EHA105) competent cells

[0042] (1) Preparation of Agrobacterium competent cells (EHA105) , specific steps:

[0043] 1. Slowly thaw the cryopreserved EHA105 glycerol bacteria on ice, and after sterilization on a clean bench, streak it on a solid culture medium containing Rif resistance and culture it in a dark incubator at 28°C for 2 to 3 days.

[0044] 2. Select a single colony with good growth status and transfer it to liquid LB medium containing Rif resistance, and culture it in the dark at 180rpm and 28℃.

[0045] 3. When the OD value reaches 0.4-0.6, place it in an ice bath for 30 minutes.

[0046] Centrifuge at 5000 rpm at 4.4°C for 10 min. Remove the supernatant and add 10 mL of 0.15 mol / L ice-cold NaCl to the bacterial pellet. Resuspend the cells and centrifuge at 5000 rpm at 4°C for 10 min.

[0047] 5. Collect the bacterial precipitate and add 1 mL of 0.02 mol / L ice-cold CaCl2, then pipette and mix to suspend the cells.

[0048] 6. Add an equal volume of pre-cooled 30% glycerol. At this time, the EHA105 competent cells have been prepared and can be used for transformation of recombinant plasmids after aliquoting (50 μL per tube), or stored at -80°C after quick freezing in liquid nitrogen.

[0049] (2) Transformation of competent cells (EHA105) , specific steps:

[0050] 1. Transfer 1 ug of the recombinant plasmid into the EHA105 competent cells, mix well and place on ice for 30 minutes.

[0051] 2. Quickly freeze in liquid nitrogen for 3 minutes, then warm at 37°C for 3 minutes, and then cool on ice for 3 minutes.

[0052] 3. Add 500 μL of LB liquid culture medium and culture in a shaking incubator at 28°C and 180 rpm for about 5 hours.

[0053] 4. After taking out, centrifuge at 3000rpm for 3min. Collect about 100μL of bacterial solution, mix well by pipetting, and then apply it on the plate containing Kan and Rif. Place it in a dark incubator at 28℃ and culture for 2-3 days.

[0054] 5. Select monoclonal colonies and transfer them to LB liquid culture medium containing Kan and Rif resistance, place them in a shaker at 28℃ and 180rpm for culture for about 36 hours, and perform PCR detection after the bacterial solution becomes turbid. Positive bacterial solution can be directly streaked on solid culture medium containing Kan and Rif resistance to infect callus tissue, or it can be added with an equal volume of 30% glycerol for quick freezing and then stored in a -80℃ refrigerator.

[0055] The third aspect of this embodiment is to provide a method for constructing an OsLOX10 gene overexpression vector.

[0056] In this experiment, an overexpression fusion vector of the gene was constructed based on the pCAMBIA-1302 vector driven by CaMV 35S bidirectionally. After analyzing the vector sequence and the CDS sequence of the gene, overexpression amplification primers with homologous ends of the vector restriction sites were designed using NcoI and BstEII as restriction sites.

[0057] The plasmid containing the target gene was used as a template, and PCR amplification was performed using the high-fidelity enzyme provided by Vazyme. The resulting product was then ligated and transformed, and sent to the company for sequencing. The plasmid was extracted from the correctly sequenced bacterial solution and transformed with Agrobacterium, and the OsLOX10 overexpression vector was successfully constructed.

[0058] The fourth aspect of this embodiment is Agrobacterium-mediated rice genetic transformation and transgenic seedling detection.

[0059] 1. Material Preparation

[0060] Select the plump rice seeds newly harvested that year, in the present invention, select Kitaake rice seeds, peel off the shells, pay attention to keep the integrity of the embryo during shelling to ensure the germination rate, about 30 to 50 seeds of each variety.

[0061] 2. Wash the seeds

[0062] Wash the hulled rice seeds in a sterilized triangular bottle with sterile water for 3 to 5 times to remove impurities. If there are many impurities, wash them several times with sterile water. Disinfect the surface with 75% ethanol solution for 3 minutes. Then disinfect with 2.5% NaClO solution for about 10 minutes. During this period, place it on a shaker and shake it gently to achieve a better disinfection effect. Finally, wash it with sterile water for 3 to 5 times and blow dry it on a clean bench.

[0063] 3. Callus induction and subculture

[0064] The washed rice seeds were transferred to the NB induction medium, making sure that the embryos were in contact with the medium. The seeds were then cultured in the dark at 28°C for about 12 days before being budded and continued to be cultured.

[0065] 4. Agrobacterium transformation of rice callus

[0066] (1) Bacterial Activation

[0067] The positive Agrobacterium culture stored at -80℃ was streaked on a plate containing Kan (50mg / L -1 ) and Rif(50mg / L -1 )-resistant plates were placed upside down in a 28°C incubator and cultured in the dark for about 2 days.

[0068] (2) Screening of callus tissue

[0069] Select callus tissue with good growth condition, dense structure, bright yellow color and moderate size and pre-culture it at 28℃ for 2 to 3 days.

[0070] (3) Infection of callus tissue

[0071] 1. Use a pipette to absorb an appropriate amount of AAM solution (containing 100 μM AS) and gently blow on the streaked plate to suspend and mix the bacterial solution. Transfer the suspended bacterial solution to a sterilized culture dish and adjust its OD to 0.2-0.3. After sealing, revive it in a dark incubator at 28°C for 1 hour.

[0072] 2. Take an appropriate amount of pre-cultured rice callus tissue and transfer it to the activated Agrobacterium infection solution and gently shake it for 3 to 5 minutes.

[0073] 3. After infection, transfer the callus onto sterile filter paper and place it on a clean bench for about 10 minutes. Then transfer it to the co-culture medium containing 100 UmdAS and culture it at 28°C for 1 to 2 days.

[0074] 4. Finally, transfer to the screening medium (Screen 1) containing 500 mg / L Car and 50 mg / L Hyg for callus screening culture.

[0075] (4) Screening of resistant callus

[0076] During the screening process, non-resistant callus will appear black, brown and lose vitality, while resistant callus can grow new callus after a period of culture. These new callus will be screened and cultured for the second and third generations.

[0077] (5) Predifferentiation and differentiation culture

[0078] The resistant callus with good growth status obtained through screening can be transferred to the pre-differentiation medium and cultured under 28°C light conditions. When green spots appear or some callus grow green buds, they can be transferred to the differentiation medium for culture.

[0079] (6) Rooting culture

[0080] The differentiated seedlings are transferred to the rooting medium and cultured for a period of time.

[0081] (7) Hardening of seedlings

[0082] After the seedlings have grown in the rooting medium for a period of time, they can be transferred to nutrient solution or nutrient soil for cultivation to allow them to adapt to the external or field environment, thereby obtaining the corresponding transgenic plants.

[0083] 6. Detection of knockout and overexpression plants

[0084] Two homozygous knockout plants were obtained by using specific primers, and their mutation types are as follows:

[0085] lox10 mutation types

[0086] At the same time, corresponding fluorescent quantitative primers were designed to detect the expression level of the overexpression plants. The primers are as follows: LOX10-qPCR-F such as SEQ NO: 11, and LOX10-qPCR-R such as SEQ NO: 12.

[0087] LOX10-qPCR-F: TTCCTTCTCACCATCACTAA

[0088] LOX10-qPCR-R:GTTCTTCTCCACCTCCAA

[0089] The fifth aspect of this embodiment is to cultivate rice seedlings based on seeds obtained from OsLOX10 gene knockout plants and OsLOX10 gene overexpression plants, respectively, to provide an application of rice OsLOX10 gene in regulating rice resistance to salt-alkali stress.

[0090] The rice seedlings were cultured in a light incubator until the 3-leaf stage, then treated with 25 mM Na2CO3 pH = 10.0 for 5 days, and then rehydrated for 7 days and the survival rate was calculated. Figure 6 The experimental results showed that OsLOX10 overexpression enhanced the resistance of rice seedlings to saline-alkali stress.

[0091] The present invention is based on rice by knocking out and overexpressing the OsLOX10 gene to prepare and screen corresponding plants, and based on the salt-alkali stress tolerance experiment conducted on the seedlings of the corresponding plants. Figure 6 -A, Figure 6 -B. Among them, Figure 6 -A The first row: From left to right, wild seedlings (as blank samples, marked as WT) and transgenic seedlings (from left to right, lox10-1, lox10-2, LOX10-OE1, LOX10-OE2) were cultured in a light incubator to the 3-leaf stage of rice seedlings. Figure 6 -A The second row: plants treated with 25 mM Na2CO3 pH = 10.0 for 5 days, Figure 6 -A The third row: plants rewatered for 7 days.

[0092] The present invention has found through experiments that overexpression of the OsLOX10 gene enhances the resistance of rice seedlings to saline-alkali stress. Figure 6-B shows that for saline-alkali stress at pH = 10, the survival rate of OsLOX10 overexpressing plants (LOX10-OE1, LOX10-OE2) on the 5th day was significantly higher than that of the blank sample (WT) and the gene knockout plants (lox10-1, lox10-2). The plant activity was expressed by the average plant height and the comparison of the plant height after 5 days of saline-alkali stress treatment with the plant height of the original plants that were not subjected to saline-alkali stress treatment. The survival rate of OsLOX10 overexpressing plants (LOX10-OE1, LOX10-OE2) after 7 days of rehydration after 5 days of saline-alkali stress was about 50%, which was significantly higher than that of the blank sample (WT). The WT sample had a survival rate of about 20% after 7 days of rehydration after 5 days of saline-alkali stress. The gene knockout plants (lox10-1, lox10-2) had a survival rate of about 20% after 7 days of rehydration after 5 days of saline-alkali stress. And further comparison shows that the plant activity and rehydration survival rate of LOX10-OE1 overexpressing seedlings are higher than those of LOX10-OE2. This means that for overexpressing seedlings, LOX10 overexpression within a certain range has a better effect on enhancing the salt-alkali stress resistance of rice. The LOX10 overexpression amount, based on the rice plants that have not been gene-edited, the preferred relative expression amount of the LOX10 gene is 100 to 150 times, and better rice salt-alkali stress resistance is obtained within this range.

Claims

1. A kind of rice OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: Said OsLOX10 The CDS region of the gene is the sequence shown in SEQ NO: 1; by overexpression OsLOX10 The gene or the expression amount or expression activity of the protein encoded by the gene in rice is increased to improve the salt-alkali stress resistance of rice.

2. The rice according to claim 1 OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: The overexpression OsLOX10 The expression level or expression activity of a gene or a protein encoded by the gene in rice is increased by: using a non-gene-edited rice plant as a benchmark through fluorescence quantitative analysis, OsLOX10 The relative expression of the gene was no less than 100 times.

3. The rice according to claim 2 OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: The overexpression OsLOX10 The expression level or expression activity of a gene or a protein encoded by the gene in rice is increased by: using a non-gene-edited rice plant as a benchmark through fluorescence quantitative analysis, OsLOX10 The relative expression of the gene was 100-150 times.

4. The rice according to claim 1 OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: The overexpression OsLOX10 The method for expressing a gene or increasing the expression of a protein encoded by the gene in rice comprises: using a plasmid containing the target gene as a template for PCR amplification, and constructing OsLOX10 Overexpression vector, the target fragment is integrated into rice callus cells through Agrobacterium-mediated method and induced to differentiate into seedlings.

5. The rice according to any one of claims 1 to 4 OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: The rice is KitaaKe.

6. The rice according to claim 1 OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: The alkaline stress resistance is stress resistance under an alkaline environment.

7. The rice according to claim 6 OsLOX10 The application of the gene in regulating the resistance of rice to salt-alkali stress is characterized in that: The alkaline environment is an alkaline environment with a pH value of not less than 10.0.

Images