Application of a rice lipoxygenase OsLOX10 gene in regulating rice seed activity

Abstract

The present invention selects corresponding homozygous plants by knocking out and overexpressing the OsLOX10 gene, and further investigates the germination rate and germination potential and seed storage resistance based on the seeds obtained from the corresponding plants. The present invention found through experiments that for newly picked seeds, overexpression of the OsLOX10 gene enhances the germination rate of seeds, including germination rate, germination potential, seedling vitality index, etc.; the germination rate of the knockout seedlings after artificial aging is stronger than that of the wild type and the overexpression strain, proving that the knockout seedlings of the OsLOX10 gene have the performance of improving seed aging resistance. Therefore, the present invention provides a new technical solution for extending the storage resistance of rice seeds.

Description

Technical Field

[0001] The invention belongs to the fields of botany and biotechnology, and particularly relates to an application of a rice lipoxygenase OsLOX10 gene in rice seed activity. Background Art

[0002] Lipoxygenase (LOX; EC 1.13.11.12), also known as lipoxygenase or lipoxygenase, is a dioxygenase containing non-heme iron or manganese. It specifically catalyzes the oxygenation reaction of polyunsaturated fatty acids (PUFA) with a cis-1,4-pentadiene structure in the body. In higher plants, linolenic acid (LeA) and linoleic acid (LA) in unsaturated fatty acids are mainly used as reaction substrates. At present, the LOXs gene family has been found in many species (soybean, corn, Arabidopsis, rice, barley, tomato, potato and tea tree), etc. It is widely present in different organs and tissues of plants, such as roots, stems, leaves, flowers, fruits and seeds of plants, and has different expression abundances.

[0003] As a model plant and the world's main food crop, rice is favored by many researchers. During storage, rice often suffers from problems such as nutrient decomposition, staleness and deterioration, and loss of seed vitality. How to store and extend the life of rice seeds for a long time is a long-term concern in the breeding field.

[0004] Technical Solution

[0005] To solve the above problems, the present invention provides a method for using the rice OsLOX10 gene (LOX10 for short) in regulating rice seed activity, wherein the CDS region of the OsLOX10 gene has a gene having a sequence as shown in SEQ NO:1 or a complementary sequence thereof; and the protein encoded by the OsLOX10 gene has an amino acid sequence as shown in SEQ NO:2.

[0006] The present invention first provides a method for knocking out the OsLOX10 gene, comprising: selecting an OsLOX10 knockout target site, introducing the target site by PCR amplification, and finally constructing a CRISPR / Cas9 knockout vector of the gene by using the Golden Gate cloning method.

[0007] The present invention further comprises a gene knockout vector prepared based on the above method, wherein a vector DNA fragment carrying the OsLox10-CRISPR-Cas9 knockout target is integrated into rice callus cells through Agrobacterium and induced to differentiate into seedlings.

[0008] The present invention further provides a method for overexpressing the OsLOX10 gene, comprising: performing PCR amplification using a plasmid containing the target gene as a template, then performing ligation and transformation to construct an OsLOX10 overexpression vector, integrating the overexpression vector into rice callus cells through Agrobacterium and inducing differentiation into seedlings.

[0009] The present invention performs homozygous screening on the gene knockout seedlings and gene overexpression seedlings obtained in the above method, further cultivates the homozygous plant seedlings obtained by screening, and harvests the seeds thereof.

[0010] The present invention further provides an application of a rice OsLOX10 gene in regulating rice seed activity, wherein regulating rice seed activity is regulating the germination potential, seed germination rate and / or seed storage resistance of rice seeds, especially newly harvested rice seeds.

[0011] In the present invention, the seeds are placed in a 28° C. light incubator as day 0, the number of germinations on the 3rd and 7th days is counted, and the ratio of the number of seeds germinated on the 3rd day to the total number of seeds is defined as the germination potential, and the ratio of the number of seeds germinated on the 7th day to the total number of seeds is defined as the germination rate.

[0012] The present invention soaks newly harvested seeds for germination, places them in a light incubator for culture, and counts and calculates the germination rate and germination potential, etc., and finds that under normal conditions, overexpression of the OsLOX10 gene enhances the germination rate of seeds, including germination rate, germination potential, seedling vitality index, etc. In the present invention, the newly harvested seeds are seeds that have been stored for no longer than 6 months under conventional storage conditions after the seeds are mature and picked, especially seeds that have been stored for no longer than 3 months under conventional storage conditions; or seeds that have not been subjected to accelerated aging experiments after being mature and picked.

[0013] The present invention breaks dormancy of newly harvested seeds and performs artificial aging. The aged seeds are soaked for germination, placed in a light incubator for culture, and the germination rate and germination potential are counted and calculated. The present invention finds that after aging for 18 days, the germination rate of the gene knockout seedlings cultured for 7 days and 14 days is stronger than that of the wild type and the overexpression strain.

[0014] In a specific embodiment of the present invention, the rice is Kitaake.

[0015] The present invention prepares OsLOX10 gene knockout or overexpression seedlings based on japonica rice Kitaake varieties, cultivates homozygous gene-edited rice and harvests its seeds. The present invention further studies the effect of OsLOX10 gene on seed activity through specific examples, and finds that OsLOX10 gene can play a role in regulating seed activity and regulating seed storage resistance, providing a new solution for extending rice seed storage resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 1 is a schematic diagram of the agarose gel electrophoresis analysis results of the OsLOX10 CDS amplification product;

[0017] Among them, M=DL5000 marker; 2:LOX10.

[0018] Figure 2 : Schematic diagram of the construction of OsLOX10 knockout and overexpression vectors.

[0019] Figure 3 Figure 1: Flow chart of Agrobacterium-mediated rice genetic transformation.

[0020] Figure 4 Schematic diagram of OsLOX10 mutation types.

[0021] Figure 5 Figure 2: Detection results of relative expression level of OsLOX10.

[0022] Figure 6 Figure 1: Schematic diagram of the effect of OsLOX10 on seed germination activity;

[0023] Among them, A: OsLOX10 germination phenotype, B: germination potential, C: germination rate, D: seedling vigor index.

[0024] Figure 7 Figure 1: Schematic diagram of the detection of seed storage properties by OsLOX10;

[0025] Among them, A: seed germination after 18 days of artificial aging, B: seed germination rate after 7 days of cultivation, C: seed germination rate after 14 days of cultivation. DETAILED DESCRIPTION

[0026] The present invention provides the following specific embodiments to further illustrate the technical solutions of the present invention.

[0027] This example first provides a method for cloning the rice OsLOX10 gene.

[0028] After searching the NCBI website, the corresponding primers were designed, and the OsLOX10 gene was cloned using rice Kitaake cDNA as a template. The amplification primers are as follows: LOX10-CDS-F is as shown in SEQ NO: 7, and LOX10-CDS-R is as shown in SEQ NO: 8.

[0029] LOX10-CDS-F: AGGTAGCTAGTAGTACGATGCAG

[0030] LOX10-CDS-R: ACACGAGAAGAGAAATGTTGCT

[0031] The PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO was used for amplification. The PCR amplification system was as follows: Primer Star 10μL, ddH2O 7μL, Primer-F 1.5μL, Primer-R 1.5μL, and template DNA 1μL. After adding the sample, mix and centrifuge. The PCR amplification procedure was as follows: 98℃ pre-denaturation for 2min; 98℃ denaturation for 10s, 65℃ annealing for 30s, 72℃ extension for 90s, a total of 34 cycles; 72℃ extension for 10min; 4℃ constant temperature. The OsLOX10 gene CDS was obtained from Kitaake. After amplification, the PCR product was detected by agarose gel electrophoresis, and the amplified product was recovered by gel and sent to the company for sequencing, that is, the OsLOX10 gene CDS was obtained from Kitaake. After sequencing, the CDS region of the OsLOX10 gene has a gene with a sequence as shown in SEQ NO: 1 or a complementary sequence thereof; the protein encoded by the OsLOX10 gene has an amino acid sequence as shown in SEQ NO: 2.

[0032] The second aspect of this embodiment is to provide a method for constructing an OsLOX10 gene knockout vector.

[0033] The accession number of OsLOX10 gene LOC_Os11g36719 was logged into the CRISPR-PLANT (https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) website for prediction of CRISPR / Cas9 knockout targets. At the same time, appropriate target sequences were selected as gRNA targets in different segments of the coding region or protein active sites (the red ones are targets below), and then the target sequences were logged into the CRISPR RGEN Tools (http: / / www.rgenome.net / cas-offinder / ) website for off-target analysis.

[0034] Then PCR amplification was performed to introduce the target site. Finally, the CRISPR / Cas9 knockout vector of the pHUE411 gene was constructed using the Golden Gate cloning method.

[0035] Transformation of recombinant plasmid into DH5α competent cells

[0036] 1. Take 5 μL of the ligation product and transfer it to the DH5α competent cells that have been packaged. Mix gently and let it stand on ice for about 30 minutes.

[0037] 2. Heat shock at 42°C for 90 seconds and place on ice for 3 minutes.

[0038] 3. Add 500 μL LB liquid culture medium and shake at 220 rpm and 37°C for 1 hour.

[0039] 4. After taking out, centrifuge at 3000rpm for 3min. Collect about 100μL of the precipitate and spread it evenly on the Kan plate. Place it in a 37℃ incubator for overnight culture.

[0040] 5. Select a single colony and send it to the company for sequencing, and successfully construct the LOX10-Cas9 vector. Use the specific sequencing primers provided by the vector: OsU3-FD3 such as SEQ NO: 9, TaU3-RD such as SEQ NO: 10.

[0041] OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3'

[0042] TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3'

[0043] Extraction of recombinant plasmid

[0044] The positive strains with correct sequencing were transferred to LB liquid medium containing Kan for expansion culture (about 50 mL) and then plasmid extraction was performed. Plasmid extraction was performed using the SanPrep column plasmid DNA small-scale extraction kit provided by Shanghai Shenggong Bioengineering Co., Ltd., and the specific steps are shown in its instructions.

[0045] Transformation of recombinant plasmid into Agrobacterium (EHA105) competent cells

[0046] (1) Preparation of Agrobacterium competent cells (EHA105) , specific steps:

[0047] 1. Slowly thaw the cryopreserved EHA105 glycerol bacteria on ice, and after sterilization on a clean bench, streak it on a solid culture medium containing Rif resistance and culture it in a dark incubator at 28°C for 2 to 3 days.

[0048] 2. Select a single colony with good growth status and transfer it to liquid LB medium containing Rif resistance, and culture it in the dark at 180rpm and 28℃.

[0049] 3. Wait for OD 600 After the value reaches 0.4-0.6, place it in an ice bath for 30 minutes.

[0050] Centrifuge at 5000 rpm at 4.4°C for 10 min. Remove the supernatant and add 10 mL of 0.15 mol / L ice-cold NaCl to the bacterial pellet. Resuspend the cells and centrifuge at 5000 rpm at 4°C for 10 min.

[0051] 5. Collect the bacterial precipitate and add 1 mL of 0.02 mol / L ice-cold CaCl2, then pipette and mix to suspend the cells.

[0052] 6. Add an equal volume of pre-cooled 30% glycerol. At this time, the EHA105 competent cells have been prepared and can be used for transformation of recombinant plasmids after aliquoting (50 μL per tube), or stored at -80°C after quick freezing in liquid nitrogen.

[0053] (2) Transformation of competent cells (EHA105) , specific steps:

[0054] 1. Transfer 1 ug of the recombinant plasmid into the EHA105 competent cells, mix well and place on ice for 30 minutes.

[0055] 2. Quickly freeze in liquid nitrogen for 3 minutes, then warm at 37°C for 3 minutes, and then cool on ice for 3 minutes.

[0056] 3. Add 500 μL of LB liquid culture medium and culture in a shaking incubator at 28°C and 180 rpm for about 5 hours.

[0057] 4. After taking out, centrifuge at 3000rpm for 3min. Collect about 100μL of bacterial solution, mix well by pipetting, and then apply it to the Kan and Rif plates. Culture in a dark incubator at 28℃ for 2-3 days.

[0058] 5. Select monoclonal colonies and transfer them to LB liquid culture medium containing Kan and Rif resistance, place them in a shaker at 28℃ and 180rpm for culture for about 36 hours, and perform PCR detection after the bacterial solution becomes turbid. Positive bacterial solution can be directly streaked on solid culture medium containing Kan and Rif resistance to infect callus tissue, or it can be added with an equal volume of 30% glycerol for quick freezing and then stored in a -80℃ refrigerator.

[0059] The third aspect of this embodiment is to provide a method for constructing an OsLOX10 gene overexpression vector.

[0060] In this experiment, an overexpression fusion vector of the gene was constructed based on the pCAMBIA-1302 vector driven by CaMV 35S bidirectionally. After analyzing the vector sequence and the CDS sequence of the gene, overexpression amplification primers with homologous ends of the vector restriction sites were designed using NcoI and BstEII as restriction sites.

[0061] The plasmid containing the target gene was used as a template, and PCR amplification was performed using the high-fidelity enzyme provided by Vazyme. The resulting product was then ligated and transformed, and sent to the company for sequencing. The plasmid was extracted from the correctly sequenced bacterial solution and transformed with Agrobacterium, and the OsLOX10 overexpression vector was successfully constructed.

[0062] The fourth aspect of this embodiment is Agrobacterium-mediated rice genetic transformation and transgenic seedling detection.

[0063] 1. Material Preparation

[0064] Select the plump rice seeds newly harvested that year, in the present invention, select Kitaake rice seeds, peel off the shells, pay attention to keep the integrity of the embryo during shelling to ensure the germination rate, about 30 to 50 seeds of each variety.

[0065] 2. Wash the seeds

[0066] Wash the hulled rice seeds in a sterilized triangular bottle with sterile water for 3 to 5 times to remove impurities. If there are many impurities, wash them several times with sterile water. Disinfect the surface with 75% ethanol solution for 3 minutes. Then disinfect with 2.5% NaClO solution for about 10 minutes. During this period, place it on a shaker and shake it gently to achieve a better disinfection effect. Finally, wash it with sterile water for 3 to 5 times and blow dry it on a clean bench.

[0067] 3. Callus induction and subculture

[0068] The washed rice seeds were transferred to the NB induction medium, making sure that the embryos were in contact with the medium. The seeds were then cultured in the dark at 28°C for about 12 days before being budded and continued to be cultured.

[0069] 4. Agrobacterium transformation of rice callus

[0070] (1) Bacterial Activation

[0071] The positive Agrobacterium culture stored at -80℃ was streaked on a plate containing Kan (50mg / L -1 ) and Rif(50mg / L -1 )-resistant plates were placed upside down in a 28°C incubator and cultured in the dark for about 2 days.

[0072] (2) Screening of callus tissue

[0073] Select callus tissue with good growth condition, dense structure, bright yellow color and moderate size and pre-culture it at 28℃ for 2 to 3 days.

[0074] (3) Infection of callus tissue

[0075] 1. Use a pipette to absorb an appropriate amount of AAM solution (containing 100 μM AS) and gently blow on the streaked plate to suspend and mix the bacterial solution. Transfer the suspended bacterial solution to a sterilized culture dish and adjust its OD to 0.2-0.3. After sealing, revive it in a dark incubator at 28°C for 1 hour.

[0076] 2. Take an appropriate amount of pre-cultured rice callus tissue and transfer it to the activated Agrobacterium infection solution and gently shake it for 3 to 5 minutes.

[0077] 3. After infection, transfer the callus onto sterile filter paper and place it on a clean bench for about 10 minutes. Then transfer it to the co-culture medium containing 100 UmdAS and culture it at 28°C for 1 to 2 days.

[0078] 4. Finally, transfer to the screening medium (Screen 1) containing 500 mg / L Car and 50 mg / L Hyg for callus screening culture.

[0079] (4) Screening of resistant callus

[0080] During the screening process, non-resistant callus will appear black and dead, brown and lose vitality, while resistant callus can grow new callus after a period of culture. These new callus will be screened and cultured for the second and third generations in turn.

[0081] (5) Predifferentiation and differentiation culture

[0082] The resistant callus with good growth status obtained through screening can be transferred to the pre-differentiation medium and cultured under 28°C light conditions. When green spots appear or some callus grow green buds, they can be transferred to the differentiation medium for culture.

[0083] (6) Rooting culture

[0084] The differentiated seedlings are transferred to the rooting medium and cultured for a period of time.

[0085] (7) Hardening of seedlings

[0086] After the seedlings have grown in the rooting medium for a period of time, they can be transferred to nutrient solution or nutrient soil for cultivation to allow them to adapt to the external or field environment, thereby obtaining the corresponding transgenic plants.

[0087] 6. Detection of knockout and overexpression plants

[0088] Two homozygous knockout plants were obtained by using specific primers, and their mutation types are as follows:

[0089] Oslox10 mutation types

[0090] At the same time, corresponding fluorescent quantitative primers were designed to detect the expression level of the overexpression plants. The primers are as follows: LOX10-qPCR-F such as SEQ NO: 11, and LOX10-qPCR-R such as SEQ NO: 12.

[0091] LOX10-qPCR-F: TTCCTTCTCACCATCACTAA

[0092] LOX10-qPCR-R:GTTCTTCTCCACCTCCAA

[0093] The fifth aspect of this embodiment is the application of the OsLOX10 gene in regulating the activity of rice seeds based on seeds obtained from OsLOX10 gene knockout plants and OsLOX10 gene overexpression plants, respectively.

[0094] The pure and plant seedlings obtained in the above method are further cultivated and their seeds are harvested. The newly harvested seeds are baked at 37°C for 2 days, 50 full seeds are soaked overnight for germination, and the seeds are placed in a 9CM culture dish covered with a layer of filter paper, placed in a 28°C light incubator, and the germination rate and germination potential and other indicators are counted and calculated. In the present invention, the seeds are placed in a 28°C light incubator as the 0th day, the number of germinations on the 3rd and 7th days is counted, and the ratio of the number of seeds germinated on the 3rd day to the total number of seeds is defined as the germination potential, and the ratio of the number of seeds germinated on the 7th day to the total number of seeds is defined as the germination rate.

[0095] The effects of OsLOX10 gene on germination potential and germination rate of newly harvested seeds are shown in Table 1 and Figure 6 In this experiment, 50 seeds were selected in each group, and each experiment was repeated four times to obtain the original germination data of newly harvested seeds, among which Table 1 shows the number of seeds germinated on the 3rd day, and Table 2 shows the number of seeds germinated on the 7th day.

[0096] Table 1: Data of germination of newly harvested seeds with OsLOX10 gene in 3 days

[0097] Rice Types WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2 Group 1 15 13 10 23 20 Group 2 16 17 12 24 19 Group 3 14 12 12 19 25 Group 4 17 15 9 20 22

[0098] Table 2: Data on germination of newly harvested seeds with OsLOX10 gene after 7 days

[0099] Rice Types WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2 Group 1 41 33 34 42 42 Group 2 40 34 34 42 39 Group 3 38 33 30 43 41 Group 4 40 31 29 39 45

[0100] Analysis found that under normal conditions, OsLOX10 overexpression enhanced seed germination rate, including germination rate, germination potential, seedling vigor index, etc.

[0101] The newly harvested seeds were baked at 42°C for 2 days to break dormancy, 50 full seeds were taken and placed in an artificial aging incubator (42, 80% humidity) for 18 days, 50 full seeds were soaked overnight to germinate, and placed in a 9CM culture dish covered with a layer of filter paper and placed in a 28°C light incubator, and the germination rate and germination potential were counted and calculated. The effect of OsLOX10 gene on seed storage tolerance is shown in Tables 3, 4 and Figure 7 In this experiment, 50 seeds were selected in each group, and each experiment was repeated four times to obtain the original germination data of the seeds after artificial aging, among which Table 3 shows the number of seeds germinated on the 7th day, and Table 4 shows the number of seeds germinated on the 14th day.

[0102] Table 3: 7-day germination data of artificially aged seeds with OsLOX10 gene

[0103] Rice Types WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2 Group 1 12 16 23 6 13 Group 2 11 21 23 9 10 Group 3 10 20 21 5 8 Group 4 14 19 19 9 11

[0104] Table 4: 14-day germination data of artificially aged seeds with OsLOX10 gene

[0105]

[0106]

[0107] The analysis found that after 18 days of aging, the germination rate of gene knockout mutant seeds was stronger than that of wild type and overexpression strains.

[0108] The present invention is based on rice, and the corresponding plants are screened out by knocking out and overexpressing the OsLOX10 gene, and the germination rate and germination potential as well as the seed storage resistance are further investigated based on the seeds obtained from the corresponding plants. The present invention found through experiments that the germination rate of the knockout seedlings after artificial aging is stronger than that of the wild type and the overexpression strain, thereby indicating that the gene knockout seedlings have the performance of improving the aging resistance of seeds. For the newly picked gene overexpression seeds, overexpression enhances the germination rate of the seeds, including germination rate, germination potential, seedling vitality index, etc. The present invention found through specific examples that the OsLOX10 gene can play a role in regulating seed activity and regulating seed storage resistance, and provides a new solution for extending the storage resistance of rice seeds.

Claims

1. A use of a rice OsLOX10 gene in regulating rice seed activity, characterized in that: The CDS region of the OsLOX10 gene is the sequence shown in SEQ NO: 1; the germination potential or germination rate of seeds is improved by overexpressing the OsLOX10 gene or increasing the expression amount or expression activity of the protein encoded by the gene in rice; the improvement of the germination potential or germination rate of seeds is to improve the germination potential or germination rate of newly harvested rice seeds.

2. A use of a rice OsLOX10 gene in regulating rice seed activity, characterized in that: The regulation of rice seed activity is to regulate the storage resistance of rice seeds; the storage resistance of rice seeds is improved by knocking out the OsLOX10 gene.

3. The use of the rice OsLOX10 gene in regulating rice seed activity according to claim 2, wherein: The method for knocking out the OsLOX10 gene includes: selecting the OsLOX10 knockout target site, introducing the target site by PCR amplification, and finally constructing a CRISPR / Cas9 knockout vector of the gene by Golden Gate cloning method, integrating the vector DNA fragment carrying the OsLox10-CRISPR-Cas9 knockout target site into rice callus cells by Agrobacterium and inducing differentiation into seedlings.

4. The use of the rice OsLOX10 gene in regulating rice seed activity according to claim 1, wherein: The method for overexpressing the OsLOX10 gene comprises: using a plasmid containing the target gene as a template for PCR amplification, then performing ligation transformation to construct an OsLOX10 overexpression vector, integrating the overexpression vector into rice callus cells through Agrobacterium and inducing differentiation into seedlings.

5. Use of the rice OsLOX10 gene in regulating rice seed activity according to any one of claims 1 to 4, characterized in that: The rice is Kitaake.

Images