Tuberculosis diagnostic circRNA marker, primer and application thereof

By screening for circRNA markers hsa_circ_0002371 and hsa_circ_0007460 in PBMCs of patients with active pulmonary tuberculosis and validating them with RT-qPCR, the problems of time-consuming and low-sensitivity existing tuberculosis diagnostic methods have been solved, achieving rapid and sensitive tuberculosis diagnosis with high stability and high specificity.

CN116732165BActive Publication Date: 2026-02-10FUDAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310767612.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-27
Publication Date
2026-02-10
Estimated Expiration
2043-06-27

AI Technical Summary

Technical Problem

Existing tuberculosis diagnostic methods are time-consuming and have low sensitivity. They lack rapid, sensitive, and efficient biomarkers, making it difficult to diagnose tuberculosis in its early stages.

Method used

Using the circRNA markers hsa_circ_0002371 and hsa_circ_0007460, specific primers were designed for RT-qPCR validation. Combined with PBMCs in whole blood samples, circRNAs that are significantly highly expressed in patients with active pulmonary tuberculosis were screened for diagnosis of active pulmonary tuberculosis.

Benefits of technology

It achieves rapid, simple, time-saving, and highly sensitive tuberculosis diagnosis with low sample consumption, high stability and specificity, and ROC curve analysis shows high diagnostic accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116732165B_ABST
    Figure CN116732165B_ABST
Patent Text Reader

Abstract

The application discloses a tuberculosis diagnosis circRNA marker, primers and application thereof. The application screens two circRNAs which are significantly highly expressed in PBMC of active pulmonary tuberculosis patients, namely, hsa_circ_0002371, a transcription region of which is located on chromosome 10 and formed by reverse splicing of exons 20 and 21 of a CCAR1 gene, and hsa_circ_0007460, a transcription region of which is located on chromosome 1 and formed by reverse splicing of exons 6-9 of a GOSR1 gene. The application further discloses primers in a tuberculosis diagnosis kit based on the circRNA marker. The circRNA marker can effectively distinguish uninfected people from active pulmonary tuberculosis patients, provides a new thought for studying the pathogenesis of active pulmonary tuberculosis, and provides a new target for early diagnosis of active pulmonary tuberculosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a tuberculosis diagnostic circRNA marker, primer, and its application. Background Technology

[0002] Tuberculosis (TB) is caused by Mycobacterium tuberculosis (Mycobacterium tuberculosis). Mycobacterium tuberculosis , Mtb It is a serious respiratory infectious disease caused by .

[0003] Early diagnosis of tuberculosis infection is crucial for controlling the spread of the disease. Currently, bacterial culture and smear microscopy remain the most widely used tools for clinical diagnosis of tuberculosis, but they are time-consuming and have poor sensitivity. Therefore, there is an urgent need to find tuberculosis-specific biomarkers and establish a rapid, sensitive, and efficient diagnostic method for pulmonary tuberculosis to prevent its widespread transmission.

[0004] Circular RNA (circRNA) is a covalently closed endogenous molecule in eukaryotes, lacking a 5'-cap and a 3'-poly(A) tail. Most are expressed by known protein-coding genes and exhibit tissue and cell specificity. Due to its covalently closed circular shape and tolerance to RNase R degradation, circRNA can serve as a potential biomarker for tumors, cardiovascular diseases, and other diseases.

[0005] Many studies have found dysregulation of circRNA and Mtb Related to infection, it may serve as a novel biomarker for TB diagnosis. Studies by Zhuang ZG et al. have shown that hsa_circ_0005836 can be a new potential biomarker for TB diagnosis. Huang Z et al. found that the expression of hsa_circ_0043497 and hsa_circ_0001204 was significantly increased in monocyte-derived macrophages of TB patients. Studies by Zhang XL et al. have shown that hsa_circ_0028883 has potential value for TB diagnosis and is a potentially reliable biomarker. These studies indicate that circRNAs may play an important role in TB and have great potential as novel biomarkers for TB diagnosis. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide a tuberculosis diagnostic circRNA biomarker, primers, and their applications. This invention discloses for the first time two circRNAs as specific biomarkers for active pulmonary tuberculosis, which have high stability. This invention utilizes whole blood samples that are relatively easy to obtain clinically, isolates PBMCs from them, and uses designed primer pairs to perform RT-qPCR to verify the differential expression of circRNAs. It has the advantages of being rapid, simple, time-saving, highly sensitive, and having low sample consumption, making it a very suitable method for diagnosing active pulmonary tuberculosis using differentially expressed circRNAs.

[0007] This invention utilizes circRNA sequencing to screen for two circRNAs that are significantly highly expressed in PBMCs of patients with active pulmonary tuberculosis: hsa_circ_0002371 and hsa_circ_0007460. The transcribed region of hsa_circ_0002371 is located on chromosome 10, formed by backsplicing of exons 20 and 21 of the CCAR1 gene, and is 230 bp in length. The transcribed region of hsa_circ_0007460 is located on chromosome 1, formed by backsplicing of exons 6-9 of the GOSR1 gene, and is 363 bp in length. The specific technical solution of this invention is as follows:

[0008] This invention provides the application of a circRNA biomarker in the preparation of a tuberculosis diagnostic kit. The circRNA biomarker is one or both of hsa_circ_0002371 and hsa_circ_0007460. hsa_circ_0002371 is 230 bp long and located on human chromosome 10, and its base sequence is shown in SEQ ID NO: 5. hsa_circ_0007460 is 363 bp long and located on human chromosome 1, and its base sequence is shown in SEQ ID NO: 6.

[0009] In this invention, the hsa_circ_0002371 sequence is SEQ ID NO: 5, as follows:

[0010] ATAGGGATGAGGAAGAAATGACCAAACGAGATGACAAAAGAGATATCAACAGATACTGCAAGGAGAGGCCCTCTAAAGATAAGGAAAAAGAAAAGACTCAAATGATCACAATTAACAGAGATCTGTTAATGGCTTGTTTATTTTGATCAAAGTCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAG.

[0011] In this invention, the hsa_circ_0007460 sequence is SEQ ID NO: 6, as follows:

[0012] TTCTGATACAACACCCCTTTTAAATGGATCAAGCCAAGACAGAATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGCTTACAGGGGTAAATGATAAAATGGCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGAATGCAGCCCTGATGCATACATTACAGCGGCATA GAGACATATTGCAGGATTATACACATGAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGGGAGAATCTTATGGGATCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACACAGAAGAACTGAGCTATTTTTGAAAGAACATGACCACCTTCGAAA.

[0013] In this invention, the tuberculosis diagnostic kit is a diagnostic kit for diagnosing active pulmonary tuberculosis.

[0014] In this invention, the tuberculosis diagnostic kit detects the content of one or more of hsa_circ_0002371 and hsa_circ_0007460 in the sample of the tested subject, wherein the amount of hsa_circ_0002371 and hsa_circ_0007460 is positively correlated with the probability that the tested subject has pulmonary tuberculosis.

[0015] In this invention, the contents of hsa_circ_0002371 and hsa_circ_0007460 are determined from peripheral blood mononuclear cells (PBMCs) in whole blood samples of the tested subjects.

[0016] This invention also provides the application of primers in the preparation of a tuberculosis diagnostic kit. The tuberculosis diagnostic circRNA marker is one or both of hsa_circ_0002371 and hsa_circ_0007460. hsa_circ_0002371 is 230 bp long and located on human chromosome 10, and its base sequence is shown in SEQ ID NO: 5. hsa_circ_0007460 is 363 bp long and located on human chromosome 1, and its base sequence is shown in SEQ ID NO: 6. The primers are used to obtain the expression levels of hsa_circ_0002371 and hsa_circ_0007460 in peripheral blood mononuclear cells (PBMCs) of the tested subject. The primers consist of the following sequences:

[0017] hsa_circ_0002371 forward primer sequence (SEQ ID NO: 1): 5'-AGTCATTGTGGTTACCTTCTTGA-3'; hsa_circ_0002371 reverse primer sequence (SEQ ID NO: 2): 5'-GGGCCTCTCCTTGCAGTATC-3'; hsa_circ_0007460 forward primer sequence (SEQ ID NO: 3): 5'-GTGGGTCTGGAGTAAACAACAG-3'; hsa_circ_0007460 reverse primer sequence (SEQ ID NO: 4): 5'-CCCTGTAAGCCTTGCCAAAA-3'.

[0018] In this invention, circRNA serves as a specific biomarker for active pulmonary tuberculosis. This invention extracts total RNA from PBMCs in whole blood samples from patients with active pulmonary tuberculosis and healthy controls, designs specific primers for RT-qPCR, verifies the expression of circRNAs specific to active pulmonary tuberculosis using RT-qPCR, and evaluates its diagnostic performance using ROC curves. This invention provides a method for identifying individuals who may have active pulmonary tuberculosis and its primer sequences. In this invention, the relative expression level of circRNA is analyzed using GraphPad Prism 9 software, employing one-sample t-tests and independent samples t-tests. A p-value < 0.05 is considered statistically significant.

[0019] This invention found that circRNA sequencing results showed that hsa_circ_0002371 and hsa_circ_0007460 were significantly upregulated in patients with active pulmonary tuberculosis. Further expanding the sample size, RT-qPCR was used to detect PBMCs in patients with active pulmonary tuberculosis and healthy individuals. Compared to healthy samples, the expression levels of hsa_circ_0002371 and hsa_circ_0007460 in patients with active pulmonary tuberculosis were significantly upregulated, showing a statistically significant difference. ROC curve analysis showed that AUC(hsa_circ_0002371) = 0.8063, AUC(hsa_circ_0007460) = 0.7474, and AUC(combined) = 0.8177. Both individual circRNAs have high specificity and sensitivity for diagnosis, and combined diagnosis can further improve their diagnostic efficacy. This suggests that one or more of hsa_circ_0002371 and hsa_circ_0007460 can be used as specific biomarkers for the diagnosis of active pulmonary tuberculosis. Attached Figure Description

[0020] Figure 1 This is a graph showing the results of circRNA microarray detection.

[0021] Figure 2 This is a graph showing the differential expression of hsa_circ_0002371 between patients with active pulmonary tuberculosis and healthy individuals.

[0022] Figure 3 This is a graph showing the differential expression of hsa_circ_0007460 between patients with active pulmonary tuberculosis and healthy individuals.

[0023] Figure 4 hsa_circ_0002371, hsa_circ_0007460, and the combined diagnostic performance assessment chart of the two. Detailed Implementation

[0024] The technical solution of the present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0025] In this embodiment, human lymphocyte separation medium was purchased from Shenzhen Dakwei Biotechnology Co., Ltd.; total RNA extraction reagent was purchased from Guangzhou Meiji Biotechnology Co., Ltd.; Epicentre Ribo-Zero Gold Kit was purchased from Inmena Biotechnology Co., Ltd.; RNA-Seq sample preparation kit was purchased from Inmena Biotechnology Co., Ltd.; RT-qPCR reverse transcription kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; Taq Pro Universal SYBR qPCR Master Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd.; and 96-well plates and membranes were purchased from Axygen.

[0026] Example 1: circRNA microarray expression analysis of PBMCs in whole blood of patients with active pulmonary tuberculosis and healthy volunteers.

[0027] A1: We collected blood samples from 3 clinically confirmed patients with active pulmonary tuberculosis and 3 healthy controls. All participants had their blood drawn in the morning on an empty stomach using disposable vacuum EDTA anticoagulation blood collection tubes. 5.0 mL of peripheral blood was collected and diluted with an equal volume of sterile PBS. A certain volume of human lymphocyte separation medium was added to the centrifuge tube, and the diluted blood sample was spread evenly on top of the separation medium, maintaining a clear interface between the two liquids. The ratio of separation medium, undiluted anticoagulated whole blood, and sterile PBS was 1:1:1. The tube was centrifuged at 800g for 25 min at room temperature. After centrifugation, the bottom layer consisted of red blood cells, the middle layer of separation medium, and the top layer of plasma / tissue homogenate. Between the plasma layer and the separation medium layer was a thin, relatively dense white film, i.e., a mononuclear cell layer (including lymphocytes and monocytes). The white film layer was carefully transferred to another centrifuge tube. It was diluted with sterile PBS to a certain volume and mixed by inversion. The tube was centrifuged at 250g for 10 min at room temperature, and the supernatant was discarded. The washing process was repeated 1-2 times. Gently suspend in 1 mL of TRIzol and store at -80°C.

[0028] A2: PBMC samples containing TRIzol from patients with active pulmonary tuberculosis and healthy controls were removed from a -80°C freezer and allowed to thaw naturally at 4°C. 0.2 mL of chloroform was added, and the mixture was vigorously vortexed for 15 s. After incubation at room temperature for 3 min, the samples were centrifuged at 12000 g for 15 min at 4°C. The sample separated into three layers: a yellow organic phase at the bottom, a colorless aqueous phase at the top, and an intermediate layer (DNA). RNA was mainly in the aqueous phase. The aqueous phase was transferred to a new tube, and 0.5 mL of isopropanol was added to precipitate the RNA. The mixture was mixed, incubated in a freezer for 30 min, and then centrifuged at 12000 g for 10 min at 4°C. The supernatant was discarded. The RNA precipitate was washed with 1 mL of 75% ethanol, vortexed for 30 s, and then centrifuged at 12000 g for 5 min at 4°C. The supernatant was discarded, and the sample was allowed to stand in a clean bench with forced air for 3–5 min. 20 μL of DEPC was added. The liquid in the tube is the extracted total RNA and can be stored at -80°C.

[0029] A3: After total RNA extraction, an rRNA-depleted specific library larger than 200 nt was constructed. Ribosomal RNA was removed from 10 μg of total RNA according to the Epicentre Ribo-Zero Gold Kit procedure. Subsequently, poly(A)- or poly(A)+ RNA fragments were fragmented into smaller segments using divalent cations at high temperature. The fragmented RNA fragments were then reverse transcribed according to the RNA-Seq Sample Preparation Kit (Illumina, San Diego, USA) protocol to construct the final cDNA library, with an average insertion length of 300 bp (±50 bp). Paired-end sequencing was then performed on an Illumina Hiseq 4000 according to the vendor's recommended protocol. Raw data from the circRNA microarray were extracted, and the data were normalized and processed using the R software package. Differentially expressed circRNAs between the two groups of samples were identified. Screening was performed based on fold change, circRNA length, species conservation, and P-value. The criteria for differentially expressed circRNAs were an expression ratio ≥2-fold between the ATB group and the HC group and P < 0.05.

[0030] A4: Cluster analysis of circRNA microarrays in whole blood PBMCs from patients with active pulmonary tuberculosis and healthy volunteers is available in [link to relevant documentation]. Figure 1 Microarray screening revealed multiple upregulated and downregulated circRNAs. Among them, hsa_circ_0002371 and hsa_circ_0007460 met our screening criteria and were significantly upregulated in PBMCs of patients with active pulmonary tuberculosis. Given that they may be specifically highly expressed in PBMCs of patients with active pulmonary tuberculosis, this invention was validated using a large-scale sample through the following examples.

[0031] Example 2: The expression level of hsa_circ_0002371 was significantly upregulated in patients with active pulmonary tuberculosis.

[0032] A1: Thirty clinically diagnosed patients with active pulmonary tuberculosis and 32 healthy controls were collected. Blood samples from all participants were drawn in the morning on an empty stomach using disposable vacuum EDTA anticoagulation blood collection tubes. 5.0 mL of peripheral blood was collected and diluted with an equal volume of sterile PBS. A certain volume of human lymphocyte separation medium was added to the centrifuge tube, and the diluted blood sample was spread evenly on top of the separation medium, maintaining a clear interface between the two liquids. The ratio of separation medium, undiluted anticoagulated whole blood, and sterile PBS was 1:1:1. The tube was centrifuged at 800g for 25 min at room temperature. After centrifugation, the bottom layer consisted of red blood cells, the middle layer was the separation medium, and the top layer was a plasma / tissue homogenate layer. Between the plasma layer and the separation medium layer was a thin, relatively dense white film, i.e., a mononuclear cell layer (including lymphocytes and monocytes). The white film layer was carefully transferred to another centrifuge tube. The tube was diluted with sterile PBS to a certain volume and mixed by inversion. The tube was centrifuged at 250g for 10 min at room temperature, and the supernatant was discarded. Repeat washing 1-2 times. Gently suspend in 1 mL of TRIzol and store at -80°C.

[0033] A2: PBMC samples containing TRIzol from patients with active pulmonary tuberculosis and healthy controls were removed from a -80°C freezer and allowed to thaw naturally at 4°C. 0.2 mL of chloroform was added, and the mixture was vigorously vortexed for 15 s. After incubation at room temperature for 3 min, the samples were centrifuged at 12000 g for 15 min at 4°C. The sample separated into three layers: a yellow organic phase at the bottom, a colorless aqueous phase at the top, and an intermediate layer (DNA). RNA was mainly in the aqueous phase. The aqueous phase was transferred to a new tube, and 0.5 mL of isopropanol was added to precipitate the RNA. The mixture was mixed, incubated in a freezer for 30 min, and then centrifuged at 12000 g for 10 min at 4°C. The supernatant was discarded. The RNA precipitate was washed with 1 mL of 75% ethanol, vortexed for 30 s, and then centrifuged at 12000 g for 5 min at 4°C. The supernatant was discarded, and the sample was allowed to stand in a clean bench with forced air for 3–5 min. 20 μL of DEPC was added. The liquid in the tube is the extracted total RNA and can be stored at -80°C.

[0034] Total RNA samples (5.0 μL) from patients with active pulmonary tuberculosis and healthy controls were collected and mixed with 0.5 μL of 10× Loading Buffer. Electrophoresis was performed at 130 V for 30 min, and the band distribution was observed under UV light. OD values ​​were measured using a Thermo Nanodrop 2000 analyzer, and the A260 / A280 ratio was determined using a UV spectrophotometer. Results showing total RNA concentrations between 50 and 500 ng / μL and A260 / A280 ratios between 1.8 and 2.2 indicated good purity of total RNA, free from protein or other organic contamination and degradation.

[0035] A3: Design circRNA RT-qPCR primer pairs. The RT-qPCR primers should be about 20 bp in length, with an annealing temperature (Tm) of about 60℃ and a GC content of about 40%~60%. The primer pair sequences are SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, SEQ ID NO: 4, see Table 1.

[0036] Taking the amplification of the internal control GAPDH in PBMCs isolated from whole blood samples of patients with active pulmonary tuberculosis as an example, the amplification was observed. The amplification curve was smooth, and the fluorescence signal showed a clear logarithmic phase with increasing cycle number, while the blank control did not generate a continuous curve, indicating good amplification. Melting curves of the amplified circRNA product showed only one distinct single peak, while the template-free control showed no obvious peak, indicating that the amplified product is specific circRNA, meaning the quantification is uncontaminated, accurate, and reliable.

[0037] Table 1 RT-qPCR primers

[0038]

[0039] A4: Diagnostic kit for active pulmonary tuberculosis: RT-qPCR for specific circRNAs associated with active pulmonary tuberculosis.

[0040] Reverse transcription was performed using the HiScript III All-in-one RT SuperMix Perfect for qPCR Reverse Transcription Kit. The reverse transcription reaction mixture consisted of 4 μL of 5×All-in-one qRT SuperMix, 1 μL of Enzyme Mix, and 1 μg of total RNA, for a total volume of 20 μL. Reaction conditions were: 50℃ for 15 min; 85℃ for 5 sec. After the reaction, the sample was stored at -80℃.

[0041] RT-qPCR system: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 2 μL of template cDNA, 0.4 μL of forward / reverse primers (10 μM), 7.2 μL of ddH2O, total volume 20 μL. After mixing, centrifuge at 3000 rpm for 5 min, and perform real-time PCR reaction in a CFX96 real-time PCR instrument. The reaction parameters are set as follows: 95℃ for 30 sec, then 95℃ for 10 sec, 60℃ for 30 sec, for a total of 40 cycles, followed by 95℃ for 15 sec, 60℃ for 60 sec, and 95℃ for 15 sec.

[0042] circRNA quantitative PCR data analysis used GAPDH as an internal reference gene. The target gene was normalized to ensure comparison of target gene levels across equal sample sizes. The formula for fold change in circRNA expression is RE = 2. -△△Ct , where △△Ct = (Ct circRNA -Ct GAPDH )ATB-(Ct circRNA -Ct GAPDH Mean HC. RE represents the relative change in expression, Ct circRNA and Ct GAPDH The Ct values ​​represent the target circRNA and the internal reference gene GAPDH in the same sample, respectively. ATB represents patients with active pulmonary tuberculosis, HC represents healthy controls, and Mean HC represents the mean value among all normal control groups. Negative controls and replicate experiments were included. The negative control was performed without cDNA template, using ddH2O instead. All RT-qPCRs were performed in triplicate. Relative circRNA expression analysis was conducted using GraphPad Prism 9 software, employing one-sample t-tests and independent samples t-tests. A p-value < 0.05 was considered statistically significant. The differentially expressed circRNA data were expressed as mean ± standard error, and a scatter plot including error bars was plotted.

[0043] The expression levels of hsa_circ_0002371 and hsa_circ_0007460 were detected in 30 patients with pulmonary tuberculosis and 32 healthy controls. The results showed that the expression of both hsa_circ_0002371 and hsa_circ_0007460 was significantly upregulated in patients with pulmonary tuberculosis. The difference in hsa_circ_0002371 expression level is shown in the figure. Figure 2 The expression levels of hsa_circ_0007460 are shown in the figure. Figure 3The results suggest that both can serve as diagnostic biomarkers. The area under the receiver operating characteristic (ROC) curves (AUC) for hsa_circ_0002371 was 0.8063, for hsa_circ_0007460 it was 0.7474, and for combined hsa_circ_0007460 it was 0.8177, indicating that hsa_circ_0002371 and hsa_circ_0007460 have good accuracy in diagnosing active pulmonary tuberculosis, and that their combined diagnosis can further improve diagnostic accuracy. The evaluation charts for the diagnostic performance of hsa_circ_0002371, hsa_circ_0007460, and their combined diagnosis are shown below. Figure 4 .

[0044] The above are preferred embodiments of the present invention. The scope of protection of the present invention is not limited thereto. Any simple changes or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the scope of the technology disclosed in the present invention shall fall within the scope of protection of the present invention.

Claims

1. The application of a reagent for detecting circRNA biomarkers in the preparation of a tuberculosis diagnostic kit, characterized in that, The circRNA marker is one or both of hsa_circ_0002371 and hsa_circ_0007460; hsa_circ_0002371 is 230 bp long and located on human chromosome 10, and its base sequence is shown in SEQ ID NO: 5; hsa_circ_0007460 is 363 bp long and located on human chromosome 1, and its base sequence is shown in SEQ ID NO:

6.

2. The application according to claim 1, characterized in that: The tuberculosis diagnostic kit is a diagnostic kit for diagnosing active pulmonary tuberculosis.

3. The application as described in claim 1 or 2, characterized in that, The tuberculosis diagnostic kit detects the levels of one or more of hsa_circ_0002371 and hsa_circ_0007460 in the sample of the tested subject, wherein the levels of hsa_circ_0002371 and hsa_circ_0007460 are positively correlated with the probability that the tested subject has pulmonary tuberculosis.

4. The application as described in claim 3, characterized in that, The levels of hsa_circ_0002371 and hsa_circ_0007460 were determined from peripheral blood mononuclear cells (PBMCs) in whole blood samples from the tested subjects.

5. The application of a primer in the preparation of a tuberculosis diagnostic kit, characterized in that, The tuberculosis diagnostic circRNA markers are one or both of hsa_circ_0002371 and hsa_circ_0007460; hsa_circ_0002371 is 230 bp long and located on human chromosome 10, and its base sequence is shown in SEQ ID NO: 5; hsa_circ_0007460 is 363 bp long and located on human chromosome 1, and its base sequence is shown in SEQ ID NO: 6; primers are used to obtain the expression levels of hsa_circ_0002371 and hsa_circ_0007460 in peripheral blood mononuclear cells (PBMCs) of the tested subjects; the primers consist of the following sequences: Forward primer sequence of hsa_circ_0002371: 5'-AGTCATTGTGGTTACCTTCTTGA-3'; Reverse primer sequence of hsa_circ_0002371: 5'-GGGCCTCTCCTTGCAGTATC-3'; Forward primer sequence of hsa_circ_0007460: 5'-GTGGGTCTGGAGTAAACAACAG-3'; Reverse primer sequence of hsa_circ_0007460: 5'-CCCTGTAAGCCTTGCCAAAA-3'.