Application of carbonic anhydrase gene βCA2 in increasing tomato fruit yield and regulating tomato flowering time

Abstract

The invention discloses the application of carbonic anhydrase gene βCA2 in improving tomato fruit yield and regulating tomato flowering time, and belongs to the field of biotechnology. The nucleotide sequence of the protein coding region of the carbonic anhydrase gene βCA2 is shown in SEQ ID NO.1. The invention also discloses the application of the protein encoded by the carbonic anhydrase gene βCA2 in improving tomato fruit yield and regulating tomato flowering time. The amino acid sequence of the protein encoded by the carbonic anhydrase gene βCA2 is shown in SEQ ID NO.2. The invention constructs a carbonic anhydrase gene βCA2 overexpression vector by transgenic technology, and screens the obtained carbonic anhydrase gene βCA2 overexpression homozygous strain by tissue culture technology, which can improve tomato fruit yield and promote tomato early flowering compared with a wild-type control group, and provides important gene resources for cultivating high-yield tomato varieties.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of a carbonic anhydrase gene beta CA2 in increasing tomato fruit yield and regulating tomato flowering time. Background Art

[0002] In the life activities of crops, CO2 is an important environmental factor involved in crop photosynthesis. Tomato is one of the most important crops in the world. China's annual tomato production is about 60 million tons, accounting for 35.3% of the global annual production. The total tomato cultivation area in China is about 16.637 million mu, and the facility cultivation area accounts for about 60%. However, the CO2 concentration in the facility cultivation environment is lower than the atmospheric CO2 concentration level for a long time, which reduces the photosynthetic efficiency of plants, and then puts tomatoes in a state of CO2 starvation, which may affect the growth, development and stress resistance of its stems, leaves, fruits and other organs.

[0003] In the prior art, in order to solve the technical problem of low CO2 concentration in the facility cultivation environment, the commonly used means is to apply CO2 fertilizer, such as the Chinese patent document with publication number CN113424717A discloses the use of zeolite molecular sieve as a carrier to apply CO2 gas fertilizer to the facility cultivation environment; or by promoting the accumulation of nutrients during the growth period of facility crops, improving the flowering and fruiting during the reproductive period, and other cultivation management techniques, such as the Chinese patent document with publication number CN113854066A discloses the use of conidia suspension of appropriate concentration, appropriate cultivation temperature and substrate pH to improve the ability of tomatoes to resist wilt disease and increase the yield of tomatoes per plant; but the above method is time-consuming and labor-intensive, and the cost expenditure is high. In addition, artificial cultivation management requires professional tomato practitioners to carry out. For varieties with low yields, it is difficult to achieve high yields even if the best management technology is provided, which has high limitations; there is also the selection of high-yield tomato varieties through hybrid breeding of cultivated varieties or wild species, but the cultivation of varieties has a long cycle, the mechanism is unclear, and it is uncertain whether the hybrid offspring can increase the yield, and the uncertainty is high.

[0004] Carbonic anhydrase (CAs) is a CO2-binding protein that catalyzes the mutual conversion between CO2 and HCO3- and is an important component of the HCO3- sensing and concentration system. Animal CAs are involved in a variety of metabolic processes, especially pathological-related metabolism, such as lipogenesis, gluconeogenesis, etc. Plant CAs are usually divided into α-, β- and γ-types according to their protein sequence and structure (DiMario RJ, Clayton H, Mukherjee A, Ludwig M, Moroney JV. Plant Carbonic Anhydrases: Structures, Locations, Evolution, and Physiological Roles. Mol Plant. 2017, 9; 10(1): 30-46.). α-type and γ-type CA proteins are highly expressed in reproductive organs, especially in endosperm and anthers, where they may play a role in developmental regulation. βCAs are highly expressed in leaves, accounting for 2% of leaf soluble proteins, and may affect stomatal movement and plant stress resistance. For example, Chinese patent document No. CN114736919A discloses that the drought resistance of corn can be improved by knocking out the carbonic anhydrase gene in corn.

[0005] CO2 is the carbon source for plant life activities. CAs are the core component of the carbon dioxide perception and concentration mechanism, allowing optimal growth under low carbon dioxide conditions. In addition, CAs are also involved in plant respiration, pH regulation, amino acid and lipid metabolism, stomatal movement, abiotic stress and other physiological processes. Studying the relationship between carbonic anhydrase gene and tomato yield has theoretical and practical application value, which can improve tomato yield from the genetic level and increase the certainty of cultivating high-yield tomatoes. Summary of the invention

[0006] The purpose of the present invention is to provide a gene that can increase tomato fruit yield and regulate tomato flowering time, so as to provide a basis for breeding high-yield and early-flowering tomato varieties.

[0007] The specific technical solutions adopted are as follows:

[0008] The present invention provides an application of a carbonic anhydrase gene βCA2 in increasing tomato fruit yield and regulating tomato flowering time. The nucleotide sequence of a protein coding region of the carbonic anhydrase gene βCA2 is shown in SEQ ID NO.1, and the length of the protein coding region is 840 bp.

[0009] The carbonic anhydrase gene βCA2 encodes a CO2 sensing protein composed of 279 amino acids with a molecular weight of 24.18KD. It is located on the cell membrane but has no transmembrane domain. It is an extrinsic protein of the cell membrane and may play a role in signal recognition.

[0010] The present invention also provides the use of a protein encoded by the carbonic anhydrase gene βCA2 in improving tomato fruit yield and regulating tomato flowering time. The amino acid sequence of the protein encoded by the carbonic anhydrase gene βCA2 is shown in SEQ ID NO.2.

[0011] Specifically, the carbonic anhydrase gene βCA2 or the protein encoded by the carbonic anhydrase gene βCA2 regulates the flowering time of tomatoes, which means promoting early flowering of tomatoes.

[0012] The transgenic plants overexpressing the carbonic anhydrase gene βCA2 grew vigorously during the vegetative growth period, had a high net photosynthetic rate, and accumulated sufficient nutrients. This may be due to the sufficient accumulation of nutrients, which promoted the early flowering time and the early entry into reproductive growth.

[0013] The present invention also provides a method for increasing tomato fruit yield and regulating tomato flowering time, wherein the carbonic anhydrase gene βCA2 in tomatoes is overexpressed, and the nucleotide sequence of the protein coding region of the carbonic anhydrase gene βCA2 is shown in SEQ ID NO.1.

[0014] The specific steps include:

[0015] (1) constructing a vector for overexpressing the carbonic anhydrase gene βCA2;

[0016] (2) constructing an Agrobacterium genetically engineered bacterium containing the vector used to overexpress the carbonic anhydrase gene βCA2 in step (1);

[0017] (3) Transforming the genetically engineered Agrobacterium described in step (2) into tomato tissues, and screening and culturing to obtain transgenic plants.

[0018] The present invention constructs a carbonic anhydrase gene βCA2 overexpression vector through transgenic technology, and uses tissue culture technology to screen and obtain a carbonic anhydrase gene βCA2 overexpression homozygous strain; experiments show that overexpressing the carbonic anhydrase gene βCA2 can increase tomato fruit yield and regulate tomato flowering time.

[0019] The vector is pAC004-HA vector.

[0020] Preferably, in step (1), upstream primers and downstream primers are selected, and PCR amplification is performed using tomato cDNA as a template. The amplified product is transformed by enzyme digestion and then ligated to the pAC004-HA vector by homologous recombination to construct a vector for overexpressing the carbonic anhydrase gene βCA2.

[0021] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0022] Preferably, the genetically engineered Agrobacterium is Agrobacterium tumefaciens GV3101 strain.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] (1) The present invention provides a method for cultivating high-yield and early-flowering tomato germplasm using transgenic technology, and obtains high-yield and early-flowering transgenic homozygous plants, which is of great significance for tomato production. It can reduce manual tomato management and help save the cost of orchard management. In addition, the high-yield traits of the strain can be integrated into other excellent varieties through cross-pollination, which plays an important role in actual production and new variety breeding.

[0025] (2) Compared with the control group, the SlβCA2 OE#1 and SlβCA2 OE#3 transgenic tomatoes cultivated by the present invention have significantly improved net photosynthetic rate, advanced flowering time, larger single fruit, and increased single plant fruit yield, indicating that overexpression of the carbonic anhydrase gene βCA2 can increase tomato fruit yield and promote early flowering of tomatoes; the present invention provides a new use of the carbonic anhydrase gene βCA2 in increasing tomato fruit yield and regulating tomato flowering time, providing an important gene resource for cultivating high-yield tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 These are optical pictures of the growth status of the wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressing SlβCA2OE#1, and overexpressing SlβCA2 OE#3 plants at the seedling stage in Example 1.

[0027] Figure 2 Statistical graphs of net photosynthetic rates of wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressing SlβCA2OE#1, and overexpressing SlβCA2 OE#3 in Example 1; a, b, and c represent significant differences at the 5% level.

[0028] Figure 3 This is a statistical chart of the flowering time of the first flower of the wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressing SlβCA2OE#1, and overexpressing SlβCA2 OE#3 plants in Example 1; a, b, and c represent significant differences at the 5% level.

[0029] Figure 4 This is a statistical diagram of the flowering position of the first panicle of the wild-type AC, mutant Slβca2#10, and overexpressing SlβCA2 OE#3 plants in Example 1, where a indicates no significant difference among the groups.

[0030] Figure 5These are optical pictures of fruits of wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressing SlβCA2OE#1, and overexpressing SlβCA2 OE#3 in Example 1.

[0031] Figure 6 This is a statistical graph of fruit diameters of wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressed SlβCA2OE#1, and overexpressed SlβCA2 OE#3 in Example 1; a, b, and c represent significant differences at the 5% level.

[0032] Figure 7 The statistical graphs of single fruit weight of wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressed SlβCA2OE#1, and overexpressed SlβCA2 OE#3 in Example 1; a, b, and c represent significant differences at the 5% level.

[0033] Figure 8 These are optical images of the ear phenotypes of the wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressing SlβCA2OE#1, and overexpressing SlβCA2 OE#3 in Example 1.

[0034] Fig. 9 The single plant yield statistics of wild-type AC, mutant Slβca2#8, mutant Slβca2#10, overexpressed SlβCA2OE#1, and overexpressed SlβCA2 OE#3 in Example 1; a, b, and c represent significant differences at the 5% level. DETAILED DESCRIPTION

[0035] The present invention is further illustrated below in conjunction with the examples and accompanying drawings. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0036] Example 1

[0037] (1) Construction and identification of carbonic anhydrase gene βCA2 overexpression vector and tomato plants

[0038] The coding sequence of the carbonic anhydrase gene βCA2 (NM_001310063.1) was obtained according to the tomato genome information provided by the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the nucleotide sequence of the protein coding region is shown in SEQ ID NO. 1, and the amino acid sequence of the protein encoded by the carbonic anhydrase gene βCA2 is shown in SEQ ID NO. 2. Referring to the Gateway manual, the upstream primer (SEQ ID NO. 3) 5'>AAACCTCCTCGGATTCCATTG>3' and the downstream primer (SEQ ID NO. 4) 5'>GGCGGTAAGGATCTGAGCTA>3' were designed using Primer5 software.

[0039] RNA was extracted from tomato leaves and cDNA was obtained by reverse transcription. Using cDNA as a template, the full-length coding region of the tomato carbonic anhydrase gene βCA2 was amplified by PCR using upstream primers and downstream primers. The amplified product was digested and transformed and connected to the pAC004-HA vector. The pAC004-HA vector carries an HA tag. After the recombinant plasmid was successfully constructed, it was transformed into the Agrobacterium tumefaciens GV3101 strain by electroporation. The transformed Agrobacterium was then used to infect tomato cotyledons and tissue culture was performed to screen SlβCA2 OE T0 generation plants. After protein was extracted from young leaves, Western blot verification was performed using HA specific recognition antibodies. The T0 generation strains with the target bands were used for identification and screening of three consecutive generations of self-pollination, and two homozygous T3 generation strains, SlβCA2 OE#1 and SlβCA2 OE#3, were obtained. (2) Preparation and identification of carbonic anhydrase gene βCA2 mutant materials

[0040] The coding sequence of the carbonic anhydrase gene βCA2 (NM_001310063.1) was obtained according to the tomato genome information provided by the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and the Cas9-designed editing site was used. The CRISPR target prediction website https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html was used to select two targets of about 20 bp (CA2-sgRNA1 (SEQ ID NO.5): CGGATTCGCTCATTTCAAGGCGG; CA2-sgRNA2 (SEQ ID NO.6): TTTATTTTCTACCAGTCGAGAGG) close to the start codon ATG to ensure that the target sequence was in the exon region and the continuity of the target sequence was guaranteed. The target fragment used for gene knockout was the target fragment containing the PAM structure (specific recognition of the Cas protein).

[0041] Design the corresponding CRISPR front primer and back primer sequences as shown below. The underlined part indicates the reverse complementary sequence of sgRNA.

[0042]

[0043]

[0044] Take 2 μL of the above CRISPR front primer and back primer respectively, mix them well and anneal them into double strands using a PCR instrument (amplification program: 98°C, 2 min; 98°C, 10 s; 61°C, 10 s, 38 cycles; 68°C, 10 s; 68°C, 5 min), and connect the fragments to the PHEE401 plasmid using Cas9 enzyme catalysis. After the recombinant PHEE401 plasmid is successfully constructed, it is transformed into the Agrobacterium tumefaciens GV3101 strain by electroporation, and then the transformed Agrobacterium is used to infect tomato cotyledons, and tissue culture is carried out. Resistance screening is used to obtain the mutant Slβca2 T0 generation plants.

[0045] Then, the editing site was detected at the DNA level: DNA of tomato leaves was extracted, and primers were designed upstream and downstream of the editing site using DNA as a template (as shown below), and PCR amplification was performed using upstream and downstream primers, and sequencing was performed to detect the editing type. The strains with base mutations were used for identification and screening of self-breeding for three consecutive generations, and homozygous mutant materials Slβca2#8 and Slβca2#10 were obtained for subsequent experiments of the present invention.

[0046] CA2-sg1-F (SEQ ID NO.11) GATTTCATCCTCCAATCCTCTAA CA2-sg1-R (SEQ ID NO.12) GTGGGAGTCAACTTTTCACATT CA2-sg2-F (SEQ ID NO.13) CAAATGGGTGACGTTCCA CA2-sg2-R (SEQ ID NO.14) GCAATGGCGTCTTCGTAT

[0047] Example 2

[0048] Five strains, namely wild-type control plants AC, mutant plants Slβca2#8 and Slβca2#10, overexpressing SlβCA2 OE#1 and overexpressing SlβCA2 OE#3, were sown and cultured in the same and suitable environment. The ambient temperature was controlled at about 25°C, the relative humidity was about 75%, and the light intensity was about 400 μmol m -2 s -1 After 45 days, the wild-type control plants and mutant plants were photographed and recorded. Figure 1 As shown, plants overexpressing SlβCA2 OE#1 and SlβCA2 OE#3 can significantly promote the growth of tomato plants, while the growth of mutant Slβca2#8 and mutant Slβca2#10 plants is significantly inhibited compared with wild-type plants.

[0049] Five strains, namely wild-type control plants AC, mutant plants Slβca2#8 and Slβca2#10, overexpressing SlβCA2 OE#1 and overexpressing SlβCA2 OE#3, were sown and cultured in the same and suitable environment. The ambient temperature was controlled at about 25°C, the relative humidity was about 75%, and the light intensity was about 400 μmol m -2 s -1 After 30 days, the net photosynthetic rate of mature expanded leaves at leaf positions 3-5 was measured using a 6400 photosynthetic meter. Figure 2 As shown, plants overexpressing SlβCA2 OE#1 and SlβCA2 OE#3 promoted the photosynthetic rate during the vegetative period, while mutants Slβca2#8 and Slβca2#10 inhibited the photosynthetic rate.

[0050] In addition, some wild-type control plants AC, mutant plants Slβca2#8 and Slβca2#10, overexpressed SlβCA2OE#1 and overexpressed SlβCA2 OE#3 were selected and planted in the greenhouse. After the tomato plants bloomed, the flowering time and flowering node were counted. The results were as follows: Figure 3 and Figure 4 As shown, it shows that overexpression of carbonic anhydrase gene βCA2 can promote early flowering of tomatoes. The mutant plants Slβca2#8 and Slβca2#10 delayed flowering time. Whether it is wild type or transgenic materials, the flowering position is at the 11th leaf position, indicating that early flowering has nothing to do with flowering node position; after the tomato plants have borne fruit and most of the fruits have changed color, the fruit diameter, single fruit weight, and single plant yield were counted and photographed and recorded. The results are shown in Figure 1. Figure 5-Figure 9 shown.

[0051] from Figure 5-Figure 7 It can be seen that the average fruit diameter of the wild-type control group AC was 29.2 mm, and the average fruit diameters of overexpressing SlβCA2 OE#1 and overexpressing SlβCA2 OE#3 were 32.6 mm and 31.8 mm respectively. Overexpression of the carbonic anhydrase gene βCA2 increased the fruit diameter, and the average fruit diameters of the mutants Slβca2#8 and Slβca2#10 were 22.4 mm and 25.2 mm respectively, which reduced the fruit diameter; the average weight of a single fruit in the wild-type control group AC was 28.0 g, and the average weight of a single fruit of overexpressing SlβCA2 OE#1 and overexpressing SlβCA2 OE#3 were 32.0 g and 31.8 g respectively, which increased the fruit size, and the average weight of a single fruit of the mutants Slβca2#8 and Slβca2#10 were 23 g and 21.5 g respectively, which reduced the fruit weight; the above results indicate that overexpression of βCA2 increases the fruit diameter and weight, making the fruit larger.

[0052] In order to analyze the effect of carbonic anhydrase gene βCA2 on tomato yield, the yield of each plant was counted. Figure 8-Figure 9 It can be seen that the average single plant yield of the wild-type control group AC was 331.0g, and the average single plant yield of overexpressing SlβCA2 OE#1 and overexpressing SlβCA2OE#3 was 437g and 515.8g, indicating that overexpressing the carbonic anhydrase gene βCA2 increased the fruit yield; the average single plant yield of mutant Slβca2#8 and mutant Slβca2#10 was 207.2g and 205.1g, indicating that inhibiting the expression of carbonic anhydrase gene βCA2 reduced the tomato fruit yield.

[0053] In summary, mutants Slβca2#8 and Slβca2#10 not only delayed flowering time, but also suffered from serious flower and fruit drop after flowering, resulting in a decrease in the number of tomato fruits; while transgenic plants overexpressing the carbonic anhydrase gene βCA2 grew vigorously during the vegetative growth period and had a high net photosynthetic rate, which may be due to sufficient accumulation of nutrients, promoting early flowering time and entering reproductive growth early; it may also be due to the distribution of nutrients, prompting metabolic transport from source to sink and promoting increased yield.

[0054] The above-described embodiments provide a detailed description of the technical solutions of the present invention. It should be understood that the above descriptions are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Carbonic anhydrase gene βCA2 The application of the method in increasing tomato fruit yield and promoting early flowering of tomatoes is characterized in that: The carbonic anhydrase gene βCA2 The nucleotide sequence of the protein coding region is shown in SEQ ID NO.

1.

2. Carbonic anhydrase gene βCA2 The use of the encoded protein in increasing tomato fruit yield and promoting early flowering of tomatoes is characterized in that: The carbonic anhydrase gene βCA2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A method for increasing tomato fruit yield and promoting early flowering of tomatoes, characterized in that: Carbonic anhydrase gene in tomato βCA2 Overexpression; the carbonic anhydrase gene βCA2 The nucleotide sequence of the protein coding region is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that: The specific steps include: (1) Construction of overexpression of carbonic anhydrase gene βCA2 The carrier; (2) Constructing a gene for overexpressing carbonic anhydrase in step (1) βCA2 Agrobacterium genetic engineering bacteria containing a vector; (3) Transforming the genetically engineered Agrobacterium described in step (2) into tomato tissues, and screening and culturing to obtain transgenic plants.

5. The method according to claim 4, characterized in that: The vector is pAC004-HA vector.

6. The method according to claim 4, characterized in that: The Agrobacterium genetic engineering bacteria is Agrobacterium tumefaciens GV3101 strain.

Images