A method for constructing a zebrafish epilepsy model
By using the CRISPANT technology to design a targeting site on the zebrafish cars2 gene, and utilizing the CRISPR/Cas9 system and sgRNA microinjection, a cars2 gene-deficient zebrafish epilepsy model was successfully constructed. This solves the problem of the lack of such models in existing technologies, achieves efficient and low-cost gene editing and model construction, and provides a powerful tool for epilepsy research.
Patent Information
- Application Number
- CN202310912824.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-24
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2043-07-24
AI Technical Summary
The existing technology has failed to effectively construct a zebrafish epilepsy model, especially a cars2 gene-deficient zebrafish model, for studying epilepsy-related genes and screening anti-epileptic drugs.
The CRISPANT technology was used to design a suitable targeting site in the zebrafish cars2 gene. The CRISPR/Cas9 system and specific single guide RNA (sgRNA) were used for microinjection to knock out a 37 bp fragment in exon 1 of the zebrafish cars2 gene, thus constructing a zebrafish model with cars2 gene deletion.
More efficient and precise gene editing has been achieved, and a reliable zebrafish epilepsy model has been constructed, providing a good basis for studying the pathogenesis of epilepsy and screening anti-epileptic drugs. The method is simple and low-cost.
Smart Images

Figure GDA0005566035470000051 
Figure GDA0005566035470000052 
Figure GDA0005566035470000061
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene editing technology, and in particular to a method for constructing a zebrafish epilepsy model. Background Art
[0002] CRISPR (clustered, regularly interspaced, short palindromic repeats) is an immune mechanism derived from bacteria that degrades invading viral DNA or other foreign DNA. In bacteria and archaea, CRISPR systems are divided into three categories. Class I and Class III require multiple CRISPR-associated proteins (Cas proteins) to work together, while Class II systems only require one Cas protein, which facilitates their widespread application. Currently, the CRISPR / Cas9 system is the most widely used. Researchers have found that using multiple sgRNAs to target the same gene can maximize the efficiency of KO editing and named this method CRISPANT technology.
[0003] As a vertebrate, zebrafish possess a complex nervous system and a genetic structure similar to humans, sharing approximately 70% of their genes with humans. Approximately 84% of genes associated with known human diseases are also expressed in zebrafish. Previous WES results from epilepsy patients identified the gene CARS2 as a potential cause of epilepsy, but no zebrafish lines with epilepsy-causing mutations in CARS2 have been reported. Summary of the Invention
[0004] In view of this, the present invention provides a method for constructing a zebrafish epilepsy model. The present invention designed a suitable targeting site on the cars2 gene and successfully bred cars2 gene-deficient zebrafish - a zebrafish epilepsy model.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides the use of cars2 gene knockout in preparing a zebrafish epilepsy model. In the present invention, the knockout or knockdown is achieved using CRISPANT technology, knocking out a 37bp fragment in exon 1 of the zebrafish cars2 gene, ultimately breeding cars2 gene-deficient zebrafish, i.e., a zebrafish epilepsy model.
[0007] The present invention provides the use of sgRNA targeting exon 1 of the cars2 gene in constructing a zebrafish epilepsy model or in screening anti-epileptic drugs.
[0008] This invention provides a sgRNA combination for CRISPANT-specific knockout of the zebrafish cars2 gene to construct a zebrafish epilepsy model. Using CRISPANT technology, a 37-bp fragment within exon 1 of the zebrafish cars2 gene was deleted, resulting in the generation of a cars2 gene-deficient zebrafish model of epilepsy. The deleted fragment is represented by SEQ ID NO: 7: GGACGGAAAGAGGGTGGGTAAAACCAGTGGGTTTTGA.
[0009] The present invention also provides an sgRNA targeting the zebrafish cars2 gene, comprising at least one of the sgRNAs with sequences such as SEQ ID NOs: 1 to 4.
[0010] In some specific embodiments, the sgRNA targeting the zebrafish cars2 gene of the present invention includes sgRNA1, sgRNA2, sgRNA3, and sgRNA4, whose sequences are shown in SEQ ID NOs: 1, 2, 3, and 4, respectively. The four sgRNAs target the same gene, which can maximize the editing efficiency and perform gene editing more effectively.
[0011] The present invention also provides a reagent for knocking out the zebrafish cars2 gene, comprising a Cas9 protein and the sgRNA of the present invention.
[0012] In some embodiments, the reagent for knocking out the zebrafish cars2 gene further comprises 10×cas9 nuclease reaction buffer and nuclease-free H 2 O. In some specific embodiments, the reagent for knocking out the zebrafish cars2 gene comprises water and the following components at the following concentrations: Cas9 protein 250 ng / μl, sgRNA 100 ng / μl.
[0013] The present invention also provides the use of the sgRNA or the reagent in constructing a zebrafish epilepsy model.
[0014] The present invention also provides a method for constructing a zebrafish epilepsy model, wherein the reagent of the present invention is injected into zebrafish fertilized eggs, and the zebrafish epilepsy model is obtained through hatching and screening.
[0015] In some embodiments, each fertilized egg is injected with 1 nl of the reagent, wherein the final concentration of Cas9 protein in the reagent is 250 ng / μl, and the final concentration of sgRNA is 100 ng / μl.
[0016] In some embodiments, the incubation is: constant temperature culture at 28°C until 5 dpf, and then transferred to 25°C for culture until 2-3 months of age.
[0017] In the method for constructing a zebrafish epilepsy model provided by the present invention, the screening is specifically as follows: taking juvenile fish that have developed to 3 months of age, cutting the fish tail to extract genomic DNA for PCR amplification, performing Sanger sequencing or electrophoresis on the amplified products, and obtaining zebrafish with a cars2 gene deletion based on the sequencing and / or electrophoresis results.
[0018] In some embodiments, the primers for PCR amplification include: an upstream primer whose sequence is shown as SEQ ID NO: 5 and a downstream primer whose sequence is shown as SEQ ID NO: 6.
[0019] The present invention also provides the use of the zebrafish epilepsy model constructed by the method in screening anti-epileptic drugs.
[0020] The present invention uses CRISPANT technology to design a suitable targeting site on the cars2 gene of zebrafish, and the specific sgRNA (final concentration 100ng / μL) synthesized in vitro and the Cas9 protein (final concentration 250μg / μL) are micro-injected into a zebrafish cell. After 24 hours of embryo culture, the embryos are selected for genotyping analysis to identify the effectiveness of the set targeting site. The present invention can silence specific genes in the genome of an organism more efficiently and accurately, and is simple to make and low in cost. It can also cut multiple sites on the target gene at the same time and silence any number of single genes. The zebrafish epilepsy model provided by the present invention has laid a good foundation for further research on the relationship between cars2 mutations and the pathogenesis of epilepsy and for screening anti-epileptic drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is a schematic diagram of the CRISPR / Cas9 knockout principle;
[0022] Figure 2 This is the sequence location map of the target site on the cars2 gene on the genome;
[0023] Figure 3 This is the electrophoresis detection diagram of four sgRNAs (M represents DNA Marker, from bottom to top are 100bp, 200bp, 300bp, 400bp, 500bp, 700bp, 1000bp; numbers 1, 2, 3, and 4 are sgRNA1, sgRNA2, sgRNA3, and sgRNA4 respectively);
[0024] Figure 4Electrophoresis diagram for verification of the activity of four sgRNAs (M represents DNA Marker, from bottom to top: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 700 bp, 1000 bp; numbers 1, 2, and 3 represent embryos after single-target injection of sgRNA1, numbers 4, 5, and 6 represent embryos after single-target injection of sgRNA2, numbers 7, 8, and 9 represent embryos after single-target injection of sgRNA3, and numbers 10, 11, and 12 represent embryos after single-target injection of sgRNA4; WT represents wild type);
[0025] Figure 5 Figure 5 shows the knockout efficiency of four sgRNAs after gene editing in zebrafish fertilized eggs. 5-A to 5-D are the results of sgRNA1 to sgRNA4 targeting, respectively.
[0026] Figure 6 This is the electrophoresis diagram for genotyping of the cars2 F0 generation (M represents DNA Marker, from bottom to top are (100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 700 bp, 1000 bp); numbers 1-8 are the tail numbers of the F0 generation, and WT is the wild type;
[0027] Figure 7 This is the electrophoresis diagram for genotyping of the cars2 F1 generation (M represents DNA Marker, from bottom to top it is (100bp, 200bp, 300bp, 400bp, 500bp, 700bp, 1000bp); numbers 1-8 are the tail numbers of the F1 generation, and WT is the wild type);
[0028] Figure 8 Comparison of sequencing peaks of the wild type (8-A) and mutant (8-B) of cars2 F1 generation;
[0029] Figure 9 This is the survival curve of zebrafish with each genotype of cars2-37bp deletion;
[0030] Figure 10 Representative electrophysiological signals of zebrafish in the cars2-HET knockdown group. DETAILED DESCRIPTION
[0031] The present invention provides a method for constructing a zebrafish epilepsy model. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
[0032] The test materials used in the present invention are all common commercial products and can be purchased in the market.
[0033] The present invention will be further described below in conjunction with the embodiments:
[0034] Example 1
[0035] 1) Design of CRISPR / Cas9 gene knockout target sites and detection primers
[0036] The genomic DNA sequence of the zebrafish cars2 gene (Gene ID: 555187) was searched on the National Center for Biotechnology Information (NCBI). Figure 1 ), design the target site of the cars2 gene on the website CHOPCHOP (http: / / chopchop.cbu.uib.no / ). The selection of the target site must follow this standard: 5'-GG-(N)18-NGG-3'. The GG dinucleotide at the 5' end is part of the T7 promoter. This restriction does not apply when designing the target site, but the 3' end of the target site must be NGG. The target site must be within the structural domain of the gene to ensure that the insertion or deletion of the target site base can affect the entire structural domain of the cars2 gene, thereby changing the expression of the gene. The target site of the gene to be knocked out is located in exon 1 of the cars2 gene ( Figure 2 ), the sgRNA sequences are shown in Table 1, sgRNA1 to sgRNA4 target CRISPR1, ~ CRISPR4 in sequence, the positions and sequences of sgRNA1 to sgRNA4 sequences and their targeted gene fragments are shown in Table 1. Figure 2 shown.
[0037] Table 1 sgRNA sequences
[0038]
[0039] Primers were designed using Primer Premier 3.0 software (as shown in Table 2) using the genomic region approximately 200 bp upstream and downstream of the CRISPANT target site of the cars2 gene.
[0040] Table 2 Primer sequences
[0041]
[0042] 2) sgRNA synthesis and quality control
[0043] Using the designed primers, a PCR experiment was performed to verify the sequence of the designed sgRNA. Once confirmed, the designed sgRNA was sent to a commercial company (Nanjing GenScript Biotechnology Co., Ltd., hereinafter referred to as Nanjing GenScript) for synthesis.
[0044] Centrifuge the four sgRNAs at 14,000 rpm for 10 minutes to precipitate the RNA powder. Then, add 15 μL of RNase-free double-distilled water to dissolve the RNA powder. Test the quality of the four dissolved sgRNAs.
[0045] First, take 1 μL of sgRNA solution and test the concentration on a UV spectrophotometer. Record the concentration and OD260 / 280 data of each sgRNA. Then, take 1 μL of sgRNA solution and mix it with loading buffer for agarose gel electrophoresis to detect whether the sgRNA is a single band. If the sgRNA concentration is high (at least higher than 600 ng / μL) and the electrophoresis band is a uniform band (such as Figure 3 Microinjection experiments can be performed.
[0046] Figure 3 The results showed that all four sgRNA bands were single bands, free of impurities, and high concentrations allowed for microinjection experiments.
[0047] 3) Activity verification of single sgRNA
[0048] Before formal targeting, it is necessary to test whether the designed sgRNA can effectively edit. Therefore, the activity of a single sgRNA was verified. The Cas9 protein (Nanjing GenScript, Z03389-50) was complexed with four different sgRNAs according to the system in Table 3, so that the final concentration of Cas9 protein was 250ng / μl and the final concentration of sgRNA was 100ng / μl. About 1nL of the Cas9 protein and sgRNA mixture was injected into the one-cell fertilized egg. The injected fertilized eggs were placed in E3 water and incubated at 28°C. The embryonic phenotype was observed under a stereomicroscope, and normally developed embryos were screened for target site mutation analysis.
[0049] Table 3 sgRNA and cas9 protein complex system
[0050]
[0051] 4) Sanger sequencing to detect the effectiveness of sgRNA
[0052] After microinjection of zebrafish embryos, some normally developed early embryos were selected to test for mutations in the cars2 gene, to confirm in advance whether the selected target site was effective and whether the microinjection operation was standardized.
[0053] a. Extracting the zebrafish genome
[0054] 24 hours after fertilization of zebrafish embryos (24 hpf), one tube of wild-type embryos (as a control) and three tubes of embryos from the injected experimental group (each experimental group) were collected into 1.5 mL Eppendorf tubes (5 embryos per tube), and lysis buffer was added to extract genomic DNA.
[0055] b. PCR amplification of target sequence
[0056] After extracting genomic DNA, primer sequences were designed using PrimerPremier 3.0 software based on the genomic region approximately 200 bp upstream and downstream of the CRISPANT target site to amplify the target DNA fragment.
[0057] Table 4 PCR reaction system
[0058]
[0059]
[0060] After mixing, centrifuge and perform amplification reaction on a PCR instrument. The reaction conditions are: pre-denaturation at 95℃ for 5 minutes, (denaturation at 95℃ for 30 seconds, annealing at 56℃ for 30 seconds, extension at 72℃ for 30 seconds) 35 cycles, and then 72℃ for 8 minutes. After the reaction is completed, centrifuge the PCR product and take 2μL sample to spot on 1.3% agarose gel for electrophoresis to check whether the PCR product size is correct, such as Figure 4 shown.
[0061] Figure 4 The results showed that the band was single and could be sent to a commercial company (Shanghai Sangon Biotech Co., Ltd.) for Sanger sequencing.
[0062] c. If the PCR product is correct, send it to Sanger sequencing. Figure 5) to preliminarily obtain the information of insertion or deletion, and then compare it with the tide website to obtain the sgRNA knockout efficiency. After confirming that the sgRNA is effective, the formal injection is carried out.
[0063] in, Figure 5 In A to D, the blue portion represents the gene sequence targeted by the sgRNA. The high peak values in the peak graph indicate that sgRNAs 1 to 4 have high editing efficiencies. Since sgRNA 4 targets the site on the complementary strand, the blue portion in this peak graph represents the reverse complement of the gene sequence targeted by sgRNA 4.
[0064] Table 5 Single sgRNA knockout efficiency
[0065] sgRNA1 sgRNA2 sgRNA3 sgRNA4 Knockout efficiency 59% 79% 74% 90%
[0066] 4) Microinjection of zebrafish embryos
[0067] Within 30 minutes after fertilization, the embryos were transferred with a pipette to a microinjection dish made of agarose.
[0068] Before microinjection, Cas9 protein and four different sgRNAs were thoroughly mixed to a final concentration of 250 ng / μl for Cas9 protein and 100 ng / μl for each sgRNA. Approximately 1 nL of the Cas9 protein and sgRNA mixture was injected into one-cell zygotes. Injected zygotes were placed in E3 water and incubated at 28°C. Embryonic phenotypes were observed under a stereomicroscope, and embryos with normal development were selected for target site mutation analysis.
[0069] Three tubes of embryos (5 embryos per tube) were selected to detect the efficiency of targeting and knockout. The detection steps were the same as above. After confirming that the knockout was effective, the remaining embryos were raised to 3 months of age.
[0070] 5) Screening of F0 generation mutant zebrafish
[0071] a. Extracting the zebrafish genome
[0072] After the embryos were raised to 3 months of age, part of the tail fin tissue of the adult zebrafish was collected in a 1.5 mL centrifuge tube, and lysis buffer was added to the EP tube to extract genomic DNA.
[0073] b. PCR amplification of target sequence
[0074] After extracting genomic DNA, amplify the target DNA fragment using the primer sequences listed in Table 2 and the PCR reaction system listed in Table 4. The reaction conditions were: initial denaturation at 95°C for 5 minutes, 35 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds, followed by PCR at 72°C for 8 minutes. After the reaction was complete, centrifuge the PCR product and apply 2 μL of the sample to a 1.3% agarose gel for electrophoresis to verify the correct size of the PCR product.
[0075] c. If the PCR product is correct, send it to Sanger sequencing and obtain the insertion or deletion information from the sequencing peak graph. Screen out the F0 generation zebrafish carrying the mutation. The experimental results are as follows Figure 6 shown.
[0076] Figure 6 The results showed that the target band was single and could be sent to a commercial company (Shanghai Sangon Biotech Co., Ltd.) for Sanger sequencing.
[0077] 6) Obtaining F1 generation of heritable zebrafish mutants
[0078] Through the previous series of screening, the F0 generation of zebrafish mutants was determined. Then, the F0 generation mutants were hybridized with wild-type zebrafish to obtain F1 generation embryos, which were cultured at 28°C and the survival rate of the F1 generation was observed in the initial stage.
[0079] If a mutation is detected in the F1 generation embryo, the F1 generation of zebrafish mutants will be raised to 2-3 months. Then, the tails of each F1 generation zebrafish are cut and the F1 generation mutants are screened (the specific method is as described in 5)). The experimental results are as follows: Figure 7 shown.
[0080] The results showed that the band was single and could be sent to a commercial company (Shanghai Sangon Biotech Co., Ltd.) for Sanger sequencing.
[0081] According to the Sanger sequencing results of the F1 generation mutants that have been screened, it was found that the cars2 gene had a 37bp deletion in exon 1. Figure 8 As shown, the blue box portion is the deleted 37 bp sequence: GGACGGAAAGAGGGTGGGTAAAACCAGTGGGTTTTGA (SEQ ID NO: 7).
[0082] Figure 8 The results showed that: According to the sequencing peak graph, the mutant had a 37bp sequence missing in the sgRNA sequence compared to the wild-type sequence, causing a frameshift mutation. Figure 8 The sequencing results were obtained using primer cars2-F.
[0083] 7) F2 representative phenotypic experiment
[0084] The F1 generation that carried the mutation (37bp deletion) identified in the previous series of screening was raised to sexual maturity. Then, the F1 generation with the same mutation was self-pollinated to obtain F2 generation embryos, which were cultured at 28°C. 50 normal embryos were randomly selected to observe their survival rate (embryos developed from 2dpf to 21dpf. After the end of the experiment at 21dpf, all dead and surviving individuals were genotyped). The results are shown in the table. Figure 9 .
[0085] The results showed that homozygous mutant zebrafish died at 11-12 dpf. The experimental results showed that the loss of the cars2 gene caused the homozygous mutant zebrafish to die.
[0086] The F2 generation embryos were obtained by self-fertilization of the F1 generation with the same mutation and cultured at 28°C. Fifty juveniles that developed to 5 dpf were randomly selected to observe the neuroelectrophysiological phenotype of the F2 generation mutant juveniles. The neuroelectrophysiological test results showed that epileptiform signals were observed in heterozygous mutant juveniles. The experimental results are as follows Figure 10 shown.
[0087] The above experimental results show that the loss of the cars2 gene causes epileptic seizures in zebrafish.
[0088] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. Application of cars2 gene knockout or knockdown in preparing zebrafish epilepsy models.
2. A method for constructing a zebrafish epilepsy model, characterized in that: Reagents including Cas9 protein and sgRNA targeting exon 1 of the cars2 gene were injected into zebrafish fertilized eggs, and a zebrafish epilepsy model was obtained after hatching and screening.
3. The method according to claim 2, characterized in that Each fertilized egg was injected with 1 nL of the reagent, in which the final concentration of Cas9 protein was 250 ng / μl and the final concentration of sgRNA was 100 ng / μl.
4. The method according to claim 2, characterized in that The incubation is as follows: culturing at a constant temperature of 28° C. until 5 dpf, and then transferring to 25° C. for culturing until 2-3 months old.
5. The method according to claim 2, characterized in that The screening specifically includes: taking 3-month-old juvenile fish, cutting the fish tail to extract genomic DNA for PCR amplification, performing Sanger sequencing or electrophoresis on the amplified products, and obtaining gene-deficient zebrafish based on the sequencing and / or electrophoresis results.
6. The method according to claim 5, characterized in that The primers for PCR amplification include: an upstream primer whose sequence is shown as SEQ ID NO: 5 and a downstream primer whose sequence is shown as SEQ ID NO:
6.
7. Use of the zebrafish epilepsy model constructed by the method according to any one of claims 2 to 6 in screening anti-epileptic drugs.
Citation Information
Patent Citations
FARS2 gene knockout or knockdown non-human animal model as well as construction method and application thereof
CN114015719A