Application of Escherichia coli sRNA0004 regulatory preparation in the preparation of a kit for regulating bacterial drug resistance
Through the Escherichia coli sRNA0004 control agent, the drug resistance of bacteria is regulated, and the problem of insufficient regulation of bacterial resistance in the prior art is solved, positive or negative regulation of bacterial resistance is achieved, and treatment methods for drug-resistant strain infection are provided.
Patent Information
- Application Number
- CN202310807628.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-03
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2043-07-03
AI Technical Summary
In the prior art, there are few researches on the regulation mechanism of bacterial resistance, especially in the presence of antibiotics, there is a lack of effective means of regulation of bacterial resistance.
The bacteria's drug resistance is regulated by Escherichia coli sRNA0004 modulation agent, including forward modulation agent (sRNA0004 overexpression preparation) and negative modulation agent (sRNA0004 silencing preparation). Specific methods include the preparation of expression cassettes, vectors or transgenic cells of the sRNA0004 gene.
Effective regulation of bacterial resistance has been achieved. Overexpression of sRNA0004 can enhance bacterial resistance, while silencing sRNA0004 expression can reduce bacterial resistance, providing a new way for the treatment of drug-resistant strain infection.
Smart Images

Figure CN116763927B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of an Escherichia coli sRNA0004 regulating preparation in the preparation of a kit for regulating bacterial drug resistance. Background Art
[0002] RNA in organisms includes coding RNA and non-coding RNA (ncRNA). Non-coding RNA regulates a wide range of biological activities. Similar to eukaryotes, prokaryotes also contain some non-coding RNA fragments, known as small non-coding RNA (sRNA), which influence prokaryotic metabolism, virulence, and drug resistance of pathogens at the post-transcriptional level.
[0003] Bacterial sRNAs are a class of non-protein-encoding RNA molecules ranging from 40 to 500 nt in length. They have a short half-life and are composed of three components: a variable target binding sequence, a conserved sequence, and a Rho factor-independent transcription termination sequence. The secondary structure they form often includes a stem-loop structure, which significantly enhances the stability of sRNAs. Based on how they pair with their target genes, bacterial sRNAs are divided into cis-encoded sRNAs and trans-encoded sRNAs. Trans-encoded sRNAs are transcribed from genomic locations distinct from the genes encoding their target mRNAs. These sRNAs have less complementarity with their target mRNAs and often rely on RNA chaperone proteins such as Hfq, ProQ, and CsrA to maintain their structural stability and function.
[0004] In 1984, Mizuno et al. first discovered a 174-nt sRNA, micF, in Escherichia coli (E. coli). It can inhibit the translation of the outer membrane porin OmpF through RNA / RNA base pairing under environmental stress conditions. Since the 21st century, with the development of modern high-throughput technologies and advances in bioinformatics, more and more sRNAs involved in bacterial regulation under environmental stress have emerged. To date, hundreds of sRNAs have been documented in the sRNAmap database, with the largest number found in Escherichia and Salmonella. Consequently, research on sRNAs has tended to focus on exploring their biological functions, identifying their target genes, the molecular mechanisms by which sRNAs regulate target genes, and the potential applications of sRNAs. However, research on the genetic regulatory mechanisms of sRNAs produced in bacteria in the presence of antibiotics has been relatively limited. Summary of the Invention
[0005] In view of the defects in the prior art, the purpose of the present invention is to provide an application of an Escherichia coli small RNA sRNA0004 regulatory preparation in regulating the bacterial resistance produced by antibiotics.
[0006] The purpose of the present invention is achieved through the following technical solutions:
[0007] The present invention provides an application of an Escherichia coli small RNA sRNA0004 regulating preparation in preparing a kit for regulating bacterial drug resistance. The nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO.1.
[0008] Preferably, the regulating bacterial resistance includes regulating the bacterial resistance to aminoglycoside antibiotics and / or regulating the bacterial resistance to carbapenem antibiotics.
[0009] Preferably, the aminoglycoside antibiotics include gentamicin; and the carbapenem antibiotics include imipenem.
[0010] Preferably, the regulatory agents include positive regulatory agents and negative regulatory agents;
[0011] The positive regulatory agent includes an sRNA0004 overexpression agent;
[0012] The negative regulatory agent includes an sRNA0004 silencing agent or an agent that reduces the expression of sRNA0004.
[0013] Preferably, the sRNA0004 overexpression preparation comprises one or more of the expression cassette, vector or transgenic cell of the sRNA0004 gene described in the above technical solution.
[0014] Preferably, the bacteria include Escherichia coli; the Escherichia coli includes one or more of enterotoxigenic Escherichia coli, enteroinvasive Escherichia coli, enteropathogenic Escherichia coli, enteroaggregative adhering Escherichia coli and enterohemorrhagic Escherichia coli.
[0015] The present invention provides a MIM0004 gene for inhibiting the expression of the sRNA0004 gene. The nucleotide sequence of the MIM0004 gene is shown in SEQ ID NO.2.
[0016] The present invention provides a preparation for reducing the expression of sRNA0004, which comprises one or more of the expression cassette, vector or transgenic cell of the MIM0004 gene described in the above technical solution.
[0017] The present invention also provides a use of a preparation for reducing the expression of Escherichia coli small RNA sRNA0004 in the preparation of a drug for treating diseases caused by infection with drug-resistant strains of Escherichia coli. The nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO.1.
[0018] Preferably, the Escherichia coli includes one or more of enterotoxigenic Escherichia coli, enteroinvasive Escherichia coli, enteropathogenic Escherichia coli, enteroaggregative adhering Escherichia coli and enterohemorrhagic Escherichia coli.
[0019] Beneficial effects of the present invention:
[0020] The present invention provides an application of an Escherichia coli small RNA sRNA0004 regulatory preparation in the preparation of a kit for regulating bacterial drug resistance, wherein the nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO.1. In the present invention, the Escherichia coli non-coding small RNA sRNA0004 is related to bacterial drug resistance, and the effect of regulating bacterial drug resistance can be achieved by regulating the expression of sRNA0004. The sRNA0004 overexpression preparation can positively regulate bacterial drug resistance, and the preparation that reduces sRNA0004 expression can negatively regulate bacterial drug resistance, that is, the overexpression of sRNA0004 can increase bacterial drug resistance, and after sRNA0004 is silenced, the bacterial drug resistance can be reduced. The Escherichia coli small RNA sRNA0004 regulatory preparation provided by the present invention is of great significance in the field of changing bacterial drug resistance, thereby providing a way to treat infection by drug-resistant strains. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1 This is the secondary stem-loop structure diagram of sRNA0004;
[0023] Figure 2 Schematic diagram of the peT28a-sRNA0004 expression vector;
[0024] Figure 3 is a schematic diagram of the MIM0004 sequence;
[0025] Figure 4 Schematic diagram of the ptrC99a-MIM0004 interference vector;
[0026] Figure 5 This is the result of qRT-PCR detection of the expression level of sRNA0004 in transgenic Escherichia coli;
[0027] Figure 6 This is the result of drug resistance analysis of Escherichia coli MG1655 containing recombinant plasmids peT28a-sRNA0004 and ptrC99a-MIM0004. DETAILED DESCRIPTION
[0028] The present invention provides an application of an Escherichia coli small RNA sRNA0004 regulating preparation in preparing a kit for regulating bacterial drug resistance. The nucleotide sequence of the sRNA0004 is shown in SEQ ID NO. 1: 5'-TTGATAACTCCCCCAAAATAGTTCGAGTTGCAGAAAGGCGGCAAGCTCG AGAATTCCCGGGAGCTTACATCAGTAAGTGACCGGGATGAGCGAGCGAAG ATAACGCATCTGCGGCGCGAAATATGAAGGGGGAGAGCCCTTATAGACCAGG-3'.
[0029] In the present invention, the secondary stem-loop structure of sRNA0004 is as follows Figure 1 shown.
[0030] The present invention has found through research that the Escherichia coli non-coding small RNA sRNA0004 is related to bacterial resistance, and the non-coding small RNA sRNA0004 can improve the drug resistance of Escherichia coli, providing an experimental basis for further negatively regulating sRNA0004 and thereby reducing bacterial resistance. The present invention can achieve the effect of regulating bacterial resistance by regulating the expression of sRNA0004. The sRNA0004 overexpression preparation can positively regulate bacterial resistance, and the preparation that reduces sRNA0004 expression can negatively regulate bacterial resistance, that is, the overexpression of sRNA0004 can enhance bacterial resistance, while the preparation that reduces sRNA0004 expression can reduce bacterial resistance. The Escherichia coli small RNA sRNA0004 regulation preparation provided by the present invention is of great significance in the field of changing bacterial resistance, and thus provides a way to treat infections caused by drug-resistant strains.
[0031] In the present invention, the bacteria preferably include, but are not limited to, Escherichia coli. In the present invention, the Escherichia coli preferably includes, but is not limited to, one or more of enterotoxigenic Escherichia coli, enteroinvasive Escherichia coli, enteropathogenic Escherichia coli, enteroaggregative adhering Escherichia coli, and enterohemorrhagic Escherichia coli.
[0032] In the present invention, the regulation of bacterial drug resistance preferably includes but is not limited to regulation of bacterial resistance to aminoglycoside antibiotics. In the present invention, the aminoglycoside antibiotics preferably include but are not limited to gentamicin.
[0033] In the present invention, the regulation of bacterial resistance preferably includes but is not limited to regulation of bacterial resistance to carbapenem antibiotics. In the present invention, the carbapenem antibiotics preferably include but are not limited to imipenem.
[0034] In the present invention, the regulatory agents preferably include positive regulatory agents and negative regulatory agents.
[0035] In the present invention, the positive regulatory agent preferably includes an sRNA0004 overexpression agent. In the present invention, the positive regulatory agent can enhance the drug resistance of bacteria.
[0036] In the present invention, the sRNA0004 overexpression preparation includes one or more of the expression cassette, vector or transgenic cell of the sRNA0004 gene described in the above technical solution.
[0037] The present invention has no particular limitation on the preparation method of the expression cassette, vector or transgenic cell of the sRNA0004 gene, and any conventional preparation method in the art may be used.
[0038] In the present invention, the method for preparing the sRNA0004 gene vector preferably comprises the following steps:
[0039] The gene encoding the sRNA0004 in the above technical solution was cloned into a prokaryotic expression vector to obtain an sRNA0004 overexpression vector.
[0040] In the present invention, the sRNA0004 gene is preferably obtained as the target gene by PCR amplification. In the present invention, the sRNA0004 gene is preferably obtained by PCR amplification using Escherichia coli genomic DNA as a template.
[0041] In the present invention, the primers for the sRNA0004 gene preferably include an upstream primer and a downstream primer. In the present invention, an EcoRI restriction site sequence is preferably introduced into the upstream primer; and a HindIII restriction site sequence is preferably introduced into the downstream primer. In the present invention, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3 (5'-CGAATTCTTGATAACTCCC-3'). In the present invention, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4 (5'-CCTTAAGCCTGGTCTATAAG-3').
[0042] The present invention does not specifically limit the reaction conditions of the PCR amplification, and any conventional PCR method in the art can be used to amplify the target gene. In the present invention, the PCR reaction system preferably includes 25 μL of Taq DNA polymerase Mix, 1 μL of an upstream primer with a concentration of 10 μM, 1 μL of a downstream primer with a concentration of 10 μM, 2 μL of a template DNA with a concentration of 10 μM, and sterile water to 50 μL. In the present invention, the PCR reaction procedure includes: 94°C, pre-denaturation for 5 minutes; 94°C, denaturation for 30 seconds; 58°C, annealing for 30 seconds, 72°C, extension for 20 seconds, 35 amplification cycles; finally 72°C, extension for 10 minutes; and storage at 4°C.
[0043] After the PCR reaction is completed, the present invention preferably performs electrophoresis on the PCR product to recover the target band of the sRNA0004 gene. The electrophoresis of the present invention is preferably performed in a 1.4% agarose gel. The recovery of the target band of the present invention is preferably performed using a small amount of agarose gel DNA recovery kit. After the target band of the sRNA0004 gene is recovered, the recovered product is connected to a TA vector to obtain a plasmid cloning vector. The present invention does not specifically limit the connection method, and conventional connection methods in the art can be used. In the present invention, the TA vector preferably includes but is not limited to pMD TM 19-T Vector. After obtaining the plasmid cloning vector, the present invention preferably transforms the plasmid cloning vector into competent Escherichia coli. The present invention does not particularly limit the transformation method, and conventional transformation methods in the art can be used. After transformation, the present invention preferably cultures the Escherichia coli to amplify the plasmid cloning vector. After culture, the present invention preferably sequences the plasmids of positive colonies identified by colony PCR to confirm that the target gene obtained is the sRNA0004 gene.
[0044] After confirming that the target gene is obtained, the present invention preferably clones the target gene into a prokaryotic expression vector to obtain an overexpression sRNA0004 vector.
[0045] In the present invention, the overexpression sRNA0004 vector preferably comprises a lac promoter, the target gene sRNA0004 gene, and the 3' terminator region of T7. In the present invention, the marker gene in the overexpression sRNA0004 vector is preferably a lacI gene. In the present invention, the prokaryotic expression vector preferably includes, but is not limited to, a peT28a plasmid.
[0046] The MIM0004 gene vector is preferably an interference vector composed of the trc promoter 8×MIM0004 sequence and the rrnB T2 3′ transcription termination region.
[0047] The present invention has no particular limitation on the method for cloning the target gene into the prokaryotic expression vector, and any conventional method in the art may be used.
[0048] The present invention preferably extracts the plasmid from Escherichia coli cultured according to the above technical solution to obtain a plasmid cloning vector. The present invention does not specifically limit the method for extracting the plasmid, and conventional extraction methods in the art can be used. The present invention preferably uses the endotoxin-free plasmid mini-medium extraction kit (DP118) (purchased from Tiangen Biochemical Technology Co., Ltd.) to extract the plasmid.
[0049] After obtaining the plasmid cloning vector, the present invention preferably uses EcoRI and HindIII restriction endonucleases to enzymatically digest the plasmid cloning vector to obtain a target fragment with an enzyme cleavage site. In the present invention, the enzyme cleavage system of the target gene preferably includes: 10× endonuclease Buffer 2μL, EcoRI 1μL, HindIII 1μL, and target gene gel recovery fragment 16μL (containing approximately 500ng DNA fragment). In the present invention, the temperature of the enzyme cleavage is preferably 35℃~38℃, more preferably 37℃; the time of the enzyme cleavage is preferably 5~30min, more preferably 30min. The present invention preferably uses EcoRI and HindIII restriction endonucleases to digest the prokaryotic expression vector to obtain a linear prokaryotic expression vector. In the present invention, the enzyme cleavage system of the prokaryotic expression vector preferably includes: 10× endonuclease Buffer 2μL, EcoRI 1μL, HindIII 1μL, and prokaryotic expression vector 16μL (containing approximately 500ng DNA fragment). In the present invention, the enzymatic digestion conditions of the target gene are preferably the same as those of the prokaryotic expression vector, and are not described in detail here. After the enzymatic digestion reaction is completed, the present invention preferably performs electrophoresis on the target gene obtained by enzymatic digestion and the linear prokaryotic expression vector obtained by enzymatic digestion, respectively, to obtain target gene bands obtained by enzymatic digestion and linear prokaryotic expression vector bands obtained by enzymatic digestion. The electrophoresis of the present invention is preferably performed using a 1.5% agarose gel. After the electrophoresis is completed, the present invention preferably recovers the bands in the gel. The present invention preferably uses a small amount of agarose gel DNA recovery kit for band recovery, and obtains gel-recovered target gene fragments and gel-recovered vector fragments, respectively.
[0050] After obtaining the target gene fragment after gel recovery and the vector fragment after gel recovery, the present invention preferably connects the target gene fragment after gel recovery to the vector fragment after gel recovery to obtain an overexpression sRNA0004 vector. The present invention has no special limitation on the connection method, and any conventional connection method in the field can be used. In the present invention, the connection is preferably performed by T4 DNA ligase. In the present invention, the connection system preferably includes: 1 μL of the vector fragment after gel recovery, 6 μL of the target gene fragment after gel recovery, 2 μL of 5×T4 DNA Ligase Buffer and 1 μL of T4 DNA Ligase. The temperature of the connection in the present invention is preferably 25°C; the time of the connection is preferably 2h. In the present invention, the overexpression sRNA0004 vector is preferably the recombinant plasmid peT28a-sRNA0004. The schematic diagram of the recombinant plasmid peT28a-sRNA0004 is shown as follows. Figure 2 shown.
[0051] The recombinant plasmid peT28a-sRNA0004 prepared by the above method can express sRNA0004 in large quantities in bacterial cells, allowing for further observation or investigation of the effects of sRNA0004 overexpression on bacterial drug resistance. The present invention has discovered that overexpression of sRNA0004 can enhance bacterial drug resistance, providing experimental evidence for further negative regulation of sRNA0004 to reduce bacterial drug resistance.
[0052] When using the sRNA0004 overexpression vector in the present invention, the sRNA0004 overexpression vector is preferably transformed into bacteria. In the present invention, the bacteria is preferably Escherichia coli MG1655. The present invention does not particularly limit the transformation method, and conventional transformation methods in the art can be used. In the present invention, the sRNA0004 overexpression vector is preferably directly transformed into Escherichia coli by electroporation.
[0053] In the present invention, the negative regulatory agent preferably includes an sRNA0004 silencing agent or an agent that reduces the expression of sRNA0004. In the present invention, the negative regulatory agent or the agent that reduces the expression of sRNA0004 can reduce the drug resistance of bacteria, thereby improving the control effect on bacteria.
[0054] The present invention provides a MIM0004 gene for inhibiting the expression of the sRNA0004 gene. The nucleotide sequence of the MIM0004 gene is shown in SEQ ID NO.2.
[0055] In the present invention, the nucleotide sequence of SEQ ID NO.2 is as follows:
[0056] 5'-TAAGCTC GGTGGAAT CAA CGAGCTT-3'.
[0057] Note: The underline indicates the insertion of an additional 6 bases.
[0058] In the present invention, the MIM0004 gene is mainly designed based on the MIM (target mimic) technology. The MIM0004 gene corresponds to bases 43 to 67 of sRNA0004, and an additional 6 bases are inserted between bases 8 to 10 and 16 to 18 to reduce the expression of the sRNA0004 gene, such as Figure 3 shown.
[0059] The present invention provides a preparation for reducing the expression of sRNA0004, which comprises one or more of the expression cassette, vector or transgenic cell of the MIM0004 gene described in the above technical solution.
[0060] The present invention has no particular limitation on the preparation method of the expression cassette, vector or transgenic cell of the MIM0004 gene, and any conventional preparation method in the art may be used.
[0061] In the present invention, the method for preparing the MIM0004 gene vector preferably comprises the following steps:
[0062] The MIM0004 gene described in the above technical solution is cloned into a prokaryotic expression vector to obtain a MIM0004 gene expression vector.
[0063] The present invention preferably clones the 8×MIM0004 gene into a prokaryotic expression vector to obtain a MIM0004 gene vector. In the present invention, the nucleotide sequence of the 8×MIM0004 gene is shown in SEQ ID NO.5.
[0064] In the present invention, the nucleotide sequence of SEQ ID NO.5 is as follows:
[0065] 5'-GAATTC TAAGCTCGGTGGAATCAACGAGCTT TAAGCTCGGTGGAATCAACGAGCTT TAAGCTCGG TGGAATCAACGAGCTT TAAGCTCGGTGGAATCAACGAGCTT TAAGCTCGGTGGAATCAACGAGCTT TAAGCTCGGTGGAATCAACGAGCTT TAAGCTCGGTGGAATCAACGAGCTT TAAGCTCGGTGGAATCAACGAGCTTAAGCTT-3'
[0066] Note: Bold bases are restriction enzyme cutting sites.
[0067] In the present invention, the 8×MIM0004 gene is preferably obtained by artificial synthesis. In the present invention, the 8×MIM0004 gene is preferably synthesized by Nanjing GenScript Biotechnology Co., Ltd.
[0068] After obtaining the 8×MIM0004 gene, the present invention preferably clones the 8×MIM0004 gene into a prokaryotic expression vector to obtain a MIM0004 gene vector.
[0069] In the present invention, the MIM0004 gene vector is preferably an interference vector composed of the trc promoter 8×MIM0004 sequence and the rrnB T2 3′ transcription termination region. In the present invention, the marker gene in the MIM0004 gene vector is preferably the lacI gene. In the present invention, the prokaryotic expression vector preferably includes but is not limited to the ptrC99a plasmid.
[0070] The present invention has no particular limitation on the method for cloning the target gene into the prokaryotic expression vector, and any conventional method in the art may be used.
[0071] The method of cloning the MIM0004 gene into a prokaryotic expression vector to obtain the MIM0004 gene expression vector is preferably the same as the method of cloning the sRNA0004 gene into a prokaryotic expression vector to obtain an overexpression sRNA0004 vector, which will not be described in detail here.
[0072] The present invention clones the MIM0004 gene into a prokaryotic expression vector to obtain a MIM0004 gene expression vector. In the present invention, the MIM0004 gene expression vector is preferably a recombinant plasmid ptrC99a-MIM0004. The schematic diagram of the recombinant plasmid ptrC99a-MIM0004 is as follows Figure 4 shown.
[0073] The recombinant plasmid ptrC99a-MIM0004 prepared by the above method can express the MIM0004 gene in bacterial cells, thereby reducing the expression of sRNA0004. Further, the effects of silencing sRNA0004 expression on bacterial drug resistance can be observed and explored. The present invention has discovered that sRNA0004 silencing agents or agents that reduce sRNA0004 expression can reduce bacterial drug resistance.
[0074] The present invention also provides a use of a preparation for reducing the expression of Escherichia coli small RNA sRNA0004 in the preparation of a drug for treating diseases caused by infection with drug-resistant strains of Escherichia coli. The nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO.1.
[0075] In the present invention, the formulation that reduces the expression of the Escherichia coli small RNA sRNA0004 can negatively regulate bacterial drug resistance, reducing bacterial drug resistance, thereby facilitating the prevention, control, and treatment of diseases caused by such bacteria. In the present invention, the formulation that reduces the expression of sRNA0004 includes one or more of the expression cassettes, vectors, or transgenic cells of the MIM0004 gene described in the above technical solution. The vector of the MIM0004 gene preferably includes the recombinant plasmid ptrC99a-MIM0004 described in the above technical solution.
[0076] In the present invention, the Escherichia coli preferably includes, but is not limited to, one or more of enterotoxigenic Escherichia coli, enteroinvasive Escherichia coli, enteropathogenic Escherichia coli, enteroaggregative adhering Escherichia coli and enterohemorrhagic Escherichia coli.
[0077] After obtaining the MIM0004 gene expression vector, the present invention preferably transforms the MIM0004 gene vector into bacteria for use. The present invention does not particularly limit the transformation method, and conventional transformation methods in the art can be used. The present invention preferably directly transforms the MIM0004 gene vector into Escherichia coli by electroporation.
[0078] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0079] Example 1
[0080] Cloning of gene sRNA0004
[0081] The sRNA0004 gene sequence is shown in SEQ ID NO.1, and its secondary stem-loop structure is shown in Figure 1 shown.
[0082] Primers for cloning the sRNA0004 gene were designed. An EcoRI restriction site was introduced at the 5' end of the primer, as shown in SEQ ID NO. 3 for the upstream primer, and a HindIII restriction site was introduced at the 3' end of the primer, as shown in SEQ ID NO. 4 for the downstream primer. PCR amplification was performed using Escherichia coli genomic DNA as a template.
[0083] The PCR system of the target gene (sRNA0004 gene) is shown in Table 1.
[0084] Table 1 PCR system of target gene
[0085] Reagents volume Forwardprimer 1 μL Reverseprimer 1 μL TaqDNA Polymerase Mix 25 μL Template DNA 2μL Sterile water Make up to 50 μL
[0086] The PCR amplification conditions were as follows: 94°C, pre-denaturation for 5 min; 94°C, denaturation for 30 s; 58°C, annealing for 30 s; 72°C, extension for 20 s; 35 amplification cycles; final extension at 72°C for 10 min; and storage at 4°C.
[0087] The PCR product was electrophoresed in 1.4% agarose gel and the target band was recovered using a small amount of agarose gel DNA recovery kit. An appropriate amount of the recovered product was taken and mixed with the TA vector (pMD TM The plasmid was extracted from the positive colonies and sequenced after PCR identification.
[0088] Example 2
[0089] Construction of a vector for overexpressing sRNA0004 in Escherichia coli
[0090] The expression region of the target gene sRNA0004 in the overexpression vector is composed of the lac promoter and the 3′ terminator region of T7, and the selection marker gene is the lac gene.
[0091] The plasmid of Escherichia coli in Example 1 was extracted using the endotoxin-free plasmid miniprep kit (DP118) produced by Tiangen Biochemical Technology Co., Ltd. to obtain a plasmid cloning vector.
[0092] The SRNA0004 gene was digested from the plasmid cloning vector using EcoRI and HindIII restriction endonucleases to obtain the target fragment with restriction sites; the peT28a plasmid was digested using EcoRI and HindIII restriction endonucleases to obtain the vector fragment with restriction sites.
[0093] The enzyme digestion system of target gene / peT28a plasmid is shown in Table 2.
[0094] Table 2 Enzyme digestion system of target gene / peT28a plasmid
[0095] Components Volume / μL 10× Endonuclease Buffer 2 EcoRI 1 HindIII 1 Target gene gel recovery fragment / peT28a plasmid 16
[0096] The enzyme digestion temperature of the target gene and peT28a plasmid was 37°C and the enzyme digestion time was 30 min.
[0097] The target fragment obtained by enzyme digestion was electrophoresed on a 1.4% agarose gel and recovered using a small amount of agarose gel DNA recovery kit to obtain the target fragment with the enzyme cleavage site, i.e., the gel-recovered target gene fragment. The vector fragment obtained by enzyme digestion was electrophoresed on a 1.4% agarose gel and recovered using a small amount of agarose gel DNA recovery kit to obtain the vector fragment with the enzyme cleavage site, i.e., the gel-recovered vector fragment.
[0098] The target gene fragment recovered from the gel and the vector fragment recovered from the gel were ligated with T4 DNA ligase at 25°C for 2 h. The ligation system is shown in Table 3. After the ligation reaction was completed, the overexpression sRNA0004 vector, namely the recombinant plasmid peT28a-sRNA0004, was obtained. Figure 2 shown.
[0099] Table 3 Ligation system of target gene and peT28a plasmid
[0100] Components Volume / μL Vector fragments after gel recovery 1 Target gene fragment after gel recovery 6 5×T4 DNA Ligase Buffer 2 T4DNALigase 1
[0101] The plasmid peT28a-sRNA0004 was directly transformed into the Escherichia coli MG1655 strain by electroporation to obtain the Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004.
[0102] Example 3
[0103] Using MIM (target mimic) technology, a MIM sequence was designed based on bases 43-67 of the sRNA0004 gene. Specifically, an additional 6 bases were inserted between bases 8-10 and 16-18 to obtain the MIM0004 gene to reduce the expression of sRNA0004. The design principle of the MIM0004 gene is as follows: Figure 3 The nucleotide sequence of the MIM0004 gene is shown in SEQ ID NO.2.
[0104] Example 4
[0105] A preparation for reducing sRNA0004 expression, wherein the preparation method is as follows:
[0106] The nucleotide sequence of the 8×MIM0004 gene synthesized by Shanghai GenScript is shown in SEQ ID NO. 5. The nucleotide sequence of the 8×MIM0004 gene has an EcoRI restriction site 5'GAATTC3' added to the 5' end and a HindIII restriction site 5'AAGCTT3' added to the 3' end.
[0107] After obtaining the 8×MIM0004 gene, an interference vector consisting of the trc promoter sequence of the 8×MIM004 gene and the 3′ transcription termination region of rrnB T2 was constructed, and the lacI gene was selected as the marker gene.
[0108] The 8×MIM0004 gene was digested with EcoRI and HindIII restriction endonucleases to obtain a target fragment with restriction sites; the ptrC99a plasmid was digested with EcoRI and HindIII restriction endonucleases to obtain a vector fragment with restriction sites.
[0109] The enzyme digestion system of target gene / ptrC99a plasmid is shown in Table 4.
[0110] Table 4 Enzyme digestion system of target gene / ptrC99a plasmid
[0111] Components Volume / μL 10× Endonuclease Buffer 2 EcoRI 1 HindIII 1 Target gene gel recovery fragment / ptrC99a plasmid 16
[0112] The enzyme digestion temperature of the target gene and ptrC99a plasmid was 37°C and the enzyme digestion time was 30 min.
[0113] The target fragment obtained by enzyme digestion was electrophoresed on a 1.4% agarose gel and recovered using a small amount of agarose gel DNA recovery kit to obtain the target fragment with the enzyme cleavage site, i.e., the gel-recovered target gene fragment. The vector fragment obtained by enzyme digestion was electrophoresed on a 1.4% agarose gel and recovered using a small amount of agarose gel DNA recovery kit to obtain the vector fragment with the enzyme cleavage site, i.e., the gel-recovered vector fragment.
[0114] The target gene fragment recovered from the gel and the vector fragment recovered from the gel were ligated with T4 DNA ligase at 25°C for 2h. The ligation system is shown in Table 5. After the ligation reaction was completed, a preparation for reducing the expression of sRNA0004, namely, the recombinant plasmid ptrC99a-MIM0004, was obtained. Figure 4 shown.
[0115] Table 5 Ligation system of target gene and peT28a plasmid
[0116] Components Volume / μL Vector fragments after gel recovery 1 Target gene fragment after gel recovery 6 5×T4 DNA Ligase Buffer 2 T4DNALigase 1
[0117] The plasmid ptrC99a-MIM0004 was directly transferred into the Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2 by electroporation, and a mutant strain co-overexpressing sRNA0004 and MIM0004 was obtained.
[0118] Example 5
[0119] Extraction of Total RNA from Transgenic Escherichia coli and RT-PCR Detection
[0120] (1) Extraction of bacterial total RNA
[0121] 1. Take a certain amount of bacterial cells and add them to a centrifuge tube pre-cooled with liquid nitrogen (RNase removed in advance). Depending on the material, add an appropriate amount of quartz sand during pre-cooling. When the amount of liquid nitrogen is appropriate, use a pestle to quickly grind it into powder and distribute it into new 1.5mL RNase-free centrifuge tubes, about 100-200mg per tube (the material for extraction should be stored in liquid nitrogen until use, and the rest of the material should be stored in a -80℃ refrigerator);
[0122] 2. Take out the Trizol stored at 4°C, take out the above materials and place them on ice, add 1 mL of Trizol to each tube and mix with Vortex, and let it stand at room temperature for 5 minutes to fully lyse the bacterial tissue;
[0123] 3. Add 200 μL of pre-cooled chloroform to the above centrifuge tube, vortex vigorously for 15 seconds, and let it stand at room temperature for 5 minutes;
[0124] 4. Pre-cool the tube to 4°C and centrifuge at 12,000 rpm for 15 minutes.
[0125] 5. Carefully pipette the supernatant (about 600 μL) into a new RNase-free centrifuge tube, add an equal volume of pre-chilled isopropanol, gently invert to mix, and let stand at room temperature for 10 minutes;
[0126] 6. Centrifuge at 12,000 rpm for 15 min at 4°C and discard the supernatant.
[0127] 7. Add 1 mL of pre-cooled 70% ethanol (prepared with DEPC-ddH2O) and gently flick to mix. Centrifuge at 12,000 rpm for 5 min at 4°C and discard the supernatant.
[0128] 8. Open the lid and place on ice for 5 minutes to evaporate the remaining liquid, then add 34.5 μL DEPC-ddH2O to dissolve it;
[0129] 9. Take an appropriate amount of RNA for electrophoresis detection, place the spare part on ice, and store the rest in a -80℃ refrigerator.
[0130] (2) cDNA synthesis
[0131] The product was stored at -20°C according to the instructions of TakaRa's M-MLV reverse transcriptase.
[0132] (3) Real-time fluorescence quantitative PCR
[0133] Real-time fluorescence quantitative PCR analysis was performed using gapdh as an internal reference gene and cDNA from an Escherichia coli sample as a template. The reaction system is shown in Table 6.
[0134] Table 6 Real-time fluorescence quantitative PCR reaction system
[0135]
[0136]
[0137] Among them, primer 1 is shown as SEQ ID NO.3; primer 2 is shown as SEQ ID NO.4.
[0138] The reaction program was: 94°C for 30 seconds; 94°C for 5 seconds; 60°C for 15 seconds; 72°C for 10 seconds; a total of 40 cycles, and stored at 4°C.
[0139] Use 2 -ΔΔT Data analysis was performed to determine the relative expression levels of genes.
[0140] The above method was used to detect the relative expression levels of the sRNA0004 gene in the wild type, the Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2, and the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4, respectively, to determine the relative expression levels of the sRNA0004 gene.
[0141] The experiment was repeated three times, with three technical replicates at each sampling point. The overexpression strains OEL1, OEL2, OEL3, and OEL4 from Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2 were tested. The MIM interference strains MIML1, MIML2, MIML3, and MIML4 from the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4 were tested.
[0142] Real-time fluorescence quantitative PCR detection results Figure 5 As shown. Figure 5 A in the figure is the relative expression level of SRNA0004 in the overexpression lines OEL1, OEL2, OEL3, and OEL4; Figure 5 B in the figure is the relative expression level of SRNA0004 in the interference strains MIML1, MIML2, MIML3 and MIML4.
[0143] Depend on Figure 5 It was found that the relative expression levels of SRNA0004 in the overexpression strains OEL1, OEL2, OEL3 and OEL4 were significantly higher than those in the wild-type strain; the relative expression levels of SRNA0004 in the interference strains MIML1, MIML2, MIML3 and MIML4 were significantly lower than those in the wild-type strain.
[0144] Example 6
[0145] Analysis of drug resistance of transgenic Escherichia coli
[0146] The specific process for drug resistance analysis of genetically modified Escherichia coli is as follows:
[0147] Drug resistance was tested using the liquid dilution method on the mutant strain of Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2 and the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4. Wild-type Escherichia coli was also tested for drug resistance as a negative control.
[0148] The culture medium used in the drug resistance experiment is as follows: wild-type Escherichia coli, the mutant strain of Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2, and the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4 were cultured in LB medium containing 0.25 mM IPTG and 50 μg / ml Amp (ampicillin), respectively. A low concentration of ampicillin was added to maintain the presence of the plasmid in the bacteria.
[0149] Two antibiotics with different targets were used to act on the bacterial samples. The antibiotics and their final concentrations were 5 μg / mL Gent (gentamicin) and 250 ng / mL IP (imipenem), respectively.
[0150] The drug resistance experiment protocol was as follows: wild-type Escherichia coli, the mutant strain of Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2, and the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4 were wild-type strain WT, overexpression strains (i.e., mutant strains of Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004) OEL1, OEL2, OEL3, and OEL4, and interference strains (i.e., mutant strains co-overexpressing sRNA0004 and MIM0004) MIML1, MIML2, MIML3, and MIML4. Each of the above strains was removed from a -80°C freezer, streaked onto the corresponding culture medium, and cultured overnight at 37°C. The next day, a single colony was picked and plated onto the corresponding culture medium and cultured in a shaker at 37°C at 180 rpm until mid-logarithmic phase.
[0151] The bacterial suspensions of WT, OEL1, OEL2, OEL3, OEL4, MIML1, MIML2, MIML3 and MIML4 cultured to mid-logarithmic phase were divided into three groups, one of which was subjected to antibiotic Gent test, one was subjected to antibiotic IP test, and one group served as control group without antibiotic injection.
[0152] The bacterial solution cultured to the mid-logarithmic phase was diluted with the corresponding culture medium to OD 600The experimental group of the antibiotic Gent test was added to a final concentration of 5μg / mL Gent. At the same time, the experimental group without Gent was set as the control group. The experimental group and the control group were placed in a constant temperature incubator at 25℃ and the speed was 80rpm. After culturing for 16 hours, the tubes were taken out and the OD was recorded. 600 value.
[0153] The bacterial solution cultured to the mid-logarithmic phase was diluted with the corresponding culture medium to OD 600 The experimental group and the control group were placed in a 25°C constant temperature incubator at 80 rpm for 16 hours and the OD values were recorded. 600 value.
[0154] This drug resistance experiment used two antibiotics with different targets to damage Escherichia coli and its genetic mutants. The antibiotics were: gentamicin, which targets the 30s subunit of the ribosome and belongs to the aminoglycoside antibiotic, and imipenem, a carbapenem antibiotic with a carbapenem ring. After obtaining preliminary data, the data of parallel samples were reasonably selected, and the results of each strain were displayed with the OD value of the bacterial liquid. The survival rate of the strain was obtained by taking the average data of the antibiotic-treated group as the numerator and the average data of the control group itself as the denominator. The drug resistance results of the mutant strain of Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2 and the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4 are shown in the figure below. Figure 6 As shown, Figure 6 The horizontal axis represents survival rate. The MIM lines represent the survival rate test results of the mutant strain co-overexpressing sRNA0004 and MIM0004 prepared in Example 4; the OE lines represent the survival rate test results of the mutant strain of Escherichia coli MG1655 containing the recombinant plasmid peT28a-sRNA0004 prepared in Example 2; Line 1 represents strain 1; Line 2 represents strain 2; Line 3 represents strain 3; Line 4 represents strain 4; and WT represents the wild-type strain.
[0155] Preliminary drug resistance data for the mutant strains was observed and analyzed, yielding the following results (for intuitive presentation, each gene mutant is represented by the experimental number): Gene-interference strains better reflect the value and significance of the gene's presence in the organism. Comparing the survival rates of the gene-interference mutants with those of the wild-type strain MG1655 revealed that, under both Gent and IP insults, the survival rate of the strain overexpressing only sRNA0004 was higher than that of the wild-type MG1655 strain. The survival rate of the mutant strain co-overexpressing sRNA0004 and MIM0004 was lower than that of the strain overexpressing only sRNA0004. This suggests that sRNA0004 is crucial for Escherichia coli's resistance to antibiotic damage, providing strain samples for subsequent research into bacterial resistance mechanisms.
[0156] In summary, the Escherichia coli non-coding small RNA sRNA0004 is related to bacterial resistance. The effect of regulating bacterial resistance can be achieved by regulating the expression of sRNA0004. Preparations that reduce the expression of sRNA0004 can negatively regulate bacterial resistance and reduce bacterial resistance.
[0157] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Use of a small RNA sRNA0004 regulatory agent for Escherichia coli in the preparation of a kit for regulating bacterial drug resistance, wherein the nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO. 1; The regulating bacterial resistance is regulating the bacterial resistance to aminoglycoside antibiotics and / or regulating the bacterial resistance to carbapenem antibiotics; the aminoglycoside antibiotic is gentamicin; the carbapenem antibiotic is imipenem; The regulatory agents include positive regulatory agents and negative regulatory agents; The positive regulatory agent is an sRNA0004 overexpression agent; the sRNA0004 overexpression agent is one or more of an expression cassette, a vector or a transgenic cell comprising the sRNA0004 gene; The negative regulatory agent is an agent that reduces the expression of sRNA0004; the agent that reduces the expression of sRNA0004 is one or more of an expression cassette, a vector or a transgenic cell comprising the MIM0004 gene; the nucleotide sequence of the MIM0004 gene is shown in SEQ ID NO.2; The bacteria is Escherichia coli.
2. The use according to claim 1, characterized in that The Escherichia coli includes one or more of enterotoxigenic Escherichia coli, enteroinvasive Escherichia coli, enteropathogenic Escherichia coli, enteroaggregative adhering Escherichia coli and enterohemorrhagic Escherichia coli.
3. A MIM0004 gene that inhibits the expression of the sRNA0004 gene, characterized in that: The nucleotide sequence of the MIM0004 gene is shown in SEQ ID NO.2; the nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO.
1.
4. A preparation for reducing the expression of sRNA0004, characterized in that The preparation comprises one or more of the expression cassette, vector or transgenic cell of the MIM0004 gene according to claim 3; the nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO.
1.
5. Use of a preparation for reducing the expression of Escherichia coli small RNA sRNA0004 in the preparation of a drug for treating diseases caused by infection with drug-resistant strains of Escherichia coli, wherein the nucleotide sequence of the sRNA0004 gene is shown in SEQ ID NO. 1; The drug-resistant strain is an aminoglycoside-resistant strain and / or a carbapenem-resistant strain; the aminoglycoside antibiotic is gentamicin; the carbapenem antibiotic is imipenem; The preparation for reducing the expression of Escherichia coli small RNA sRNA0004 is one or more of an expression cassette, a vector or a transgenic cell containing the MIM0004 gene; the nucleotide sequence of the MIM0004 gene is shown in SEQ ID NO.
2.
6. The use according to claim 5, characterized in that The Escherichia coli includes one or more of enterotoxigenic Escherichia coli, enteroinvasive Escherichia coli, enteropathogenic Escherichia coli, enteroaggregative adhering Escherichia coli and enterohemorrhagic Escherichia coli.
Citation Information
Patent Citations
Escherichia coli sRNA120, DNA molecule, recombinant vector and application of escherichia coli sRNA120 in regulation and control of drug resistance of bacteria
CN114517197A